← All .science files
pmid:33002344
Screening lncRNAs with diagnostic and prognostic value for human stomach adenocarcinoma based on machine learning and mRNA-lncRNA co-expression network analysis.
Qun Li · Xiaofeng Liu · Jia Gu · Jinming Zhu · Zhi Wei · Hua Huang
Molecular genetics & genomic medicine · 2020 doi:10.1002/mgg3.1512
Paper
complete
Experiment
partial
Data
partial
Analysis
complete
Execution
absent
Execution evidence has not yet been added to this .science file. Explore its methods, data and open questions to plan the next step.
Record details sci_version · id · kind · revision · content_hash · schema · created_at · updated_at · generator
paper object · 10 fields
authors array · 6 items
claims array · 1 item
[0] object · 6 fields
evidence array · 1 item
[0] object · 3 fields
gaps array · 0 items
experiment object · 8 fields
steps array · 3 items
[0] object · 13 fields
parameters object · 0 fields
inputs array · 1 item
outputs array · 1 item
instruments array · 0 items
reagents array · 0 items
[1] object · 13 fields
parameters object · 0 fields
inputs array · 0 items
outputs array · 1 item
instruments array · 0 items
reagents array · 0 items
[2] object · 13 fields
parameters object · 1 field
inputs array · 0 items
outputs array · 1 item
instruments array · 0 items
reagents array · 0 items
materials array · 0 items
instruments array · 0 items
reagents array · 0 items
conditions object · 0 fields
gaps array · 1 item
data object · 3 fields
assets array · 5 items
[0] object · 15 fields
structure object · 4 fields
[1] object · 16 fields
structure object · 5 fields
table object · 8 fields
rows array · 15 items
[0] array · 2 items
[1] array · 2 items
[2] array · 2 items
[3] array · 2 items
[4] array · 2 items
[5] array · 2 items
[6] array · 2 items
[7] array · 2 items
[8] array · 2 items
[9] array · 2 items
[10] array · 2 items
[11] array · 2 items
[12] array · 2 items
[13] array · 2 items
[14] array · 2 items
[2] object · 16 fields
structure object · 5 fields
table object · 8 fields
rows array · 29 items
[0] array · 5 items
[1] array · 5 items
[2] array · 5 items
[3] array · 5 items
[4] array · 5 items
[5] array · 5 items
[6] array · 5 items
[7] array · 5 items
[8] array · 5 items
[9] array · 5 items
[10] array · 5 items
[11] array · 5 items
[12] array · 5 items
[13] array · 5 items
[14] array · 5 items
[15] array · 5 items
[16] array · 5 items
[17] array · 5 items
[18] array · 5 items
[19] array · 5 items
[20] array · 5 items
[21] array · 5 items
[22] array · 5 items
[23] array · 5 items
[24] array · 5 items
[25] array · 5 items
[26] array · 5 items
[27] array · 5 items
[28] array · 5 items
[3] object · 16 fields
structure object · 5 fields
table object · 8 fields
rows array · 50 items
[0] array · 5 items
[1] array · 5 items
[2] array · 5 items
[3] array · 5 items
[4] array · 5 items
[5] array · 5 items
[6] array · 5 items
[7] array · 5 items
[8] array · 5 items
[9] array · 5 items
[10] array · 5 items
[11] array · 5 items
[12] array · 5 items
[13] array · 5 items
[14] array · 5 items
[15] array · 5 items
[16] array · 5 items
[17] array · 5 items
[18] array · 5 items
[19] array · 5 items
[20] array · 5 items
[21] array · 5 items
[22] array · 5 items
[23] array · 5 items
[24] array · 5 items
[25] array · 5 items
[26] array · 5 items
[27] array · 5 items
[28] array · 5 items
[29] array · 5 items
[30] array · 5 items
[31] array · 5 items
[32] array · 5 items
