Hypermethylation of the IRAK3-Activated MAPK Signaling Pathway to Promote the Development of Glioma.

{"sci_version": "1.2", "schema": "https://corpus.bntrg.co.uk/sci/1.0/sci.schema.json", "id": "pmid:32848462", "kind": "science-record", "revision": 9, "content_hash": "sha256:d4f5d0ebc975a6e145236f2b94bb41fafab8c3ebd9e8eb49e8d7fa5b60451e4f", "created_at": "2026-11-01T15:41:08Z", "updated_at": "2026-11-01T22:45:14Z", "generator": {"name": "corpus-assay-engine", "run_id": "reading-sci-2026-11-01"}, "paper": {"state": "complete", "title": "Hypermethylation of the IRAK3-Activated MAPK Signaling Pathway to Promote the Development of Glioma.", "doi": "10.2147/CMAR.S252772", "pmid": "32848462", "authors": ["Xinghai Wu", "Yian Ouyang", "Bin Wang", "Jian Lin", "Yun Bai"], "journal": "Cancer management and research", "year": 2020, "abstract": "OBJECTIVE: This study aimed to elucidate the molecular mechanism underlying the involvement of abnormal DNA methylation in the development of glioma and identify potential new targets for glioma therapy.\nMETHODS: The GSE79122 chip achieved from the Gene Expression Omnibus (GEO) database containing 69 glioma samples and 9 normal samples was analyzed. Methylation-specific polymerase chain reaction (MS-PCR or MSP), reverse transcription-PCR, and Western blot analysis were used to confirm the methylation level and expression level of the interleukin receptor-associated kinase (IRAK3) gene in glioma cells, 36 glioma samples, and the corresponding normal samples. In vitro, the proliferation, apoptosis rate, migration, and invasion abilities of glioma cells were detected by Cell Counting Kit-8 assay, Transwell assay, enzyme-linked immunosorbent assay, and flow cytometry, respectively. Besides, the xenograft assay of nude mice was used to confirm the effect of the IRAK3 on glioma in vivo.\nRESULTS: Microarray analysis showed that the IRAK3 was one of the most hypermethylated genes in glioma, and the related mitogen-activated protein kinase (MAPK) signaling pathway was activated. More experiments supported the higher methylation level and lower expression level of the IRAK3 in glioma tissues and cell lines. The viability, migration, and invasion ability of glioma cells significantly reduced and the apoptosis rate increased with the overexpression and demethylation of the IRAK3 in vitro. Besides, treatment with the MAPK signaling pathway inhibitor PD325901 alone or the overexpression or demethylation of the IRAK3 had a similar effect as the overexpression or demethylation of the IRAK3 alone in glioma cells. In vivo, xenotransplantation experiments in nude mice confirmed that the overexpression and demethylation of the IRAK3 and suppression of the MAPK signaling pathway inhibited the development of glioma.\nCONCLUSION: IRAK3 inhibited the development of glioma progression through the MAPK signaling pathway.", "claims": [{"id": "claim-method", "statement": "Differences between groups were analyzed using Student' t-test or chi-square test.", "kind": "methodological", "target": null, "evidence": [{"asset": "source:pmid:32848462", "locator": "sections[15] \"Statistical Analysis\" paragraph 2", "quote": "Differences between groups were analyzed using Student' t-test or chi-square test."}], "state": "complete"}, {"id": "claim-data-access", "statement": "The DNA methylation data of chip number GSE79122, which contained 69 glioma tissues (36 glioblastomas, 17 diffuse astrocytomas, and 16 anaplastic astrocytomas) and 9 control brain tissues, were analyzed.", "kind": "methodological", "target": null, "evidence": [{"asset": "source:pmid:32848462", "locator": "sections[6] \"Genome-Wide DNA Methylation Analysis\" paragraph 2", "quote": "The DNA methylation data of chip number GSE79122, which contained 69 glioma tissues (36 glioblastomas, 17 diffuse astrocytomas, and 16 anaplastic astrocytomas) and 9 control brain tissues, were analyzed."