← All .science files
pmid:32870172
Dysregulated circulating SOCS3 and haptoglobin expression associated with stable coronary artery disease and acute coronary syndrome: An integrated study based on bioinformatics analysis and case-control validation.
Xunnan Zhang · Xi Lv · Xiandong Li · Yaping Wang · Hao-Yu Lin · Jicai Zhang · Chunyan Peng
Anatolian journal of cardiology · 2020 doi:10.14744/AnatolJCardiol.2020.56346
Paper
complete
Experiment
complete
Data
partial
Analysis
partial
Execution
absent
Execution evidence has not yet been added to this .science file. Explore its methods, data and open questions to plan the next step.
Record details sci_version · id · kind · revision · content_hash · schema · created_at · updated_at · generator
paper object · 10 fields
authors array · 7 items
claims array · 2 items
[0] object · 6 fields
evidence array · 1 item
[0] object · 3 fields
[1] object · 6 fields
evidence array · 1 item
[0] object · 3 fields
gaps array · 0 items
experiment object · 8 fields
steps array · 3 items
[0] object · 13 fields
parameters object · 0 fields
inputs array · 1 item
outputs array · 1 item
instruments array · 0 items
reagents array · 0 items
[1] object · 13 fields
parameters object · 0 fields
inputs array · 1 item
outputs array · 1 item
instruments array · 0 items
reagents array · 0 items
[2] object · 13 fields
parameters object · 0 fields
inputs array · 1 item
outputs array · 1 item
instruments array · 0 items
reagents array · 0 items
materials array · 0 items
instruments array · 0 items
reagents array · 0 items
conditions object · 0 fields
gaps array · 0 items
data object · 3 fields
assets array · 10 items
[0] object · 15 fields
structure object · 4 fields
[1] object · 15 fields
structure object · 15 fields
sample_accessions array · 436 items
[2] object · 15 fields
structure object · 15 fields
sample_accessions array · 98 items
[3] object · 16 fields
structure object · 5 fields
table object · 8 fields
rows array · 7 items
[0] array · 3 items
[1] array · 3 items
[2] array · 3 items
[3] array · 3 items
[4] array · 3 items
[5] array · 3 items
[6] array · 3 items
[4] object · 16 fields
structure object · 5 fields
table object · 8 fields
rows array · 3 items
[0] array · 2 items
[1] array · 2 items
[2] array · 2 items
[5] object · 16 fields
structure object · 5 fields
table object · 8 fields
rows array · 22 items
[0] array · 4 items
[1] array · 1 item
[2] array · 4 items
[3] array · 4 items
[4] array · 4 items
[5] array · 4 items
[6] array · 4 items
[7] array · 4 items
[8] array · 4 items
[9] array · 4 items
[10] array · 4 items
[11] array · 4 items
[12] array · 4 items
[13] array · 4 items
[14] array · 4 items
[15] array · 4 items
[16] array · 4 items
[17] array · 4 items
[18] array · 4 items
[19] array · 4 items
[20] array · 4 items
[21] array · 4 items
[6] object · 16 fields
structure object · 5 fields
table object · 8 fields
rows array · 29 items
[0] array · 4 items
[1] array · 2 items
[2] array · 6 items
[3] array · 7 items
[4] array · 7 items
[5] array · 7 items
[6] array · 7 items
[7] array · 7 items
[8] array · 7 items
[9] array · 7 items
[10] array · 7 items
[11] array · 7 items
[12] array · 7 items
[13] array · 7 items
[14] array · 7 items
[15] array · 7 items
[16] array · 7 items
[17] array · 7 items
[18] array · 7 items
[19] array · 7 items
[20] array · 7 items
[21] array · 7 items
[22] array · 7 items
[23] array · 7 items
[24] array · 7 items
[25] array · 7 items
[26] array · 7 items
[27] array · 7 items
[28] array · 7 items
[7] object · 16 fields
structure object · 5 fields
table object · 8 fields
rows array · 29 items
[0] array · 4 items
[1] array · 2 items
[2] array · 5 items
[3] array · 6 items
[4] array · 6 items
[5] array · 6 items
[6] array · 6 items
[7] array · 6 items
[8] array · 6 items
[9] array · 6 items
[10] array · 6 items
[11] array · 6 items
[12] array · 6 items
[13] array · 6 items
[14] array · 6 items
[15] array · 6 items
[16] array · 6 items
[17] array · 6 items
[18] array · 6 items
[19] array · 6 items
[20] array · 6 items
[21] array · 6 items
[22] array · 6 items
[23] array · 6 items
[24] array · 6 items
[25] array · 6 items
[26] array · 6 items
[27] array · 6 items
[28] array · 6 items
[8] object · 16 fields
structure object · 5 fields
table object · 8 fields
rows array · 19 items
[0] array · 3 items
[1] array · 2 items
[2] array · 4 items
[3] array · 5 items
[4] array · 5 items
[5] array · 5 items
[6] array · 5 items
[7] array · 5 items
[8] array · 5 items
[9] array · 5 items
[10] array · 5 items
[11] array · 5 items
[12] array · 5 items
[13] array · 5 items
[14] array · 5 items
[15] array · 5 items
[16] array · 5 items
[17] array · 5 items
[18] array · 5 items
[9] object · 16 fields
structure object · 5 fields
table object · 8 fields
rows array · 9 items
[0] array · 4 items
[1] array · 2 items
[2] array · 4 items
[3] array · 6 items
[4] array · 6 items
[5] array · 6 items
[6] array · 6 items
[7] array · 6 items
[8] array · 6 items
gaps array · 4 items
analysis object · 4 fields
methods array · 6 items
[0] object · 10 fields
dsl_operations array · 3 items
missing_operations array · 0 items
parameters object · 0 fields
data_shapes array · 1 item
evidence object · 3 fields
[1] object · 10 fields
dsl_operations array · 0 items
missing_operations array · 1 item
parameters object · 0 fields
data_shapes array · 1 item
[2] object · 10 fields
dsl_operations array · 1 item
missing_operations array · 0 items
parameters object · 1 field
data_shapes array · 1 item
[3] object · 10 fields
dsl_operations array · 3 items
missing_operations array · 0 items
parameters object · 0 fields
data_shapes array · 1 item
[4] object · 10 fields
dsl_operations array · 1 item
missing_operations array · 0 items
parameters object · 0 fields
data_shapes array · 1 item
[5] object · 10 fields
dsl_operations array · 1 item
missing_operations array · 0 items
parameters object · 0 fields
data_shapes array · 1 item
targets array · 0 items