[33] array · 5 items
[34] array · 5 items
[35] array · 5 items
[36] array · 5 items
[37] array · 5 items
[38] array · 5 items
[39] array · 5 items
[40] array · 5 items
[41] array · 5 items
[42] array · 5 items
[43] array · 5 items
[44] array · 5 items
[45] array · 5 items
[46] array · 5 items
[47] array · 5 items
[48] array · 5 items
[49] array · 5 items
[4] object · 16 fields
structure object · 5 fields
table object · 8 fields
rows array · 15 items
[0] array · 2 items
[1] array · 2 items
[2] array · 2 items
[3] array · 2 items
[4] array · 2 items
[5] array · 2 items
[6] array · 2 items
[7] array · 2 items
[8] array · 2 items
[9] array · 2 items
[10] array · 2 items
[11] array · 2 items
[12] array · 2 items
[13] array · 2 items
[14] array · 2 items
gaps array · 0 items
analysis object · 4 fields
methods array · 3 items
[0] object · 10 fields
dsl_operations array · 3 items
missing_operations array · 0 items
parameters object · 1 field
data_shapes array · 1 item
[1] object · 10 fields
dsl_operations array · 3 items
missing_operations array · 0 items
parameters object · 1 field
data_shapes array · 1 item
[2] object · 10 fields
dsl_operations array · 3 items
missing_operations array · 0 items
parameters object · 1 field
data_shapes array · 1 item
targets array · 0 items
gaps array · 0 items
capability object · 3 fields
requirements array · 1 item
[0] object · 6 fields
assay_families array · 9 items
gaps array · 0 items
readiness object · 8 fields
axes object · 3 fields
method object · 5 fields
required_operations array · 3 items
missing_operations array · 0 items
capability object · 4 fields
data object · 6 fields
accessions array · 0 items
resolved_accessions array · 0 items
statements array · 0 items
can_run object · 3 fields
dsl_operations array · 3 items
assets array · 5 items
steps array · 1 item
must_build object · 5 fields
dsl_operations array · 0 items
converters array · 0 items
readers array · 0 items
capabilities array · 0 items
data_gaps array · 1 item
gaps array · 1 item
review object · 5 fields
machine_critique object · 5 fields
reader object · 5 fields
evidence_check object · 2 fields
usage object · 3 fields
stages array · 1 item
[0] object · 4 fields
gaps array · 3 items
provenance object · 7 fields
entities array · 3 items
activities array · 3 items
[0] object · 4 fields
used array · 3 items
[0] object · 3 fields
[1] object · 3 fields
[2] object · 3 fields
[1] object · 4 fields
agents array · 2 items
lineage object · 4 fields
gaps array · 5 items
assays array · 1 item
[0] object · 11 fields
required_operations array · 3 items
source_hashes object · 1 field
evidence array · 1 item
Complete file
{"sci_version": "1.2", "schema": "https://corpus.bntrg.co.uk/sci/1.0/sci.schema.json", "id": "pmid:33002344", "kind": "science-record", "revision": 8, "content_hash": "sha256:8c95ab77a824cbbbea56af90096df4293e2ea4fa8fb9d31217930044ca5d3dd6", "created_at": "2026-11-01T15:41:12Z", "updated_at": "2026-11-01T22:45:24Z", "generator": {"name": "corpus-assay-engine", "run_id": "reading-sci-2026-11-01"}, "paper": {"state": "complete", "title": "Screening lncRNAs with diagnostic and prognostic value for human stomach adenocarcinoma based on machine learning and mRNA-lncRNA co-expression network analysis.", "doi": "10.1002/mgg3.1512", "pmid": "33002344", "authors": ["Qun Li", "Xiaofeng Liu", "Jia Gu", "Jinming Zhu", "Zhi Wei", "Hua Huang"], "journal": "Molecular genetics & genomic medicine", "year": 2020, "abstract": "BACKGROUND: Stomach adenocarcinoma (STAD), is one of the most lethal malignancies around the world. The aim of this study was to find the long noncoding RNAs (lncRNAs) acting as diagnostic and prognostic biomarker of STAD.