}], "state": "complete"}], "gaps": []}, "experiment": {"state": "partial", "objective": null, "steps": [{"id": "read_published_estimate", "order": 1, "name": "Read the published estimate from the source", "kind": "other", "state": "complete", "blocked_on": null, "description": "The claim, method and evidence span published with the source article.", "duration_hours": null, "parameters": {}, "inputs": ["source:pmid:32848462"], "outputs": ["the published estimate and its evidence"], "instruments": [], "reagents": []}, {"id": "obtain_source_data", "order": 2, "name": "Obtain the source data from the named repository", "kind": "data-preparation", "state": "complete", "blocked_on": null, "description": "The GEO series accession resolves and its sample accessions are listed. This lane did not download the dataset or read its licence.", "duration_hours": null, "parameters": {}, "inputs": ["data:geo:GSE79122"], "outputs": ["the source data with its repository provenance"], "instruments": [], "reagents": []}, {"id": "run_analysis", "order": 3, "name": "Run the published analysis", "kind": "analysis", "state": "blocked", "blocked_on": "method:student_t", "description": "Apply the paper's statistical method to the resolved series and compare the result with the published target.", "duration_hours": null, "parameters": {}, "inputs": ["data:geo:GSE79122"], "outputs": ["the replicated result and its comparison"], "instruments": [], "reagents": []}], "materials": [], "instruments": [], "reagents": [], "conditions": {}, "gaps": ["step:run_analysis blocked on method:student_t"]}, "data": {"state": "partial", "assets": [{"id": "source:pmid:32848462", "role": "manuscript", "format": "xml", "media_type": "application/xml", "uri": "https://doi.org/10.2147/CMAR.S252772", "sha256": "sha256:a3cc2cb58804a5b83c736ca034dfba3fc9aa603c9cbe75d4fd11c63b5da9a476", "bytes": 35482, "access": "open", "state": "resolved", "reader": null, "reader_status": "reader_required", "identifier": "10.2147/CMAR.S252772", "version": null, "note": "Full article fetched from PMC; the checksum covers the rendered section body, not the original XML bytes.", "structure": {"pmcid": "PMC7425661", "source": "europe_pmc_fulltext", "coverage": "whole_body_without_references", "text_hash_scope": "rendered_section_body"}}, {"id": "data:geo:GSE79122", "role": "raw", "format": "geo-series", "media_type": "application/vnd.ncbi.geo-series+json", "uri": "https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE79122", "sha256": null, "bytes": null, "access": "open", "state": "resolved", "reader": null, "reader_status": "reader_required", "identifier": "GSE79122", "version": null, "note": "The DNA methylation data of chip number GSE79122, which contained 69 glioma tissues (36 glioblastomas, 17 diffuse astrocytomas, and 16 anaplastic astrocytomas) and 9 control brain tissues, were analyzed.", "structure": {"repository": "GEO", "access_route": "GEO accession URL", "access_statement_verbatim": "The DNA methylation data of chip number GSE79122, which contained 69 glioma tissues (36 glioblastomas, 17 diffuse astrocytomas, and 16 anaplastic astrocytomas) and 9 control brain tissues, were analyzed.", "access_statement_kind": "repository_route_statement", "sample_accessions": ["GSM2086323", "GSM2086324", "GSM2086325", "GSM2086326", "GSM2086327", "GSM2086328", "GSM2086329", "GSM2086330", "GSM2086331", "GSM2086332", "GSM2086333", "GSM2086334", "GSM2086335", "GSM2086336", "GSM2086337", "GSM2086338", "GSM2086339", "GSM2086340", "GSM2086341", "GSM2086342", "GSM2086343", "GSM2086344", "GSM2086345", "GSM2086346", "GSM2086347", "GSM2086348", "GSM2086349", "GSM2086350", "GSM2086351", "GSM2086352", "GSM2086353", "GSM2086354", "GSM2086355", "GSM2086356", "GSM2086357", "GSM2086358", "GSM2086359", "GSM2086360", "GSM2086361", "GSM2086362", "GSM2086363", "GSM2086364", "GSM2086365", "GSM2086366", "GSM2086367", "GSM2086368", "GSM2086369", "GSM2086370", "GSM2086371", "GSM2086372", "GSM2086373", "GSM2086374", "GSM2086375", "GSM2086376", "GSM2086377", "GSM2086378", "GSM2086379", "GSM2086380", "GSM2086381", "GSM2086382", "GSM2086383", "GSM2086384", "GSM2086385", "GSM2086386", "GSM2086387", "GSM2086388", "GSM2086389", "GSM2086390", "GSM2086391", "GSM2086392", "GSM2086393", "GSM2086394", "GSM2086395", "GSM2086396", "GSM2086397", "GSM2086398", "GSM2086399", "GSM2086400"], "sample_count": 78, "group_sizes": null, "group_sizes_basis": null, "platform": "13534", "taxon": "Homo sapiens", "title": "Integrative functional genomic analysis identifies epigenetically regulated Fibromodulin as an essential gene for glioma cell migration", "resolution_checked_at": "2026-11-01T15:39:55Z", "resolution_check": "identifier_resolution_only_no_download_no_licence_read", "downloaded": false, "licence_read": false}}, {"id": "asset:table:pmid:32848462:1", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:8856bc0383b5e5ae35435925439a8c292eafa85c187a469111b0bf962181c75e", "bytes": 600, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[7]/table-wrap[1]#T0001", "version": null, "note": "qRT-PCR Primers", "structure": {"pmcid": "PMC7425661", "section_index": 7, "section_title": "Quantitative RT-PCR", "row_count": 9, "column_count": 4}, "table": {"label": "Table 1", "caption": "qRT-PCR Primers", "rows": [["Gene", "Accession Number", "", "Sequence (5ʹ-3ʹ)"], ["IRAK3", "NM_007199", "Forward", "ACCCAAACTAACTGATTTTGCCA"], ["", "", "Reverse", "AGAGAAATTCCGAGGGCAGG"], ["MEK1", "NM_002755", "Forward", "CGACCTCCCATGGCAATTTT"], ["", "", "Reverse", "AACAGAGACAGGCATGGGAA"], ["C-fos", "NM_005252", "Forward", "GCCATCTCGACCAGTCCG"], ["", "", "Reverse", "TCTAGTTGGTCTGTCTCCGC"], ["GAPDH", "NM_008084", "Forward", "TAAATACGGACTGCAGCCCT"], ["", "", "Reverse", "GAGGTCAATGAAGGGGTCGT"]], "row_count": 9, "column_count": 4, "numeric_cells": 5, "header_rows": 1, "locator": "section[7]/table-wrap[1]#T0001"}}, {"id": "asset:table:pmid:32848462:2", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:9312af021e10b162c8b3162de6f0f2e1456b5607e99e0c52486c3dd921976311", "bytes": 411, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[8]/table-wrap[1]#T0002", "version": null, "note": "Methylation-Specific Primers", "structure": {"pmcid": "PMC7425661", "section_index": 8, "section_title": "DNA Methylation Assay", "row_count": 5, "column_count": 2}, "table": {"label": "Table 2", "caption": "Methylation-Specific Primers", "rows": [["Gene", "Sequence (5ʹ-3ʹ)"], ["IRAK3 forward", "5ʹTCGGGATAGTGGTTAATATTTC3ʹ"], ["IRAK3 reverse", "5ʹTTTTTTTCGTTTTTCGTAAAA3ʹ"], ["IRAK3 forward", "5ʹ AGTTTGGGATAGTGGTTAATATTTT 3ʹ"], ["IRAK3 reverse", "5ʹ TTTTTTTCATTTTTCATAAAAAAA 3ʹ"]], "row_count": 5, "column_count": 2, "numeric_cells": 5, "header_rows": 1, "locator": "section[8]/table-wrap[1]#T0002"}}], "gaps": ["asset:data:geo:GSE79122 not downloaded", "asset:data:geo:GSE79122 licence not read"]}, "analysis": {"state": "partial", "methods": [{"id": "method-1", "family": "group_comparison", "specific": "student_t_test", "label": "Group comparison", "dsl_operations": [], "missing_operations": ["student_t"], "expressible": false, "parameters": {}, "data_shapes": ["two_or_more_groups_continuous"], "evidence": {"score": 1.0, "band": "verbatim", "quote": "Differences between groups were analyzed using Student' t-test or chi-square test."