Identification of long-term survival-associated gene in breast cancer.

{"sci_version": "1.2", "schema": "https://corpus.bntrg.co.uk/sci/1.0/sci.schema.json", "id": "pmid:33080569", "kind": "science-record", "revision": 8, "content_hash": "sha256:7e0e906bd7fc863aa9692a4b01b18c80b8b15c1fa6022399f5fb8e5c5d188c74", "created_at": "2026-11-01T15:41:13Z", "updated_at": "2026-11-01T22:02:21Z", "generator": {"name": "corpus-assay-engine", "run_id": "reading-sci-2026-11-01"}, "paper": {"state": "complete", "title": "Identification of long-term survival-associated gene in breast cancer.", "doi": "10.18632/aging.103807", "pmid": "33080569", "authors": ["Shipeng Ning", "Hui Li", "Kun Qiao", "Qin Wang", "Meiying Shen", "Yujuan Kang", "Yanling Yin", "Jiena Liu", "Lei Liu", "Siyu Hou", "Jianyu Wang", "Shouping Xu", "Da Pang"], "journal": "Aging", "year": 2020, "abstract": "Breast cancer patients at the same stage may show different clinical prognoses or different therapeutic effects of systemic therapy. Differentially expressed genes of breast cancer were identified from GSE42568. Through survival, receiver operating characteristic (ROC) curve, random forest, GSVA and a Cox regression model analyses, genes were identified that could be associated with survival time in breast cancer. The molecular mechanism was identified by enrichment, GSEA, methylation and SNV analyses. Then, the expression of a key gene was verified by the TCGA dataset and RT-qPCR, Western blot, and immunohistochemistry. We identified 784 genes related to the 5-year overall survival time of breast cancer. Through ROC curve and random forest analysis, 10 prognostic genes were screened. These were integrated into a complex by GSVA, and high expression of the complex significantly promoted the recurrence-free survival of patients. In addition, key genes were related to immune and metabolic-related functions. Importantly, we identified methylation of MEX3A and TBC1D 9 and mutations events. Finally, the expression of UGCG was verified by the TCGA dataset and by experimental methods in our own samples. These results indicate that 10 genes may be potential biomarkers and therapeutic targets for long-term survival in breast cancer, especially UGCG.", "claims": [{"id": "claim-method", "statement": "A single factor Cox regression model was used to calculate the influence of clinical characteristics and mRNA expression level on the prognosis of breast cancer patients.", "kind": "methodological", "target": null, "evidence": [{"asset": "source:pmid:33080569", "locator": "sections[25] \"Statistical analysis\" paragraph 2", "quote": "A single factor Cox regression model was used to calculate the influence of clinical characteristics and mRNA expression level on the prognosis of breast cancer patients."}], "state": "complete"}, {"id": "claim-data-access", "statement": "The GEO dataset GSE42568 provided gene expression of 104 breast cancers and 17 normal breast biopsies, among them, there were 64 long survival time and 40 short survival time patients.", "kind": "methodological", "target": null, "evidence": [{"asset": "source:pmid:33080569", "locator": "sections[12] \"Data source and differential expression analysis\" paragraph 2", "quote": "The GEO dataset GSE42568 provided gene expression of 104 breast cancers and 17 normal breast biopsies, among them, there were 64 long survival time and 40 short survival time patients."