\nMETHODS: Base on TCGA dataset, the differentially expressed mRNAs (DEmRNAs) and lncRNAs (DElncRNAs) were identified between STAD and normal tissue. The machine learning and survival analysis were performed to evaluate the potential diagnostic and prognostic value of lncRNAs for STAD. We also build the co-expression network and functional annotation. The expression of selected candidate mRNAs and lncRNAs were validated by Quantitative real-time polymerase chain reaction (qRT-PCR) and GSE27342 dataset. GSE27342 dataset were also to perform gene set enrichment analysis.\nRESULTS: A total of 814 DEmRNAs and 106 DElncRNAs between STAD and normal tissue were obtained. FOXD2-AS1, LINC01235, and RP11-598F7.5 were defined as optimal diagnostic lncRNA biomarkers for STAD. The area under curve (AUC) of the decision tree model, random forests model, and support vector machine (SVM) model were 0.797, 0.981, and 0.983, and the specificity and sensitivity of the three model were 75.0% and 97.1%, 96.9% and 96%, and 96.9% and 97.1%, respectively. Among them, LINC01235 was not only an optimal diagnostic lncRNA biomarkers, but also related to survival time. The expression of three DEmRNAs (ESM1, WNT2, and COL10A1) and three optimal diagnostic lncRNAs biomarkers (FOXD2-AS1, RP11-598F7.5, and LINC01235) in qRT-PCR validation was were consistent with our integrated analysis. Except for FOXD2-AS1, ESM1, WNT2, COL10A1, and LINC01235 were upregulated in STAD, which was consistent with our integration results. Gene set enrichment analysis results indicated that DNA replication, Cell cycle, ECM-receptor interaction, and P53 signaling pathway were four significantly enriched pathways in STAD.\nCONCLUSION: Our study identified three DElncRNAs as potential diagnostic biomarkers of STAD. Among them, LINC01235 also was a prognostic lncRNA biomarkers.", "claims": [{"id": "claim-method", "statement": "The DElncRNAs and DEmRNAs in STAD compared to adjacent normal tissues were calculated using the R package DESeq2. Benjamini and Hochberg multiple testing method was applied to acquire the false discovery rate (FDR).", "kind": "methodological", "target": null, "evidence": [{"asset": "source:pmid:33002344", "locator": "sections[4] \"Identification of DEmRNAs and DElncRNAs\" paragraph 2", "quote": "The DElncRNAs and DEmRNAs in STAD compared to adjacent normal tissues were calculated using the R package DESeq2. Benjamini and Hochberg multiple testing method was applied to acquire the false discovery rate (FDR)."}], "state": "complete"}], "gaps": []}, "experiment": {"state": "partial", "objective": null, "steps": [{"id": "read_published_estimate", "order": 1, "name": "Read the published estimate from the source", "kind": "other", "state": "complete", "blocked_on": null, "description": "The claim, method and evidence span published with the source article.", "duration_hours": null, "parameters": {}, "inputs": ["source:pmid:33002344"], "outputs": ["the published estimate and its evidence"], "instruments": [], "reagents": []}, {"id": "obtain_source_data", "order": 2, "name": "Obtain the source data from the named