gaps array · 1 item
capability object · 3 fields
requirements array · 1 item
[0] object · 6 fields
assay_families array · 9 items
gaps array · 0 items
readiness object · 8 fields
axes object · 3 fields
method object · 5 fields
required_operations array · 3 items
missing_operations array · 0 items
capability object · 4 fields
data object · 6 fields
accessions array · 2 items
resolved_accessions array · 2 items
statements array · 1 item
can_run object · 3 fields
dsl_operations array · 3 items
assets array · 9 items
steps array · 1 item
must_build object · 5 fields
dsl_operations array · 0 items
converters array · 0 items
readers array · 0 items
capabilities array · 0 items
data_gaps array · 1 item
gaps array · 0 items
review object · 5 fields
machine_critique object · 5 fields
reader object · 5 fields
evidence_check object · 2 fields
usage object · 3 fields
stages array · 1 item
[0] object · 4 fields
gaps array · 3 items
provenance object · 7 fields
entities array · 3 items
activities array · 3 items
[0] object · 4 fields
used array · 3 items
[0] object · 3 fields
[1] object · 3 fields
[2] object · 3 fields
[1] object · 4 fields
agents array · 2 items
lineage object · 4 fields
gaps array · 9 items
assays array · 4 items
[0] object · 11 fields
required_operations array · 0 items
source_hashes object · 1 field
evidence array · 1 item
[1] object · 11 fields
required_operations array · 0 items
source_hashes object · 1 field
evidence array · 2 items
[2] object · 11 fields
required_operations array · 0 items
source_hashes object · 1 field
evidence array · 4 items
[3] object · 11 fields
required_operations array · 3 items
source_hashes object · 1 field
evidence array · 1 item
Complete file
{"sci_version": "1.2", "schema": "https://corpus.bntrg.co.uk/sci/1.0/sci.schema.json", "id": "pmid:32870172", "kind": "science-record", "revision": 9, "content_hash": "sha256:69e1ddcb704e38edf289c1e0ad13a48aef1003bf3784714942274abd44d22f10", "created_at": "2026-11-01T15:41:09Z", "updated_at": "2026-11-01T22:45:16Z", "generator": {"name": "corpus-assay-engine", "run_id": "reading-sci-2026-11-01"}, "paper": {"state": "complete", "title": "Dysregulated circulating SOCS3 and haptoglobin expression associated with stable coronary artery disease and acute coronary syndrome: An integrated study based on bioinformatics analysis and case-control validation.", "doi": "10.14744/AnatolJCardiol.2020.56346", "pmid": "32870172", "authors": ["Xunnan Zhang", "Xi Lv", "Xiandong Li", "Yaping Wang", "Hao-Yu Lin", "Jicai Zhang", "Chunyan Peng"], "journal": "Anatolian journal of cardiology", "year": 2020, "abstract": "OBJECTIVE: To extensively use blood transcriptome analysis to identify potential diagnostic and therapeutic targets for cardiovascular diseases.\nMETHODS: Two gene expression datasets (GSE59867 and GSE62646) were downloaded from GEO DataSets to identify altered blood transcriptomes in patients with ST-segment elevation myocardial infarction (STEMI) compared to stable coronary artery disease (CAD). Thereafter, several computational approaches were taken to determine functional roles and regulatory networks of differentially expressed genes (DEGs). Finally, the expression of dysregulated two hub genes-suppressor of cytokine signaling 3 (SOCS3) and haptoglobin (HP)-were validated in a case-control study.\nRESULTS: A total of 119 DEGs were identified in the discovery phase, consisting of 71 downregulated genes and 48 upregulated genes; two hub modules consisting of two hub genes-SOCS3 and HP-were identified. In the validation phase, both SOCS3 and HP were significantly downregulated in the stable CAD and acute coronary syndrome (ACS) patients when compared with healthy controls. Meanwhile, HP was significantly upregulated in STEMI patients when compared with stable CAD patients (p=0.041). Logistic regression analysis indicated that: downregulated expression of HP correlated with increased risk of CAD [odds ratio (OR)=0.52, 95% confidence interval (CI)=0.31~0.87, p=0.013]; and downregulated expression of SOCS3 correlated with increased risk of ACS (OR=0.66, 95% CI=0.46~0.94, p=0.023) when age, gender, history of hyperlipidemia, diabetes and hypertension were included as covariates.\nCONCLUSION: Future clarification of how SOCS3 and HP influence the pathogenesis of disease may pave the way for the development of novel diagnostic and therapeutic methods.", "claims": [{"id": "claim-method", "statement": "The raw microarray data of the two datasets downloaded from the GEO database (9) were processed with the LIMMA package of the R language (http://www.R-project.org, The R Foundation) to identify genes that were differentially expressed in peripheral blood between stable CAD patients and STEMI patients.", "kind": "methodological", "target": null, "evidence": [{"asset": "source:pmid:32870172", "locator": "sections[2] \"Methods\" paragraph 4", "quote": "The raw microarray data of the two datasets downloaded from the GEO database (9) were processed with the LIMMA package of the R language (http://www.R-project.org, The R Foundation) to identify genes that were differentially expressed in peripheral blood between stable CAD patients and STEMI patients."}], "state": "complete"}, {"id": "claim-data-access", "statement": "only two datasets were selected as discovery datasets for performing the differential analyses [(GSE62646: stable CAD (14 samples) vs. STEMI (28 samples) and GSE59867: stable CAD (46 samples) vs. STEMI (111 samples)].", "kind": "methodological", "target": null, "evidence": [{"asset": "source:pmid:32870172", "locator": "sections[2] \"Methods\" paragraph 3", "quote": "only two datasets were selected as discovery datasets for performing the differential analyses [(GSE62646: stable CAD (14 samples) vs. STEMI (28 samples) and GSE59867: stable CAD (46 samples) vs. STEMI (111 samples)]."