}], "state": "complete"}], "gaps": []}, "experiment": {"state": "complete", "objective": null, "steps": [{"id": "read_published_estimate", "order": 1, "name": "Read the published estimate from the source", "kind": "other", "state": "complete", "blocked_on": null, "description": "The claim, method and evidence span published with the source article.", "duration_hours": null, "parameters": {}, "inputs": ["source:pmid:33080569"], "outputs": ["the published estimate and its evidence"], "instruments": [], "reagents": []}, {"id": "obtain_source_data", "order": 2, "name": "Obtain the source data from the named repository", "kind": "data-preparation", "state": "complete", "blocked_on": null, "description": "The GEO series accession resolves and its sample accessions are listed. This lane did not download the dataset or read its licence.", "duration_hours": null, "parameters": {}, "inputs": ["data:geo:GSE37751"], "outputs": ["the source data with its repository provenance"], "instruments": [], "reagents": []}, {"id": "run_analysis", "order": 3, "name": "Run the published analysis", "kind": "analysis", "state": "complete", "blocked_on": null, "description": "Apply the paper's statistical method to the resolved series and compare the result with the published target.", "duration_hours": null, "parameters": {}, "inputs": ["data:geo:GSE37751"], "outputs": ["the replicated result and its comparison"], "instruments": [], "reagents": []}], "materials": [], "instruments": [], "reagents": [], "conditions": {}, "gaps": []}, "data": {"state": "partial", "assets": [{"id": "source:pmid:33080569", "role": "manuscript", "format": "xml", "media_type": "application/xml", "uri": "https://doi.org/10.18632/aging.103807", "sha256": "sha256:25a1082214e7294394a7d9236a0f9dfc3189b8b34054c1514410e7edf80892cd", "bytes": 46521, "access": "open", "state": "resolved", "reader": null, "reader_status": "reader_required", "identifier": "10.18632/aging.103807", "version": null, "note": "Full article fetched from PMC; the checksum covers the rendered section body, not the original XML bytes.", "structure": {"pmcid": "PMC7655188", "source": "europe_pmc_fulltext", "coverage": "whole_body", "text_hash_scope": "rendered_section_body"}}, {"id": "data:geo:GSE37751", "role": "raw", "format": "geo-series", "media_type": "application/vnd.ncbi.geo-series+json", "uri": "https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE37751", "sha256": null, "bytes": null, "access": "open", "state": "resolved", "reader": null, "reader_status": "reader_required", "identifier": "GSE37751", "version": null, "note": "The GEO dataset GSE42568 provided gene expression of 104 breast cancers and 17 normal breast biopsies, among them, there were 64 long survival time and 40 short survival time patients.", "structure": {"repository": "GEO", "access_route": "GEO accession URL", "access_statement_verbatim": "The GEO dataset GSE42568 provided gene expression of 104 breast cancers and 17 normal breast biopsies, among them, there were 64 long survival time and 40 short survival time patients.", "access_statement_kind": "repository_route_statement", "sample_accessions": ["GSM926963", "GSM926964", "GSM926965", "GSM926966", "GSM926967", "GSM926968", "GSM926969", "GSM926970", "GSM926971", "GSM926972", "GSM926973", "GSM926974", "GSM926975", "GSM926976", "GSM926977", "GSM926978", "GSM926979", "GSM926980", "GSM926981", "GSM926982", "GSM926983", "GSM926984", "GSM926985", "GSM926986", "GSM926987", "GSM926988", "GSM926989", "GSM926990", "GSM926991", "GSM926992", "GSM926993", "GSM926994", "GSM926995", "GSM926996", "GSM926997", "GSM926998", "GSM926999", "GSM927000", "GSM927001", "GSM927002", "GSM927003", "GSM927004", "GSM927005", "GSM927006", "GSM927007", "GSM927008", "GSM927009", "GSM927010", "GSM927011", "GSM927012", "GSM927013", "GSM927014", "GSM927015", "GSM927016", "GSM927017", "GSM927018", "GSM927019", "GSM927020", "GSM927021", "GSM927022", "GSM927023", "GSM927024", "GSM927025", "GSM927026", "GSM927027", "GSM927028", "GSM927029", "GSM927030", "GSM927031", "GSM927032", "GSM927033", "GSM927034", "GSM927035", "GSM927036", "GSM927037", "GSM927038", "GSM927039", "GSM927040", "GSM927041", "GSM927042", "GSM927043", "GSM927044", "GSM927045", "GSM927046", "GSM927047", "GSM927048", "GSM927049", "GSM927050", "GSM927051", "GSM927052", "GSM927053", "GSM927054", "GSM927055", "GSM927056", "GSM927057", "GSM927058", "GSM927059", "GSM927060", "GSM927061", "GSM927062", "GSM927063", "GSM927064", "GSM927065", "GSM927066", "GSM927067", "GSM927068", "GSM927069", "GSM927070"], "sample_count": 