repository", "kind": "data-preparation", "state": "blocked", "blocked_on": "data:accession_absent", "description": "The GEO series accession resolves and its sample accessions are listed. This lane did not download the dataset or read its licence.", "duration_hours": null, "parameters": {}, "inputs": [], "outputs": ["the source data with its repository provenance"], "instruments": [], "reagents": []}, {"id": "run_analysis", "order": 3, "name": "Run the published analysis", "kind": "analysis", "state": "complete", "blocked_on": null, "description": "Apply the paper's statistical method to the resolved series and compare the result with the published target.", "duration_hours": null, "parameters": {"fdr_threshold": "with Benjamini–Hochberg false discovery rate correction"}, "inputs": [], "outputs": ["the replicated result and its comparison"], "instruments": [], "reagents": []}], "materials": [], "instruments": [], "reagents": [], "conditions": {}, "gaps": ["step:obtain_source_data blocked on data:accession_absent"]}, "data": {"state": "partial", "assets": [{"id": "source:pmid:33002344", "role": "manuscript", "format": "xml", "media_type": "application/xml", "uri": "https://doi.org/10.1002/mgg3.1512", "sha256": "sha256:20d94fc179b9acd9178d72ecb088f1d4af37e99a9049fe3815fed522bba5aef4", "bytes": 35528, "access": "open", "state": "resolved", "reader": null, "reader_status": "reader_required", "identifier": "10.1002/mgg3.1512", "version": null, "note": "Full article fetched from PMC; the checksum covers the rendered section body, not the original XML bytes.", "structure": {"pmcid": "PMC7667366", "source": "europe_pmc_fulltext", "coverage": "whole_body", "text_hash_scope": "rendered_section_body"}}, {"id": "asset:table:pmid:33002344:1", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:2e34c00e3935e9e407567b8b6950e01cf8c081475cdda31d34d9d045a226ca48", "bytes": 800, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[9]/table-wrap[1]#mgg31512-tbl-0001", "version": null, "note": "Primer sequences used for qRT‐PCR", "structure": {"pmcid": "PMC7667366", "section_index": 9, "section_title": "Confirmation by qRT‐PCR", "row_count": 15, "column_count": 2}, "table": {"label": "TABLE 1", "caption": "Primer sequences used for qRT‐PCR", "rows": [["Name", "Sequence (5′ to 3′)"], ["ACTB‐F", "CATGTACGTTGCTATCCAGGC"], ["ACTB‐R", "CTCCTTAATGTCACGCACGAT"], ["ESM1‐F", "CAGTGAGTGCAAAAGCAGCC"], ["ESM1‐R", "TCCTCCCCATTAGAAGGCTGA"], ["WNT2‐F", "TCTCGGTGGAATCTGGCTCTGG"], ["WNT2‐R", "TGGCTAATGGCACGCATCACATC"], ["COL10A1‐F", "CAGGAAAACCAGGCTACGGA"], ["COL10A1‐R", "CCAGCTGGTCCAACZTCTCC"], ["FOXD2‐AS1‐F", "TGCATCCTGTGTCCTGTGTC"], ["FOXD2‐AS1‐R", "CCACTAGGGTCTCGCTGTTG"], ["RP11‐598F7.5‐F", "GCATGTCTGTCTCAAGCTGC"], ["RP11‐598F7.5‐R", "TGCAGAAGTTCGTGGAGGAC"], ["LINC01235‐F", "CGAGACCAGCCTGACCAACATG"], ["LINC01235‐R", "CTCCTGCCTTAGCCTCCTGAGTAG"]], "row_count": 15, "column_count": 2, "numeric_cells": 7, "header_rows": 1, "locator": "section[9]/table-wrap[1]#mgg31512-tbl-0001"}}, {"id": "asset:table:pmid:33002344:2", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:017b5c33fe9194d4033ed5ac27aa0e5c893d017297c26d3cdda7f6e1ab3cd032", "bytes": 2118, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[14]/table-wrap[1]#mgg31512-tbl-0002", "version": null, "note": "DElncRNAs between STAD and normal tissues after reduced dimensions of data by LASSO algorithm", "structure": {"pmcid": "PMC7667366", "section_index": 