}}, {"id": "method-2", "family": "contingency_analysis", "specific": "chi_square", "label": "Categorical (contingency table) analysis", "dsl_operations": ["chi_square_test"], "missing_operations": [], "expressible": true, "parameters": {}, "data_shapes": ["categorical_cross_tabulation"], "evidence": {"score": 0.8, "band": "high", "quote": "chi-square"}}], "targets": [], "gaps": ["method.student_t"]}, "capability": {"state": "complete", "requirements": [{"capability_id": "capability:computational_analysis", "label": "Computational analysis platform", "assay_families": ["meta_analysis", "machine_learning", "survival_analysis", "statistical_regression", "pca", "molecular_docking", "network_analysis", "differential_expression", "gwas"], "availability_state": "owned", "tier_unlocked": "R1", "candidate": "Automated Assays Laravel application and simulated adapters"}], "gaps": []}, "readiness": {"state": "complete", "tier": "R1", "blocking_axis": "none", "blocked_on": "nothing:replicable_now", "axes": {"method": {"tier": "R1", "expressible": false, "required_operations": [], "missing_operations": ["student_t"], "basis": "The paper names the method it used and the corpus's method extractor maps it onto the DSL catalogue: student_t_test."}, "capability": {"tier": "R1", "capability_id": "capability:computational_analysis", "availability_state": "owned", "basis": "The computational analysis is owned. The physical bench the paper used is not, so a physical validation cannot be run here."}, "data": {"tier": "R1", "reachable": true, "accessions": ["GSE79122"], "resolved_accessions": ["GSE79122"], "statements": ["The DNA methylation data of chip number GSE79122, which contained 69 glioma tissues (36 glioblastomas, 17 diffuse astrocytomas, and 16 anaplastic astrocytomas) and 9 control brain tissues, were analyzed."], "basis": "The paper names GSE79122 in Gene Expression Omnibus (GEO) and the accession resolves in the repository. No dataset was downloaded and no licence was read."}}, "can_run": {"dsl_operations": [], "assets": ["source:pmid:32848462", "data:geo:GSE79122", "asset:table:pmid:32848462:1", "asset:table:pmid:32848462:2"], "steps": []}, "must_build": {"dsl_operations": [{"operation": "student_t", "unlocks_papers": null, "priority": null}], "converters": [], "readers": [], "capabilities": [], "data_gaps": ["data:geo:GSE79122"]}, "gaps": []}, "review": {"state": "partial", "machine_critique": {"kind": "extraction_review", "reader": {"model": "MiniMax-M3.1-Flash", "provider": "minimax", "provider_family": "minimax", "read_at": "2026-10-31T18:22:06Z", "independence": "single_reader"}, "evidence_check": {"method": "verbatim", "availability": null}, "calls": 3, "usage": {"prompt_tokens": 27064, "completion_tokens": 1578, "cached_tokens": 792}}, "human_critique": null, "stages": [{"id": "extraction", "state": "complete", "reader": "MiniMax-M3.1-Flash", "provider": "minimax"}], "gaps": ["review.independent_reader", "review.machine_critique", "review.human_critique"]}, "execution": {"state": "absent", "status": "not_run", "mode": null, "runs": [], "gaps": ["execution.not_run"]}, "provenance": {"entities": [{"id": "pmid:32848462", "type": "paper", "label": "pmid:32848462"}, {"id": "source:pmid:32848462", "type": "manuscript", "label": "PMID 32848462 full text"}, {"id": "data:geo:GSE79122", "type": "dataset", "label": "GEO GSE79122"}], "activities": [{"id": "activity-reading-sci-2026-11-01", "type": "classification", "used": [{"id": "pmid:32848462", "type": "paper", "label": "pmid:32848462"}, {"id": "source:pmid:32848462", "type": "manuscript", "label": "PMID 32848462 full text"}, {"id": "data:geo:GSE79122", "type": "dataset", "label": "GEO GSE79122"}], "agent": "agent:corpus-assay-engine"}, {"id": "activity-read-32848462", "type": "extraction", "used": ["source:pmid:32848462"], "agent": "agent:minimax-reader"}, {"id": "activity-resolve-GSE79122", "type": "accession_resolution", "used": ["data:geo:GSE79122"], "agent": "agent:corpus-assay-engine"}], "agents": [{"id": "agent:corpus-assay-engine", "type": "software", "label": "Corpus assay engine"}, {"id": "agent:minimax-reader", "type": "software", "label": "MiniMax literature