108, "group_sizes": null, "group_sizes_basis": null, "platform": "6244", "taxon": "Homo sapiens", "title": "Molecular Profiles of Human Breast Cancer and Their Association with Tumor Subtypes and Disease Prognosis (Affymetrix)", "resolution_checked_at": "2026-11-01T15:39:54Z", "resolution_check": "identifier_resolution_only_no_download_no_licence_read", "downloaded": false, "licence_read": false}}, {"id": "data:geo:GSE37754", "role": "raw", "format": "geo-series", "media_type": "application/vnd.ncbi.geo-series+json", "uri": "https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE37754", "sha256": null, "bytes": null, "access": "open", "state": "resolved", "reader": null, "reader_status": "reader_required", "identifier": "GSE37754", "version": null, "note": "The GEO dataset GSE42568 provided gene expression of 104 breast cancers and 17 normal breast biopsies, among them, there were 64 long survival time and 40 short survival time patients.", "structure": {"repository": "GEO", "access_route": "GEO accession URL", "access_statement_verbatim": "The GEO dataset GSE42568 provided gene expression of 104 breast cancers and 17 normal breast biopsies, among them, there were 64 long survival time and 40 short survival time patients.", "access_statement_kind": "repository_route_statement", "sample_accessions": ["GSM927093", "GSM927094", "GSM927095", "GSM927096", "GSM927097", "GSM927098", "GSM927099", "GSM927100", "GSM927101", "GSM927102", "GSM927103", "GSM927104", "GSM927105", "GSM927106", "GSM927107", "GSM927108", "GSM927109", "GSM927110", "GSM927111", "GSM927112", "GSM927113", "GSM927114", "GSM927115", "GSM927116", "GSM927117", "GSM927118", "GSM927119", "GSM927120", "GSM927121", "GSM927122", "GSM927123", "GSM927124", "GSM927125", "GSM927126", "GSM927127", "GSM927128", "GSM927129", "GSM927130", "GSM927131", "GSM927132", "GSM927133", "GSM927134", "GSM927135", "GSM927136", "GSM927137", "GSM927138", "GSM927139", "GSM927140", "GSM927141", "GSM927142", "GSM927143", "GSM927144", "GSM927145", "GSM927146", "GSM927147", "GSM927148", "GSM927149", "GSM927150", "GSM927151", "GSM927152", "GSM927153", "GSM927154", "GSM927155", "GSM927156", "GSM927157", "GSM927158", "GSM927159", "GSM927160", "GSM927161", "GSM927162", "GSM927163", "GSM927164"], "sample_count": 72, "group_sizes": null, "group_sizes_basis": null, "platform": "13534", "taxon": "Homo sapiens", "title": "Molecular Profiles of Human Breast Cancer and Their Association with Tumor Subtypes and Disease Prognosis (Illumina)", "resolution_checked_at": "2026-11-01T15:39:54Z", "resolution_check": "identifier_resolution_only_no_download_no_licence_read", "downloaded": false, "licence_read": false}}, {"id": "data:geo:GSE42568", "role": "raw", "format": "geo-series", "media_type": "application/vnd.ncbi.geo-series+json", "uri": "https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE42568", "sha256": null, "bytes": null, "access": "open", "state": "resolved", "reader": null, "reader_status": "reader_required", "identifier": "GSE42568", "version": null, "note": "The GEO dataset GSE42568 provided gene expression of 104 breast cancers and 17 normal breast biopsies, among them, there were 64 long survival