}], "state": "complete"}], "gaps": []}, "experiment": {"state": "complete", "objective": null, "steps": [{"id": "read_published_estimate", "order": 1, "name": "Read the published estimate from the source", "kind": "other", "state": "complete", "blocked_on": null, "description": "The claim, method and evidence span published with the source article.", "duration_hours": null, "parameters": {}, "inputs": ["source:pmid:32870172"], "outputs": ["the published estimate and its evidence"], "instruments": [], "reagents": []}, {"id": "obtain_source_data", "order": 2, "name": "Obtain the source data from the named repository", "kind": "data-preparation", "state": "complete", "blocked_on": null, "description": "The GEO series accession resolves and its sample accessions are listed. This lane did not download the dataset or read its licence.", "duration_hours": null, "parameters": {}, "inputs": ["data:geo:GSE59867"], "outputs": ["the source data with its repository provenance"], "instruments": [], "reagents": []}, {"id": "run_analysis", "order": 3, "name": "Run the published analysis", "kind": "analysis", "state": "complete", "blocked_on": null, "description": "Apply the paper's statistical method to the resolved series and compare the result with the published target.", "duration_hours": null, "parameters": {}, "inputs": ["data:geo:GSE59867"], "outputs": ["the replicated result and its comparison"], "instruments": [], "reagents": []}], "materials": [], "instruments": [], "reagents": [], "conditions": {}, "gaps": []}, "data": {"state": "partial", "assets": [{"id": "source:pmid:32870172", "role": "manuscript", "format": "xml", "media_type": "application/xml", "uri": "https://doi.org/10.14744/AnatolJCardiol.2020.56346", "sha256": "sha256:9c63db349a08814849ae499b341fb8aaa4df49fd429f03041d8fdacab2f697b5", "bytes": 45239, "access": "open", "state": "resolved", "reader": null, "reader_status": "reader_required", "identifier": "10.14744/AnatolJCardiol.2020.56346", "version": null, "note": "Full article fetched from PMC; the checksum covers the rendered section body, not the original XML bytes.", "structure": {"pmcid": "PMC7585973", "source": "europe_pmc_fulltext", "coverage": "whole_body", "text_hash_scope": "rendered_section_body"}}, {"id": "data:geo:GSE59867", "role": "raw", "format": "geo-series", "media_type": "application/vnd.ncbi.geo-series+json", "uri": "https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE59867", "sha256": null, "bytes": null, "access": "open", "state": "resolved", "reader": null, "reader_status": "reader_required", "identifier": "GSE59867", "version": null, "note": "only two datasets were selected as discovery datasets for performing the differential analyses [(GSE62646: stable CAD (14 samples) vs. STEMI (28 samples) and GSE59867: stable CAD (46 samples) vs. STEMI (111 samples)].", "structure": {"repository": "GEO", "access_route": "GEO accession URL", "access_statement_verbatim": "only two datasets were selected as discovery datasets for performing the differential analyses [(GSE62646: stable CAD (14 samples) vs. STEMI (28 samples) and GSE59867: stable CAD (46 samples) vs. STEMI (111 samples)].", "access_statement_kind": "repository_route_statement", "sample_accessions": ["GSM1448335", "GSM1448336", "GSM1448337", "GSM1448338", "GSM1448339", "GSM1448340", "GSM1448341", "GSM1448342", "GSM1448343", "GSM1448344", "GSM1448345", "GSM1448346", "GSM1448347", "GSM1448348", "GSM1448349", "GSM1448350", "GSM1448351", "GSM1448352", "GSM1448353", "GSM1448354", "GSM1448355", "GSM1448356", "GSM1448357", "GSM1448358", "GSM1448359", "GSM1448360", "GSM1448361", "GSM1448362", "GSM1448363", "GSM1448364", "GSM1448365", "GSM1448366", "GSM1448367", "GSM1448368", "GSM1448369", "GSM1448370", "GSM1448371", "GSM1448372", "GSM1448373", "GSM1448374", "GSM1448375", "GSM1448376", "GSM1448377", "GSM1448378", "GSM1448379", "GSM1448380", "GSM1448381", "GSM1448382", "GSM1448383", "GSM1448384", "GSM1448385", "GSM1448386", "GSM1448387", "GSM1448388", "GSM1448389", "GSM1448390", "GSM1448391", "GSM1448392", "GSM1448393", "GSM1448394", "GSM1448395", "GSM1448396", "GSM1448397", "GSM1448398", "GSM1448399", "GSM1448400", "GSM1448401", "GSM1448402", "GSM1448403", "GSM1448404", "GSM1448405", "GSM1448406", "GSM1448407", "GSM1448408", "GSM1448409", "GSM1448410", "GSM1448411", "GSM1448412", "GSM1448413", "GSM1448414", "GSM1448415", "GSM1448416", "GSM1448417", "GSM1448418", "GSM1448419", "GSM1448420", "GSM1448421", "GSM1448422", "GSM1448423", "GSM1448424", "GSM1448425", "GSM1448426", "GSM1448427", "GSM1448428", "GSM1448429", "GSM1448430", "GSM1448431", "GSM1448432", "GSM1448433", "GSM1448434", "GSM1448435", "GSM1448436", "GSM1448437", "GSM1448438", "GSM1448439", "GSM1448440", "GSM1448441", "GSM1448442", "GSM1448443", "GSM1448444", "GSM1448445", "GSM1448446", "GSM1448447", "GSM1448448", "GSM1448449", "GSM1448450", "GSM1448451", "GSM1448452", "GSM1448453", "GSM1448454", "GSM1448455", "GSM1448456", "GSM1448457", "GSM1448458", "GSM1448459", "GSM1448460", "GSM1448461", "GSM1448462", "GSM1448463", "GSM1448464", "GSM1448465", "GSM1448466", "GSM1448467", "GSM1448468", "GSM1448469", "GSM1448470", "GSM1448471", "GSM1448472", "GSM1448473", "GSM1448474", "GSM1448475", "GSM1448476", "GSM1448477", "GSM1448478", "GSM1448479", "GSM1448480", "GSM1448481", "GSM1448482", "GSM1448483", "GSM1448484", "GSM1448485", "GSM1448486", "GSM1448487", "GSM1448488", "GSM1448489", "GSM1448490", "GSM1448491", "GSM1448492", "GSM1448493", "GSM1448494", "GSM1448495", "GSM1448496", "GSM1448497", "GSM1448498", "GSM1448499", "GSM1448500", "GSM1448501", "GSM1448502", "GSM1448503", "GSM1448504", "GSM1448505", "GSM1448506", "GSM1448507", "GSM1448508", "GSM1448509", "GSM1448510", "GSM1448511", "GSM1448512", "GSM1448513", "GSM1448514", "GSM1448515", "GSM1448516", "GSM1448517", "GSM1448518", "GSM1448519", "GSM1448520", "GSM1448521", "GSM1448522", "GSM1448523", "GSM1448524", "GSM1448525", "GSM1448526", "GSM1448527", "GSM1448528", "GSM1448529", "GSM1448530", "GSM1448531", "GSM1448532", "GSM1448533", "GSM1448534", "GSM1448535", "GSM1448