14, "section_title": "Identification of optimal diagnostic lncRNAs biomarkers for STAD", "row_count": 29, "column_count": 5}, "table": {"label": "TABLE 2", "caption": "DElncRNAs between STAD and normal tissues after reduced dimensions of data by LASSO algorithm", "rows": [["Symbol", "log2FoldChange", "p‐value", "FDR", "Updown"], ["FOXD2‐AS1", "2.139327751", "2.28E‐31", "2.63E‐28", "Up"], ["IL12A‐AS1", "−3.340180888", "5.18E‐31", "4.78E‐28", "Down"], ["AC090616.2", "−2.265896134", "1.14E‐29", "8.77E‐27", "Down"], ["RP11‐598F7.5", "2.374331116", "2.37E‐27", "1.37E‐24", "Up"], ["ADAMTS9‐AS1", "−2.750538461", "3.62E‐27", "1.86E‐24", "Down"], ["DLGAP1‐AS2", "2.043503544", "2.23E‐25", "6.44E‐23", "Up"], ["RP11‐613D13.8", "−2.423609575", "2.96E‐24", "7.19E‐22", "Down"], ["LINC02158", "−2.245429764", "3.21E‐24", "7.39E‐22", "Down"], ["AL928768.3", "−3.703197788", "1.06E‐22", "1.96E‐20", "Down"], ["LINC01235", "2.53991133", "5.63E‐22", "8.95E‐20", "Up"], ["LINC01336", "−2.549764194", "5.00E‐20", "5.12E‐18", "Down"], ["AC015849.16", "2.256425866", "9.54E‐20", "9.36E‐18", "Up"], ["RNF144A‐AS1", "2.139212352", "7.70E‐19", "6.96E‐17", "Up"], ["C5orf66‐AS1", "−3.187219896", "9.81E‐19", "8.53E‐17", "Down"], ["CDKN2B‐AS1", "−2.587107347", "2.91E‐18", "2.27E‐16", "Down"], ["LINC01697", "−2.747733567", "9.67E‐18", "6.73E‐16", "Down"], ["AC073283.7", "2.081655386", "2.20E‐16", "1.18E‐14", "Up"], ["LINC00982", "−2.306850193", "1.49E‐15", "6.46E‐14", "Down"], ["RP11‐963H4.3", "−2.022400723", "7.67E‐15", "3.00E‐13", "Down"], ["RP11‐641D5.2", "−2.040949727", "1.08E‐14", "3.99E‐13", "Down"], ["PGM5‐AS1", "−3.192676148", "1.26E‐14", "4.58E‐13", "Down"], ["RP11‐7 K24.3", "−2.041496455", "9.89E‐14", "2.90E‐12", "Down"], ["AC096579.15", "−2.46634156", "1.27E‐13", "3.67E‐12", "Down"], ["AC104024.1", "−2.111937683", "1.75E‐13", "4.82E‐12", "Down"], ["PART1", "−2.31587256", "8.27E‐12", "1.64E‐10", "Down"], ["C20orf166‐AS1", "−2.491364692", "2.57E‐11", "4.40E‐10", "Down"], ["CASC9", "2.276494335", "2.79E‐11", "4.69E‐10", "Up"], ["AF001548.6", "−2.081376039", "1.45E‐08", "1.29E‐07", "Down"]], "row_count": 29, "column_count": 5, "numeric_cells": 105, "header_rows": 1, "locator": "section[14]/table-wrap[1]#mgg31512-tbl-0002"}}, {"id": "asset:table:pmid:33002344:3", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:aa1d51239eaefe30068f84d8b2d5b0a1c655d011984531464ea88e3d8a5c7554", "bytes": 3287, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[14]/table-wrap[2]#mgg31512-tbl-0003", "version": null, "note": "DElncRNAs between STAD and normal tissues after reduced dimensions of data by Elastic net", "structure": {"pmcid": "PMC7667366", "section_index": 14, "section_title": "Identification of optimal diagnostic lncRNAs biomarkers for STAD", "row_count": 50, "column_count": 5}, "table": {"label": "TABLE 3", "caption": "DElncRNAs between STAD and normal tissues after reduced dimensions of data by Elastic