reader"}], "source_run_id": "reading-sci-2026-11-01", "dsl_catalogue_fingerprint": "343fb30756ba6ec3", "capability_table_fingerprint": "2cb3e42f047d2ecf", "snapshot_id": "ba34b49490d9bfaf"}, "lineage": {"parent_id": "pmid:32848462", "parent_hash": "sha256:2d88418cf134b15a96524fb886a6aef65069149fe1d997314f79265863e7eb2b", "fork_of": null, "generation": 8}, "gaps": ["asset:data:geo:GSE79122 licence not read", "asset:data:geo:GSE79122 not downloaded", "execution.not_run", "method.student_t", "review.human_critique", "review.independent_reader", "review.machine_critique", "step:run_analysis blocked on method:student_t"], "assays": [{"role": "data_generation", "definition_id": "western_blot", "definition_version": "99e1195c7d6f", "definition_digest": null, "required_operations": [], "support_state": "partial", "source_hashes": {"assay_lexicon": "99e1195c7d6f"}, "confidence": 0.93, "evidence": ["-PCR or MSP), reverse transcription-PCR, and Western blot analysis were used to confirm the methylatio"], "order_basis": "paper_text_order:503", "id": "assay:1"}, {"role": "data_generation", "definition_id": "apoptosis_assay", "definition_version": "99e1195c7d6f", "definition_digest": null, "required_operations": [], "support_state": "partial", "source_hashes": {"assay_lexicon": "99e1195c7d6f"}, "confidence": 0.93, "evidence": ["normal samples. In vitro, the proliferation, apoptosis rate, migration, and invasion abilities of g", "f glioma cells significantly reduced and the apoptosis rate increased with the overexpression and d"], "order_basis": "paper_text_order:751", "id": "assay:2"}, {"role": "data_generation", "definition_id": "elisa", "definition_version": "99e1195c7d6f", "definition_digest": null, "required_operations": [], "support_state": "partial", "source_hashes": {"assay_lexicon": "99e1195c7d6f"}, "confidence": 0.93, "evidence": ["Cell Counting Kit-8 assay, Transwell assay, enzyme-linked immunosorbent assay, and flow cytometry, respectively. Besides,"], "order_basis": "paper_text_order:879", "id": "assay:3"}, {"role": "data_generation", "definition_id": "flow_cytometry", "definition_version": "99e1195c7d6f", "definition_digest": null, "required_operations": [], "support_state": "partial", "source_hashes": {"assay_lexicon": "99e1195c7d6f"}, "confidence": 0.93, "evidence": ["ssay, enzyme-linked immunosorbent assay, and flow cytometry, respectively. Besides, the xenograft assay"], "order_basis": "paper_text_order:917", "id": "assay:4"}, {"role": "data_generation", "definition_id": "animal_model", "definition_version": "99e1195c7d6f", "definition_digest": null, "required_operations": [], "support_state": "partial", "source_hashes": {"assay_lexicon": "99e1195c7d6f"}, "confidence": 0.99, "evidence": ["to confirm the effect of the IRAK3 on glioma in vivo. RESULTS: Microarray analysis showed that th", "hylation of the IRAK3 alone in glioma cells. In vivo, xenotransplantation experiments in nude mic"], "order_basis": "paper_text_order:1043", "id": "assay:5"}, {"role": "data_generation", "definition_id": "microarray", "definition_version": "99e1195c7d6f", "definition_digest": null, "required_operations": [], "support_state": "partial", "source_hashes": {"assay_lexicon": "99e1195c7d6f"}, "confidence": 0.93, "evidence": ["ect of the IRAK3 on glioma in vivo. RESULTS: Microarray analysis showed that the IRAK3 was one of th"], "order_basis": "paper_text_order:1061", "id": "assay:6"}, {"role": "analysis", "definition_id": "group_comparison", "definition_version": "f2132e96ae6c7a4e", "definition_digest": null, "required_operations": [], "support_state": "partial", "source_hashes": {"dsl_catalogue": "f2132e96ae6c7a4e"}, "confidence": 1.0, "evidence": ["Differences between groups were analyzed using Student' t-test or chi-square test."], "order_basis": "consumes_earlier_output", "id": "assay:7"}]}