536", "GSM1448537", "GSM1448538", "GSM1448539", "GSM1448540", "GSM1448541", "GSM1448542", "GSM1448543", "GSM1448544", "GSM1448545", "GSM1448546", "GSM1448547", "GSM1448548", "GSM1448549", "GSM1448550", "GSM1448551", "GSM1448552", "GSM1448553", "GSM1448554", "GSM1448555", "GSM1448556", "GSM1448557", "GSM1448558", "GSM1448559", "GSM1448560", "GSM1448561", "GSM1448562", "GSM1448563", "GSM1448564", "GSM1448565", "GSM1448566", "GSM1448567", "GSM1448568", "GSM1448569", "GSM1448570", "GSM1448571", "GSM1448572", "GSM1448573", "GSM1448574", "GSM1448575", "GSM1448576", "GSM1448577", "GSM1448578", "GSM1448579", "GSM1448580", "GSM1448581", "GSM1448582", "GSM1448583", "GSM1448584", "GSM1448585", "GSM1448586", "GSM1448587", "GSM1448588", "GSM1448589", "GSM1448590", "GSM1448591", "GSM1448592", "GSM1448593", "GSM1448594", "GSM1448595", "GSM1448596", "GSM1448597", "GSM1448598", "GSM1448599", "GSM1448600", "GSM1448601", "GSM1448602", "GSM1448603", "GSM1448604", "GSM1448605", "GSM1448606", "GSM1448607", "GSM1448608", "GSM1448609", "GSM1448610", "GSM1448611", "GSM1448612", "GSM1448613", "GSM1448614", "GSM1448615", "GSM1448616", "GSM1448617", "GSM1448618", "GSM1448619", "GSM1448620", "GSM1448621", "GSM1448622", "GSM1448623", "GSM1448624", "GSM1448625", "GSM1448626", "GSM1448627", "GSM1448628", "GSM1448629", "GSM1448630", "GSM1448631", "GSM1448632", "GSM1448633", "GSM1448634", "GSM1448635", "GSM1448636", "GSM1448637", "GSM1448638", "GSM1448639", "GSM1448640", "GSM1448641", "GSM1448642", "GSM1448643", "GSM1448644", "GSM1448645", "GSM1448646", "GSM1448647", "GSM1448648", "GSM1448649", "GSM1448650", "GSM1448651", "GSM1448652", "GSM1448653", "GSM1448654", "GSM1448655", "GSM1448656", "GSM1448657", "GSM1448658", "GSM1448659", "GSM1448660", "GSM1448661", "GSM1448662", "GSM1448663", "GSM1448664", "GSM1448665", "GSM1448666", "GSM1448667", "GSM1448668", "GSM1448669", "GSM1448670", "GSM1448671", "GSM1448672", "GSM1448673", "GSM1448674", "GSM1448675", "GSM1448676", "GSM1448677", "GSM1448678", "GSM1448679", "GSM1448680", "GSM1448681", "GSM1448682", "GSM1448683", "GSM1448684", "GSM1448685", "GSM1448686", "GSM1448687", "GSM1448688", "GSM1448689", "GSM1448690", "GSM1448691", "GSM1448692", "GSM1448693", "GSM1448694", "GSM1448695", "GSM1448696", "GSM1448697", "GSM1448698", "GSM1448699", "GSM1448700", "GSM1448701", "GSM1448702", "GSM1448703", "GSM1448704", "GSM1448705", "GSM1448706", "GSM1448707", "GSM1448708", "GSM1448709", "GSM1448710", "GSM1448711", "GSM1448712", "GSM1448713", "GSM1448714", "GSM1448715", "GSM1448716", "GSM1448717", "GSM1448718", "GSM1448719", "GSM1448720", "GSM1448721", "GSM1448722", "GSM1448723", "GSM1448724", "GSM1620759", "GSM1620760", "GSM1620761", "GSM1620762", "GSM1620763", "GSM1620764", "GSM1620765", "GSM1620766", "GSM1620767", "GSM1620768", "GSM1620769", "GSM1620770", "GSM1620771", "GSM1620772", "GSM1620773", "GSM1620774", "GSM1620775", "GSM1620776", "GSM1620777", "GSM1620778", "GSM1620779", "GSM1620780", "GSM1620781", "GSM1620782", "GSM1620783", "GSM1620784", "GSM1620785", "GSM1620786", "GSM1620787", "GSM1620788", "GSM1620789", "GSM1620790", "GSM1620791", "GSM1620792", "GSM1620793", "GSM1620794", "GSM1620795", "GSM1620796", "GSM1620797", "GSM1620798", "GSM1620799", "GSM1620800", "GSM1620801", "GSM1620802", "GSM1620803", "GSM1620804"], "sample_count": 436, "group_sizes": null, "group_sizes_basis": null, "platform": "6244", "taxon": "Homo sapiens", "title": "Gene expression profiling reveals potential prognostic biomarkers associated with the progression of heart failure", "resolution_checked_at": "2026-11-01T15:39:54Z", "resolution_check": "identifier_resolution_only_no_download_no_licence_read", "downloaded": false, "licence_read": false}}, {"id": "data:geo:GSE62646", "role": "raw", "format": "geo-series", "media_type": "application/vnd.ncbi.geo-series+json", "uri": "https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE62646", "sha256": null, "bytes": null, "access": "open", "state": "resolved", "reader": null, "reader_status": "reader_required", "identifier": "GSE62646", "version": null, "note": "only two datasets were selected as discovery datasets for performing the differential analyses [(GSE62646: stable CAD (14 samples) vs. STEMI (28 samples) and GSE59867: stable CAD (46 samples) vs. STEMI (111 samples)].", "structure": {"repository": "GEO", "access_route": "GEO accession URL", "access_statement_verbatim": "only two datasets were selected as discovery datasets for performing the differential analyses [(GSE62646: stable CAD (14 samples) vs. STEMI (28 samples) and GSE59867: stable CAD (46 samples) vs. STEMI (111 samples)].", "access_statement_kind": "repository_route_statement", "sample_accessions": ["GSM1530765", "GSM1530766", "GSM1530767", "GSM1530768", "GSM1530769", "GSM1530770", "GSM1530771", "GSM1530772", "GSM1530773", "GSM1530774", "GSM1530775", "GSM1530776", "GSM1530777", "GSM1530778", "GSM1530779", "GSM1530780", "GSM1530781", "GSM1530782", "GSM1530783", "GSM1530784", "GSM1530785", "GSM1530786", "GSM1530787", "GSM1530788", "GSM1530789", "GSM1530790", "GSM1530791", "GSM1530792", "GSM1530793", "GSM1530794", "GSM1530795", "GSM1530796", "GSM1530797", "GSM1530798", "GSM1530799", "GSM1530800", "GSM1530801", "GSM1530802", "GSM1530803", "GSM1530804", "GSM1530805", "GSM1530806", "GSM1530807", "GSM1530808", "GSM1530809", "GSM1530810", "GSM1530811", "GSM1530812", "GSM1530813", "GSM1530814", "GSM1530815", "GSM1530816", "GSM1530817", "GSM1530818", "GSM1530819", "GSM1530820", "GSM1530821", "GSM1530822", "GSM1530823", "GSM1530824", "GSM1530825", "GSM1530826", "GSM1530827", "GSM1530828", "GSM1530829", "GSM1530830", "GSM1530831", "GSM1530832", "GSM1530833", "GSM1530834", "GSM1530835", "GSM1530836", "GSM1530837", "GSM1530838", "GSM1530839", "GSM1530840", "GSM1530841", "GSM1530842", "GSM1530843", "GSM1530844", "GSM1530845", "GSM1530846", "GSM1530847", "GSM1530848", "GSM1530849", "GSM1530850", "GSM1530851", "GSM1530852", "GSM1530853", "GSM1530854", "GSM1530855", "GSM1530856", "GSM1530857", "GSM1530858", "GSM1530859", "GSM1530860", "GSM1530861", "GSM1530862"], "sample_count": 