net", "rows": [["Symbol", "log2FoldChange", "p‐value", "FDR", "Updown"], ["FOXD2‐AS1", "2.139328", "2.28E‐31", "2.63E‐28", "Up"], ["RP11‐598F7.5", "2.374331", "2.37E‐27", "1.37E‐24", "Up"], ["LINC01235", "2.539911", "5.63E‐22", "8.95E‐20", "Up"], ["AL928768.3", "−3.7032", "1.06E‐22", "1.96E‐20", "Down"], ["GAPLINC", "2.062859", "1.75E‐18", "1.43E‐16", "Up"], ["DUXAP8", "3.316478", "1.22E‐35", "2.80E‐32", "Up"], ["LINC01336", "−2.54976", "5.00E‐20", "5.12E‐18", "Down"], ["DLGAP1‐AS2", "2.043504", "2.23E‐25", "6.44E‐23", "Up"], ["LINC01697", "−2.74773", "9.67E‐18", "6.73E‐16", "Down"], ["C5orf66‐AS1", "−3.18722", "9.81E‐19", "8.53E‐17", "Down"], ["RP1‐60O19.1", "2.739187", "4.28E‐14", "1.32E‐12", "Up"], ["RP11‐867G23.10", "−3.08974", "1.47E‐25", "4.53E‐23", "Down"], ["ADAMTS9‐AS2", "−2.15844", "4.67E‐16", "2.24E‐14", "Down"], ["AC015849.16", "2.256426", "9.54E‐20", "9.36E‐18", "Up"], ["RNF144A‐AS1", "2.139212", "7.70E‐19", "6.96E‐17", "Up"], ["LINC02086", "2.525563", "2.62E‐14", "8.68E‐13", "Up"], ["KRT7‐AS", "2.226896", "3.66E‐12", "8.11E‐11", "Up"], ["AC073283.7", "2.081655", "2.20E‐16", "1.18E‐14", "Up"], ["LINC02158", "−2.24543", "3.21E‐24", "7.39E‐22", "Down"], ["RP11‐770 J1.3", "−2.05015", "1.84E‐39", "8.50E‐36", "Down"], ["PGM5‐AS1", "−3.19268", "1.26E‐14", "4.58E‐13", "Down"], ["MEF2C‐AS1", "−2.09002", "3.43E‐16", "1.76E‐14", "Down"], ["RBMS3‐AS3", "−2.2516", "2.02E‐15", "8.47E‐14", "Down"], ["RP11‐211G23.2", "2.118864", "2.16E‐12", "5.14E‐11", "Up"], ["CTD‐2540F13.2", "2.141602", "9.78E‐18", "6.73E‐16", "Up"], ["AC108676.1", "2.441715", "4.71E‐16", "2.24E‐14", "Up"], ["CASC9", "2.276494", "2.79E‐11", "4.69E‐10", "Up"], ["PART1", "−2.31587", "8.27E‐12", "1.64E‐10", "Down"], ["TRPM2‐AS", "2.748372", "2.12E‐20", "2.39E‐18", "Up"], ["CTD‐2540F13.2", "2.141602", "9.78E‐18", "6.73E‐16", "Up"], ["RP11‐21A7A.2", "−2.52023", "9.31E‐17", "5.43E‐15", "Down"], ["IL12A‐AS1", "−3.34018", "5.18E‐31", "4.78E‐28", "Down"], ["AC096579.15", "−2.46634", "1.27E‐13", "3.67E‐12", "Down"], ["RP11‐641D5.2", "−2.04095", "1.08E‐14", "3.99E‐13", "Down"], ["RP11‐963H4.3", "−2.0224", "7.67E‐15", "3.00E‐13", "Down"], ["CDKN2B‐AS1", "−2.58711", "2.91E‐18", "2.27E‐16", "Down"], ["RP11‐613D13.8", "−2.42361", "2.96E‐24", "7.19E‐22", "Down"], ["RP11‐626H12.2", "2.19915", "3.16E‐17", "1.94E‐15", "Up"], ["AC090616.2", "−2.2659", "1.14E‐29", "8.77E‐27", "Down"], ["C20orf166‐AS1", "−2.49136", "2.57E‐11", "4.40E‐10", "Down"], ["UBXN10‐AS1", "−2.77015", "6.71E‐20", "6.73E‐18", "Down"], ["LINC00671", "−2.66457", "3.07E‐20", "3.29E‐18", "Down"], ["LINC00982", "−2.30685", "1.49E‐15", "6.46E‐14", "Down"], ["AC104024.1", "−2.11194", "1.75E‐13", "4.82E‐12", "Down"], ["SOX21‐AS1", "−2.18199", "2.01E‐07", "1.34E‐06", "Down"], ["RP11‐351 J23.1", "−2.7255", "5.24E‐14", "1.61E‐12", "Down"], ["AF001548.6", "−2.08138", "1.45E‐08", "1.29E‐07", "Down"], ["RP11‐7 K24.3", "−2.0415", "9.89E‐14", "2.90E‐12", "Down"], ["RP11‐800A18.4", "−2.53106", "1.73E‐12", "4.18E‐11", "Down"]], "row_count": 50, "column_count": 5, "numeric_cells": 183, "header_rows": 1, "locator": "section[14]/table-wrap[2]#mgg31512-tbl-0003"}}, {"id": "asset:table:pmid:33002344:4", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:2e34c00e3935e9e407567b8b6950e01cf8c081475cdda31d34d9d045a226ca48", "bytes": 800, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[9]/table-wrap[1]#mgg31512-tbl-0001", "version": null, "note": "Primer sequences used for qRT‐PCR", "structure": {"pmcid": "PMC7667366", "section_index": 18, "section_title": "Confirmation by qRT‐PCR", "row_count": 15, "column_count": 2}, "table": {"label": "TABLE 1", "caption": "Primer sequences used for qRT‐PCR", "rows": [["Name", "Sequence (5′ to 3′)"], ["ACTB‐F", "CATGTACGTTGCTATCCAGGC"], ["ACTB‐R", "CTCCTTAATGTCACGCACGAT"], ["ESM1‐F", "CAGTGAGTGCAAAAGCAGCC"], ["ESM1‐R", "TCCTCCCCATTAGAAGGCTGA"], ["WNT2‐F", "TCTCGGTGGAATCTGGCTCTGG"], ["WNT2‐R", "TGGCTAATGGCACGCATCACATC"], ["COL10A1‐F", "CAGGAAAACCAGGCTACGGA"], ["COL10A1‐R", "CCAGCTGGTCCAACZTCTCC"], ["FOXD2‐AS1‐F", "TGCATCCTGTGTCCTGTGTC"], ["FOXD2‐AS1‐R", "CCACTAGGGTCTCGCTGTTG"], ["RP11‐598F7.5‐F", "GCATGTCTGTCTCAAGCTGC"], ["RP11‐598F7.5‐R", "TGCAGAAGTTCGTGGAGGAC"], ["LINC01235‐F", "CGAGACCAGCCTGACCAACATG"], ["LINC01235‐R", "CTCCTGCCTTAGCCTCCTGAGTAG"]], "row_count": 15, "column_count": 2, "numeric_cells": 7, "header_rows": 1, "locator": "section[9]/table-wrap[1]#mgg31512-tbl-0001"}}], "gaps": []}, "analysis": {"state": "complete", "methods": [{"id": "method-1", "family": "differential_expression", "specific": "deseq2", "label": "Differential expression analysis", "dsl_operations": ["normalise_counts", "differential_expression_fit", "fdr_bh"], "missing_operations": [], "expressible": true, "parameters": {"fdr_threshold": "with Benjamini–Hochberg false discovery rate correction"}, "data_shapes": ["count_matrix_with_condition"], "evidence": {"score": 1.0, "band": "verbatim", "quote": "The DElncRNAs and DEmRNAs in STAD compared to adjacent normal tissues were calculated using the R package DESeq2. Benjamini and Hochberg multiple testing method was applied to acquire the false discovery rate (FDR)."}}, {"id": "method-2", "family": "machine_learning", "specific": "support_vector_machine", "label": "Machine learning", "dsl_operations": ["train_classifier", "cross_validate", "roc_auc"], "missing_operations": [], "expressible": true, "parameters": {"auc": "The area under curve (AUC) of the decision tree m"}, "data_shapes": ["labelled_feature_matrix"], "evidence": {"score": 0.7, "band": "medium", "quote": "support vector machine"}}, {"id": "method-3", "family": "machine_learning", "specific": "decision_tree", "label": "Machine learning", "dsl_operations": ["train_classifier", "cross_validate", "roc_auc"], "missing_operations": [], "expressible": true, "parameters": {"auc": "The area under curve (AUC) of the decision tree m"}, "data_shapes": ["labelled_feature_matrix"], "evidence": {"score": 0.7, "band": "medium", "quote": "decision tree"}}], "targets": [], "gaps": []}, "capability": {"state": "complete", "requirements": [{"capability_id": "capability:computational_analysis", "label": "Computational analysis platform", "assay_families": ["meta_analysis", "machine_learning", "survival_analysis", "statistical_regression", "pca", "molecular_docking", "network_analysis", "differential_expression", "gwas"], "availability_state": "owned", "tier_unlocked": "R1", "candidate": "Automated Assays Laravel application and simulated adapters"}], "gaps": []}, "readiness": {"state": "blocked", "tier": "R4", "blocking_axis": "data", "blocked_on": "data:accession_absent", "axes": {"method": {"tier": "R1", "expressible": true, "required_operations": ["normalise_counts", "differential_expression_fit", "fdr_bh"], "missing_operations": [], "basis": "The paper names the method it used and the corpus's method extractor maps it onto the DSL catalogue: deseq2."}, "capability": {"tier": "R1", "capability_id": "capability:computational_analysis", "availability_state": "owned", "basis": "The computational analysis is owned. The physical bench the paper used is not, so a physical validation cannot be run here."}, "data": {"tier": "R4", "reachable": false, "accessions": [], "resolved_accessions": [], "statements": [], "basis": "The paper names no accession to its source data, so the data has to come from the authors."