98, "group_sizes": null, "group_sizes_basis": null, "platform": "6244", "taxon": "Homo sapiens", "title": "Altered gene expression pattern in peripheral blood mononuclear cells in patients with acute myocardial infarction", "resolution_checked_at": "2026-11-01T15:39:55Z", "resolution_check": "identifier_resolution_only_no_download_no_licence_read", "downloaded": false, "licence_read": false}}, {"id": "asset:table:pmid:32870172:1", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:aa3476a3e51404cc01bc992547e115dc7c52b76c557f674ac481ec935463002e", "bytes": 465, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[2]/table-wrap[1]#T1", "version": null, "note": "Primer sequences used for qPCR", "structure": {"pmcid": "PMC7585973", "section_index": 2, "section_title": "Methods", "row_count": 7, "column_count": 3}, "table": {"label": "Table S1", "caption": "Primer sequences used for qPCR", "rows": [["Gene name", "Primer sequence 5’-3’", "Method"], ["SOCS3", "F: AGCAGCGATGGAATTACCTGGAAC", "qPCR"], ["", "R: TCCAGCCCAATACCTGACACAGAA", ""], ["HP", "F: TGAATGTGAAGCAGTATGTGGGA", "qPCR"], ["", "R: CATTGATCAGCGTGGCACC", ""], ["GAPDH", "F: GAAGGTGAAGGTCGGAGTC", "qPCR"], ["", "R: GAAGATGGTGATGGGATTTC", ""]], "row_count": 7, "column_count": 3, "numeric_cells": 1, "header_rows": 1, "locator": "section[2]/table-wrap[1]#T1"}}, {"id": "asset:table:pmid:32870172:2", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:fb2de8028cf6c16f7446291b3560a18d2ec6b80b9e416a13416d60ff59e4f751", "bytes": 1271, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[4]/table-wrap[1]#T2", "version": null, "note": "One hundred nineteen DEGs were screened from GSE59867, GSE62646 microarrays for STEMI", "structure": {"pmcid": "PMC7585973", "section_index": 4, "section_title": "Results", "row_count": 3, "column_count": 2}, "table": {"label": "Table 1", "caption": "One hundred nineteen DEGs were screened from GSE59867, GSE62646 microarrays for STEMI", "rows": [["DEGs", "Gene symbol*"], ["Upregulated (48)", "LILRB4, FCGR1CP, FCGR1B, FCGR1A, STAB1, VSIG4, EDA2R, MIR223, CYP27A1, TNFAIP6, FMN1, RNASE1, STEAP4, ASGR2, TRIB1, NFE2, PRR13, FAM20C, AQP9, ECRP, RNASE2, LOC441081, FAM20A, SOCS3, SASH1, SLED1, TCN2, GPR162, CCR1, SIGLEC16, PPARG, ADM, SIGLEC9, LILRA5, LILRA3, TBC1D2, SH3PXD2B, LILRA6, FLVCR2, PLB1, CYP1B1, HP, CR1,TMEM176A, PADI2, EGR1, DYSF, ST14, TMEM150B, TSPO"], ["Downregulated (71)", "MYBL1, SNHG16, SNORD61, EPB41L4A, SNORD82, FGFBP2, DTHD1, SNORD45C, TGFBR3, SYNE2, PDGFD, BIRC3, FAM169A, KLRF1, KLRC1, CLEC2D, RORA, SH2D1A, SAMD3, TARP, CEP78, KLRC4-KLRK1, CD226, SNORA16A, SCARNA9, CLC, SNORD45B, SCARNA9L, SNORD54, SNORD58A, SNORD28, SNORD50A, HLA-DOB, HRH4, SNHG1, MYO6, SNORD59B, KLRG1, ODF2L, SNORD81, JAKMIP2, SNHG1, GNG2, LOC102725104, GBP5, C12orf75, NPM1, ARAP2, SNORA8, CPA3, KLRC4-KLRK1, KLRC3, VPS13A, KLRA1P, SYTL2, KLRC4-KLRK1, SLC4A4, PRSS23, SNORA20, SLCO4C1, KPNA5, SNORD6///TAF1D, MS4A3, KLRC2, SNORD73A, KLRD1, SNORD30, IL18RAP, C1orf21, WEE1, LINC00680-GUSBP4"]], "row_count": 3, "column_count": 2, "numeric_cells": 4, "header_rows": 1, "locator": "section[4]/table-wrap[1]#T2"}}, {"id": "asset:table:pmid:32870172:3", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:ed0b8a19453b2bfeefc84b6dc55655d00d2202c899883bf54f27f5a112e87830", "bytes": 1548, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[4]/table-wrap[2]#T3", "version": null, "note": "Significant enriched GO terms and Kyoto Encyclopedia of Genes and Genomes pathways of common differentially expressed genes", "structure": {"pmcid": "PMC7585973", "section_index": 4, "section_title": "Results", "row_count": 22, "column_count": 4}, "table": {"label": "Table S2", "caption": "Significant enriched GO terms and Kyoto Encyclopedia of Genes and Genomes pathways of common differentially expressed genes", "rows": [["Term", "Description", "Count", "P-value"], ["Biological process"], ["GO:0007166", "Cell surface receptor signaling pathway", "10", "5.46E-06"], ["GO:0050776", "Regulation of immune response", "8", "2.04E-05"], ["GO:0045087", "Innate immune response", "9", "9.23E-04"], ["GO:0007165", "Signal transduction", "14", "2.83E-03"], ["GO:0006968", "Cellular defense response", "4", "3.10E-03"], ["GO:0045954", "Positive regulation of natural killer cell mediated cytotoxicity", "3", "3.18E-03"], ["GO:0002250", "Adaptive immune response", "5", "5.22E-03"], ["GO:0006954", "Inflammatory response", "7", "8.86E-03"], ["GO:0002228", "Natural killer cell mediated immunity", "2", "9.39E-03"], ["GO:0031100", "Organ regeneration", "3", "2.06E-02"], ["GO:0007155", "Cell adhesion", "7", "2.10E-02"], ["GO:0060850", "Regulation of transcription involved in cell fate commitment", "2", "2.33E-02"], ["GO:0070301", "Cellular response to hydrogen peroxide", "3", "2.95E-02"], ["GO:0007267", "Cell–cell signaling", "5", "3.18E-02"], ["GO:0060670", "Branching involved in labyrinthine layer morphogenesis", "2", "4.16E-02"], ["GO:0006955", "Immune response", "6", "4.82E-02"], ["KEGG pathway", "", "", ""], ["hsa04380", "Osteoclast differentiation", "6", "5.44E-04"], ["hsa04612", "Antigen processing and presentation", "5", "6.20E-04"], ["hsa05321", "IBD", "3", "4.38E-02"]], "row_count": 22, "column_count": 4, "numeric_cells": 57, "header_rows": 1, "locator": "section[4]/table-wrap[2]#T3"}}, {"id": "asset:table:pmid:32870172:4", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:29b49c1e41b2415757b99ed0dea12ac976a4cf95714b80039e3dca3335567537", "bytes": 2366, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[4]/table-wrap[3]#T4", "version": null, "note": "General characteristics of the study participants", "structure": {"pmcid": "PMC7585973", "section_index": 4, "section_title": "Results", "row_count": 29, "column_count": 7}, "table": {"label": "Table 2", "caption": "General characteristics of the study participants", "rows": [["Characteristic", "", "Patients", "P"], ["", ""], ["Controls (n=100)", "Stable CAD (n=100)", "ACS (n=102)", "", "P1", "P2"], ["Demographics", "", "", "", "", "", ""], ["Age (years)", "57.39±7.69", "58.32±8.39", "59.74±9.67", "0.415", "0.057", "0.415"], ["Male", "43", "51", "68", "0.321", "0.001", "0.321"], ["Risk factors", "", "", "", "", "", ""], ["Hypertension (%)", "12", "55", "51", "<0.001", "<0.001", "<0.001"], ["Diabetes mellitus (%)", "0", "29", "23", "<0.001", "<0.001", "<0.001"], ["Hyperlipidemia (%)", "0", "12", "12", "<0.001", "<0.001", "<0.001"], ["Clinical parameters", "", "", "", "", "", ""], ["TC (mmol/L)", "5.04±0.84", "3.73±0.99", "3.92±1.01", "<0.001", "<0.001", "<0.001"], ["TG (mmol/L)", "1.04 (0.76, 1.33)", "1.45 (0.83, 2.02)", "1.16 (0.84, 1.98)", "<0.001", "0.002", "<0.001"], ["HDL-C (mmol/L)", "1.60±0.35", "1.05±0.27", "1.04±0.26", "<0.001", "<0.001", "<0.001"], ["LDL-C (mmol/L)", "2.42±0.54", "2.01±0.70", "2.18±0.75", "<0.001", "0.016", "<0.001"], ["Apo-A1 (g/L)", "1.65±0.21", "1.49±0.24", "1.41±0.28", "<0.001", "<0.001", "<0.001"], ["Apo-B (g/L)", "0.89±0.17", "0.84±0.19", "0.86±0.20", "0.112", "0.291", "0.112"], ["LP(a) (mg/L)", "90.45±88.38", "176.21±204.23", "166.20±170.11", "0.011", "0.008", "0.011"], ["AST (IU/L)", "25.00 (22.00, 29.00)", "22.00 (17.00, 30.00)", "28.00 (18.25, 59.50)", "0.017", "0.001", "0.017"], ["CK(IU/L)", "113.77±64.89", "76.68±38.63", "294.60±493.64", "<0.001", "<0.001", "<0.001"], ["CKMB (IU/L)", "7.16±4.86", "13.51±9.98", "31.59±53.90", "<0.001", "<0.001", "<0.001"], ["LDH (IU/L)", "205.11±142.39", "183.10±52.55", "250.59±120.35", "0.297", "0.336", "0.297"], ["HBDH (IU/L)", "127.05±22.99", "119.05±27.98", "182.22±108.70", "0.046", "<0.001", "0.046"], ["hs-CRP (mg/L)", "4.06 (2.41, 6.11)", "3.36 (1.30, 8.25)", "6.52 (2.84, 17.17)", "0.138", "<0.001", "0.138"], ["HCY (µmol/L)", "12.10 (9.90, 14.80)", "13.00 (8.65, 15.97)", "15.40 (11.05, 20.20)", "0.974", "0.023", "0.974"], ["CysC (mg/L)", "0.60±0.09", "0.65 (0.56,0.73)", "0.63±0.20", "<0.001", "0.052", "<0.001"], ["GSP (mmol/L)", "2.60±0.274", "2.77±0.54", "1.73±1.07", "0.014", "<0.001", "0.014"], ["SOCS3 (fold change)", "1.00±1.04", "0.84±0.83", "0.75±0.68", "0.040", "0.005", "0.040"], ["HP (fold change)", "1.00±0.70", "0.54±0.73", "0.73±0.72", "0.001", "0.048", "0.001"]], "row_count": 29, "column_count": 7, "numeric_cells": 141, "header_rows": 3, "locator": "section[4]/table-wrap[3]#T4"}}, {"id": "asset:table:pmid:32870172:5", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:1d3ec4d309b3a46fcfb92a938e9ed39c1ec2b09ff68a365a1e5afcccdf92d660", "bytes": 2158, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[4]/table-wrap[4]#T5", "version": null, "note": "General characteristics of the study participants", "structure": {"pmcid": "PMC7585973", "section_index": 4, "section_title": "Results", "row_count": 29, "column_count": 6}, "table": {"label": "Table S3", "caption": "General characteristics of the study participants", "rows": [["Characteristic", "", "ACS patients", "P"], ["", ""], ["Stable CAD (n=100)", "STEMI (n=100)", "NSTEMI (n=87)", "P1", "P2"], ["Demographics", "", "", "", "", ""], ["Age (years)", "58.32±8.39", "59.52±10.17", "64.86±7.56", "0.375", "0.005"], ["Male", "51", "58", "10", "0.037", "0.283"], ["Risk factors", "", "", "", "", ""], ["Hypertension (%)", "55", "42", "9", "0.382", "0.786"], ["Diabetes mellitus (%)", "29", "20", "3", "0.406", "0.553"], ["Hyperlipidemia (%)", "12", "8", "4", "0.638", "0.221"], ["Clinical parameters", "", "", "", "", ""], ["TC (mmol/L)", "3.73±0.97", "3.90±1.01", "3.90±1.01", "0.279", "0.299"], ["TG (mmol/L)", "1.45 (0.83, 2.02)", "1.15 (0.84, 1.98)", "1.33 (0.98, 2.04)", "0.125", "0.560"], ["HDL-C (mmol/L)", "1.05±0.27", "1.04±0.27", "1.06±0.27", "0.742", "0.939"], ["LDL-C (mmol/L)", "2.01±0.70", "2.14±0.73", "2.45±0.89", "0.242", "0.054"], ["Apo-A1 (g/L)", "1.49±0.24", "1.43±0.29", "1.41±0.28", "0.249", "0.017"], ["Apo-B (g/L)", "0.84±0.19", "0.85±0.20", "0.89±0.20", "0.724", "0.519"], ["LP(a) (mg/L)", "176.21±204.23", "167.53±176.30", "152.03±86.07", "0.798", "0.776"], ["AST (IU/L)", "22.00 (17.00, 30.00)", "27.00 (18.00, 58.00)", "40.50 (25.25, 59.75)", "<0.001", "0.002"], ["CK(IU/L)", "76.68±38.63", "303.48±524.34", "239.33±235.06", "<0.001", "0.072"], ["CKMB (IU/L)", "13.51±9.98", "31.87±57.67", "29.88±20.43", "0.029", "0.043"], ["LDH (IU/L)", "183.10±52.55", "241.55±107.31", "305.89±179.85", "0.001", "0.076"], ["HBDH (IU/L)", "119.05±27.98", "174.47±94.50", "229.56±165.11", "<0.001", "0.077"], ["hs-CRP (mg/L)", "3.36 (1.30, 8.25)", "5.67 (2.78, 16.57)", "12.66 (3.05, 20.84)", "0.002", "0.047"], ["HCY (µmol/L)", "13.00 (8.65, 15.97)", "13.00 (9.80, 18.60)", "20.65 (17.35, 23.80)", "0.537", "0.025"], ["CysC (mg/L)", "0.65 (0.56, 0.73)", "0.62 (0.54, 0.70)", "0.75±0.19", "0.107", "0.655"], ["GSP (mmol/L)", "2.77±0.54", "1.89±1.10", "1.06±0.61", "<0.001", "<0.001"], ["SOCS3 (fold change)", "1.00±0.99", "0.91±0.84", "0.77±0.56", "0.489", "0.386"], ["HP (fold change)", "1.00±1.34", "1.42±1.37", "0.97±0.93", "0.041", "0.945"]], "row_count": 29, "column_count": 6, "numeric_cells": 118, "header_rows": 3, "locator": "section[4]/table-wrap[4]#T5"}}, {"id": "asset:table:pmid:32870172:6", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:4db8fdba760831f0c7c2817ee393245a2184473f1bba1149e308513103fa5380", "bytes": 986, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[4]/table-wrap[5]#T6", "version": null, "note": "Correlation analysis of gene expression with detective parameters of all participants", "structure": {"pmcid": "PMC7585973", "section_index": 4, "section_title": "Results", "row_count": 19, "column_count": 5}, "table": {"label": "Table 3", "caption": "Correlation analysis of gene expression with detective parameters of all participants", "rows": [["Clinical parameters", "SOCS3 (n=302)", "HP (n=302)"], ["", ""], ["r", "P1", "r", "P2"], ["TC", "0.121", "0.040", "0.096", "0.106"], ["TG", "0.015", "0.807", "0.034", "0.571"], ["HDL-C", "0.044", "0.470", "0.035", "0.565"], ["LDL-C", "0.095", "0.116", "0.055", "0.359"], ["Apo-A1", "-0.008", "0.897", "-0.074", "0.259"], ["Apo-B", "0.076", "0.240", "0.043", "0.509"], ["LP(a)", "-0.151", "0.045", "-0.199", "0.008"], ["AST", "-0.033", "0.566", "-0.067", "0.248"], ["CK", "-0.072", "0.297", "-0.041", "0.551"], ["CKMB", "-0.110", "0.108", "-0.044", "0.519"], ["LDH", "-0.084", "0.220", "-0.042", "0.539"], ["HBDH", "-0.092", "0.181", "-0.006", "0.931"], ["hs-CRP", "0.062", "0.291", "0.308", "<0.001"], ["HCY", "-0.137", "0.035", "-0.076", "0.244"], ["CysC", "0.012", "0.851", "-0.016", "0.797"], ["GSP", "0.110", "0.107", "0.060", "0.380"]], "row_count": 19, "column_count": 5, "numeric_cells": 66, "header_rows": 3, "locator": "section[4]/table-wrap[5]#T6"}}, {"id": "asset:table:pmid:32870172:7", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:0f51069f2d9924d17cb0d550c2e96377bed68cde1a41879453b4b2678a4b0fff", "bytes": 678, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[4]/table-wrap[6]#T7", "version": null, "note": "Conditional logistic regression analysis of independent correlates between circulating leukocyte mRNA variability and stable CAD and ACS", "structure": {"pmcid": "PMC7585973", "section_index": 4, "section_title": "Results", "row_count": 9, "column_count": 6}, "table": {"label": "Table 4", "caption": "Conditional logistic regression analysis of independent correlates between circulating leukocyte mRNA variability and stable CAD and ACS", "rows": [["", "", "Stable CAD", "ACS"], ["", ""], ["SOCS3", "HP", "SOCS3", "HP"], ["Model 1", "OR", "0.728", "0.522", "0.588", "0.484"], ["", "95% CI", "0.544~0.973", "0.351~0.776", "0.413~0.839", "0.298~0.785"], ["", "P-value", "0.032", "0.001", "0.003", "0.003"], ["Model 2", "OR", "0.772", "0.521", "0.658", "0.667"], ["", "95% CI", "0.537~1.108", "0.311~0.873", "0.459~0.943", "0.437~1.016"], ["", "P-value", "0.160", "0.013", "0.023", "0.059"]], "row_count": 9, "column_count": 6, "numeric_cells": 28, "header_rows": 3, "locator": "section[4]/table-wrap[6]#T7"}}], "gaps": ["asset:data:geo:GSE59867 not downloaded", "asset:data:geo:GSE59867 licence not read", "asset:data:geo:GSE62646 not downloaded", "asset:data:geo:GSE62646 licence not read"]}, "analysis": {"state": "partial", "methods": [{"id": "method-1", "family": "differential_expression", "specific": "limma_voom", "label": "Differential expression analysis", "dsl_operations": ["normalise_counts", "differential_expression_fit", "fdr_bh"], "missing_operations": [], "expressible": true, "parameters": {}, "data_shapes": ["count_matrix_with_condition"], "evidence": {"score": 1.0, "band": "verbatim", "quote": "The raw microarray data of the two datasets downloaded from the GEO database (9) were processed with the LIMMA package of the R language (http://www.R-project.org, The R Foundation) to identify genes that were differentially expressed in peripheral blood between stable CAD patients and STEMI patients."}}, {"id": "method-2", "family": "group_comparison", "specific": "mann_whitney", "label": "Group comparison", "dsl_operations": [], "missing_operations": ["group_comparison_mann_whitney"], "expressible": false, "parameters": {}, "data_shapes": ["two_or_more_groups_continuous"], "evidence": {"score": 0.8, "band": "high", "quote": "Mann-Whitney"}}, {"id": "method-3", "family": "regression_modelling", "specific": "logistic", "label": "Regression modelling", "dsl_operations": ["glm_logit_fit"], "missing_operations": [], "expressible": true, "parameters": {"coefficient": "increased risk of CAD [odds ratio (OR)=0"}, "data_shapes": ["predictors_and_outcome"], "evidence": {"score": 0.7, "band": "medium", "quote": "Logistic regression"}}, {"id": "method-4", "family": "network_analysis", "specific": "ppi_network", "label": "Network / pathway analysis", "dsl_operations": ["build_graph", "centrality_scores", "pathway_enrich"], "missing_operations": [], "expressible": true, "parameters": {}, "data_shapes": ["edge_list"], "evidence": {"score": 0.8, "band": "high", "quote": "PPI"}}, {"id": "method-5", "family": "network_analysis", "specific": "pathway_enrichment", "label": "Network / pathway analysis", "dsl_operations": ["pathway_enrich"], "missing_operations": [], "expressible": true, "parameters": {}, "data_shapes": ["edge_list"], "evidence": {"score": 0.8, "band": "high", "quote": "pathway enrichment"}}, {"id": "method-6", "family": "contingency_analysis", "specific": "chi_square", "label": "Categorical (contingency table) analysis", "dsl_operations": ["chi_square_test"], "missing_operations": [], "expressible": true, "parameters": {}, "data_shapes": ["categorical_cross_tabulation"], "evidence": {"score": 0.8, "band": "high", "quote": "Chi-square"}}], "targets": [], "gaps": ["method.reader_differs_from_extractor"]}, "capability": {"state": "complete", "requirements": [{"capability_id": "capability:computational_analysis", "label": "Computational analysis platform", "assay_families": ["meta_analysis", "machine_learning", "survival_analysis", "statistical_regression", "pca", "molecular_docking", "network_analysis", "differential_expression", "gwas"], "availability_state": "owned", "tier_unlocked": "R1", "candidate": "Automated Assays Laravel application and simulated adapters"}], "gaps": []}, "readiness": {"state": "complete", "tier": "R1", "blocking_axis": "none", "blocked_on": "nothing:replicable_now", "axes": {"method": {"tier": "R1", "expressible": true, "required_operations": ["normalise_counts", "differential_expression_fit", "fdr_bh"], "missing_operations": [], "basis": "The paper names the method it used and the corpus's method extractor maps it onto the DSL catalogue: limma_voom."}, "capability": {"tier": "R1", "capability_id": "capability:computational_analysis", "availability_state": "owned", "basis": "The computational analysis is owned. The physical bench the paper used is not, so a physical validation cannot be run here."