}}, "can_run": {"dsl_operations": ["normalise_counts", "differential_expression_fit", "fdr_bh"], "assets": ["source:pmid:33002344", "asset:table:pmid:33002344:1", "asset:table:pmid:33002344:2", "asset:table:pmid:33002344:3", "asset:table:pmid:33002344:4"], "steps": ["run_analysis"]}, "must_build": {"dsl_operations": [], "converters": [], "readers": [], "capabilities": [], "data_gaps": ["data:geo:None"]}, "gaps": ["data:accession_absent"]}, "review": {"state": "partial", "machine_critique": {"kind": "extraction_review", "reader": {"model": "MiniMax-M3.1-Flash", "provider": "minimax", "provider_family": "minimax", "read_at": "2026-10-31T19:12:07Z", "independence": "single_reader"}, "evidence_check": {"method": "verbatim", "availability": null}, "calls": 3, "usage": {"prompt_tokens": 32097, "completion_tokens": 1872, "cached_tokens": 792}}, "human_critique": null, "stages": [{"id": "extraction", "state": "complete", "reader": "MiniMax-M3.1-Flash", "provider": "minimax"}], "gaps": ["review.independent_reader", "review.machine_critique", "review.human_critique"]}, "execution": {"state": "absent", "status": "not_run", "mode": null, "runs": [], "gaps": ["execution.not_run"]}, "provenance": {"entities": [{"id": "pmid:33002344", "type": "paper", "label": "pmid:33002344"}, {"id": "source:pmid:33002344", "type": "manuscript", "label": "PMID 33002344 full text"}, {"id": "data:geo:None", "type": "dataset", "label": "GEO None"}], "activities": [{"id": "activity-reading-sci-2026-11-01", "type": "classification", "used": [{"id": "pmid:33002344", "type": "paper", "label": "pmid:33002344"}, {"id": "source:pmid:33002344", "type": "manuscript", "label": "PMID 33002344 full text"}, {"id": "data:geo:None", "type": "dataset", "label": "GEO None"}], "agent": "agent:corpus-assay-engine"}, {"id": "activity-read-33002344", "type": "extraction", "used": ["source:pmid:33002344"], "agent": "agent:minimax-reader"}, {"id": "activity-resolve-None", "type": "accession_resolution", "used": ["data:geo:None"], "agent": "agent:corpus-assay-engine"}], "agents": [{"id": "agent:corpus-assay-engine", "type": "software", "label": "Corpus assay engine"}, {"id": "agent:minimax-reader", "type": "software", "label": "MiniMax literature reader"}], "source_run_id": "reading-sci-2026-11-01", "dsl_catalogue_fingerprint": "343fb30756ba6ec3", "capability_table_fingerprint": "2cb3e42f047d2ecf", "snapshot_id": "ba34b49490d9bfaf"}, "lineage": {"parent_id": "pmid:33002344", "parent_hash": "sha256:a316d8e35c8721b729255785280845c47af463a7616af4979a80bfa06867e97d", "fork_of": null, "generation": 7}, "gaps": ["execution.not_run", "review.human_critique", "review.independent_reader", "review.machine_critique", "step:obtain_source_data blocked on data:accession_absent"], "assays": [{"role": "analysis", "definition_id": "differential_expression", "definition_version": "f2132e96ae6c7a4e", "definition_digest": null, "required_operations": ["normalise_counts", "differential_expression_fit", "fdr_bh"], "support_state": "supported", "source_hashes": {"dsl_catalogue": "f2132e96ae6c7a4e"}, "confidence": 1.0, "evidence": ["The DElncRNAs and DEmRNAs in STAD compared to adjacent normal tissues were calculated using the R package DESeq2. Benjamini and Hochberg multiple testing method was applied to acquire the false discovery rate (FDR)."], "order_basis": "analysis_only", "id": "assay:1"}]}