}, "data": {"tier": "R1", "reachable": true, "accessions": ["GSE62646", "GSE59867"], "resolved_accessions": ["GSE62646", "GSE59867"], "statements": ["only two datasets were selected as discovery datasets for performing the differential analyses [(GSE62646: stable CAD (14 samples) vs. STEMI (28 samples) and GSE59867: stable CAD (46 samples) vs. STEMI (111 samples)]."], "basis": "The paper names GSE62646, GSE59867 in GEO DataSets and the accession resolves in the repository. No dataset was downloaded and no licence was read."}}, "can_run": {"dsl_operations": ["normalise_counts", "differential_expression_fit", "fdr_bh"], "assets": ["source:pmid:32870172", "data:geo:GSE59867", "asset:table:pmid:32870172:1", "asset:table:pmid:32870172:2", "asset:table:pmid:32870172:3", "asset:table:pmid:32870172:4", "asset:table:pmid:32870172:5", "asset:table:pmid:32870172:6", "asset:table:pmid:32870172:7"], "steps": ["run_analysis"]}, "must_build": {"dsl_operations": [], "converters": [], "readers": [], "capabilities": [], "data_gaps": ["data:geo:GSE59867"]}, "gaps": []}, "review": {"state": "partial", "machine_critique": {"kind": "extraction_review", "reader": {"model": "MiniMax-M3.1-Flash", "provider": "minimax", "provider_family": "minimax", "read_at": "2026-10-31T18:22:12Z", "independence": "single_reader"}, "evidence_check": {"method": "verbatim", "availability": null}, "calls": 3, "usage": {"prompt_tokens": 33243, "completion_tokens": 1352, "cached_tokens": 792}}, "human_critique": null, "stages": [{"id": "extraction", "state": "complete", "reader": "MiniMax-M3.1-Flash", "provider": "minimax"}], "gaps": ["review.independent_reader", "review.machine_critique", "review.human_critique"]}, "execution": {"state": "absent", "status": "not_run", "mode": null, "runs": [], "gaps": ["execution.not_run"]}, "provenance": {"entities": [{"id": "pmid:32870172", "type": "paper", "label": "pmid:32870172"}, {"id": "source:pmid:32870172", "type": "manuscript", "label": "PMID 32870172 full text"}, {"id": "data:geo:GSE59867", "type": "dataset", "label": "GEO GSE59867"}], "activities": [{"id": "activity-reading-sci-2026-11-01", "type": "classification", "used": [{"id": "pmid:32870172", "type": "paper", "label": "pmid:32870172"}, {"id": "source:pmid:32870172", "type": "manuscript", "label": "PMID 32870172 full text"}, {"id": "data:geo:GSE59867", "type": "dataset", "label": "GEO GSE59867"}], "agent": "agent:corpus-assay-engine"}, {"id": "activity-read-32870172", "type": "extraction", "used": ["source:pmid:32870172"], "agent": "agent:minimax-reader"}, {"id": "activity-resolve-GSE59867", "type": "accession_resolution", "used": ["data:geo:GSE59867"], "agent": "agent:corpus-assay-engine"}], "agents": [{"id": "agent:corpus-assay-engine", "type": "software", "label": "Corpus assay engine"}, {"id": "agent:minimax-reader", "type": "software", "label": "MiniMax literature reader"}], "source_run_id": "reading-sci-2026-11-01", "dsl_catalogue_fingerprint": "343fb30756ba6ec3", "capability_table_fingerprint": "2cb3e42f047d2ecf", "snapshot_id": "ba34b49490d9bfaf"}, "lineage": {"parent_id": "pmid:32870172", "parent_hash": "sha256:15df37c921de6c4e4ef6d2bd03718bea1742ed02bf18fb1971d0e40fe1a2c0f2", "fork_of": null, "generation": 8}, "gaps": ["asset:data:geo:GSE59867 licence not read", "asset:data:geo:GSE59867 not downloaded", "asset:data:geo:GSE62646 licence not read", "asset:data:geo:GSE62646 not downloaded", "execution.not_run", "method.reader_differs_from_extractor", "review.human_critique", "review.independent_reader", "review.machine_critique"], "assays": [{"role": "data_generation", "definition_id": "microarray", "definition_version": "99e1195c7d6f", "definition_digest": null, "required_operations": [], "support_state": "partial", "source_hashes": {"assay_lexicon": "99e1195c7d6f"}, "confidence": 0.93, "evidence": ["a processing and DEG identification: The raw microarray data of the two datasets downloaded from the"], "order_basis": "paper_text_order:3986", "id": "assay:1"}, {"role": "data_generation", "definition_id": "cell_culture", "definition_version": "99e1195c7d6f", "definition_digest": null, "required_operations": [], "support_state": "partial", "source_hashes": {"assay_lexicon": "99e1195c7d6f"}, "confidence": 0.99, "evidence": ["treatment: Human monocytic THP-1 cells were cultured in RPMI-1640 medium (Gibco, USA) containing 10%", "Total RNA was extracted from leukocytes and cultured cells using TRIZOL Regent (Invitrogen, Carls"], "order_basis": "paper_text_order:8093", "id": "assay:2"}, {"role": "data_generation", "definition_id": "qpcr", "definition_version": "99e1195c7d6f", "definition_digest": null, "required_operations": [], "support_state": "partial", "source_hashes": {"assay_lexicon": "99e1195c7d6f"}, "confidence": 0.99, "evidence": ["and quantitative polymerase chain reaction (qPCR): Total RNA was extracted from leukocytes an", "formed with a HiScript® II Q RT SuperMix for qPCR Kit (Nanjing Vazyme Biotech Co., Ltd, Nanjin", "for real-time reactions using ChamQTM SYBR® qPCR Master Mix (Nanjing Vazyme Biotech Co., Ltd,", "ed as 2-ΔCq. Detailed primer information and qPCR data processing are shown in Table S1. Prime"], "order_basis": "paper_text_order:8569", "id": "assay:3"}, {"role": "analysis", "definition_id": "differential_expression", "definition_version": "f2132e96ae6c7a4e", "definition_digest": null, "required_operations": ["normalise_counts", "differential_expression_fit", "fdr_bh"], "support_state": "supported", "source_hashes": {"dsl_catalogue": "f2132e96ae6c7a4e"}, "confidence": 1.0, "evidence": ["The raw microarray data of the two datasets downloaded from the GEO database (9) were processed with the LIMMA package of the R language (http://www.R-project.org, The R Foundation) to identify genes that were differentially expressed in peripheral blood between stable CAD patients and STEMI patients."], "order_basis": "consumes_earlier_output", "id": "assay:4"}]}