time and 40 short survival time patients.", "structure": {"repository": "GEO", "access_route": "GEO accession URL", "access_statement_verbatim": "The GEO dataset GSE42568 provided gene expression of 104 breast cancers and 17 normal breast biopsies, among them, there were 64 long survival time and 40 short survival time patients.", "access_statement_kind": "repository_route_statement", "sample_accessions": ["GSM1045191", "GSM1045192", "GSM1045193", "GSM1045194", "GSM1045195", "GSM1045196", "GSM1045197", "GSM1045198", "GSM1045199", "GSM1045200", "GSM1045201", "GSM1045202", "GSM1045203", "GSM1045204", "GSM1045205", "GSM1045206", "GSM1045207", "GSM1045208", "GSM1045209", "GSM1045210", "GSM1045211", "GSM1045212", "GSM1045213", "GSM1045214", "GSM1045215", "GSM1045216", "GSM1045217", "GSM1045218", "GSM1045219", "GSM1045220", "GSM1045221", "GSM1045222", "GSM1045223", "GSM1045224", "GSM1045225", "GSM1045226", "GSM1045227", "GSM1045228", "GSM1045229", "GSM1045230", "GSM1045231", "GSM1045232", "GSM1045233", "GSM1045234", "GSM1045235", "GSM1045236", "GSM1045237", "GSM1045238", "GSM1045239", "GSM1045240", "GSM1045241", "GSM1045242", "GSM1045243", "GSM1045244", "GSM1045245", "GSM1045246", "GSM1045247", "GSM1045248", "GSM1045249", "GSM1045250", "GSM1045251", "GSM1045252", "GSM1045253", "GSM1045254", "GSM1045255", "GSM1045256", "GSM1045257", "GSM1045258", "GSM1045259", "GSM1045260", "GSM1045261", "GSM1045262", "GSM1045263", "GSM1045264", "GSM1045265", "GSM1045266", "GSM1045267", "GSM1045268", "GSM1045269", "GSM1045270", "GSM1045271", "GSM1045272", "GSM1045273", "GSM1045274", "GSM1045275", "GSM1045276", "GSM1045277", "GSM1045278", "GSM1045279", "GSM1045280", "GSM1045281", "GSM1045282", "GSM1045283", "GSM1045284", "GSM1045285", "GSM1045286", "GSM1045287", "GSM1045288", "GSM1045289", "GSM1045290", "GSM1045291", "GSM1045292", "GSM1045293", "GSM1045294", "GSM1045295", "GSM1045296", "GSM1045297", "GSM1045298", "GSM1045299", "GSM1045300", "GSM1045301", "GSM1045302", "GSM1045303", "GSM1045304", "GSM1045305", "GSM1045306", "GSM1045307", "GSM1045308", "GSM1045309", "GSM1045310", "GSM1045311"], "sample_count": 121, "group_sizes": null, "group_sizes_basis": null, "platform": "570", "taxon": "Homo sapiens", "title": "Breast Cancer Gene Expression Analysis", "resolution_checked_at": "2026-11-01T15:39:54Z", "resolution_check": "identifier_resolution_only_no_download_no_licence_read", "downloaded": false, "licence_read": false}}, {"id": "data:geo:GSE7390", "role": "raw", "format": "geo-series", "media_type": "application/vnd.ncbi.geo-series+json", "uri": "https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE7390", "sha256": null, "bytes": null, "access": "open", "state": "resolved", "reader": null, "reader_status": "reader_required", "identifier": "GSE7390", "version": null, "note": "The GEO dataset GSE42568 provided gene expression of 104 breast cancers and 17 normal breast biopsies, among them, there were 64 long survival time and 40 short survival time patients.", "structure": {"repository": "GEO", "access_route": "GEO accession URL", "access_statement_verbatim": "The GEO dataset GSE42568 provided gene expression of 104 breast cancers and 17 normal breast biopsies, among them, there were 64 long survival time and 40 short survival time patients.", "access_statement_kind": "repository_route_statement", "sample_accessions": ["GSM177885", "GSM177886", "GSM177887", "GSM177888", "GSM177889", "GSM177890", "GSM177891", "GSM177892", "GSM177893", "GSM177894", "GSM177895", "GSM177896", "GSM177897", "GSM177898", "GSM177899", "GSM177900", "GSM177901", "GSM177902", "GSM177903", "GSM177904", "GSM177905", "GSM177906", "GSM177907", "GSM177908", "GSM177909", "GSM177910", "GSM177911", "GSM177912", "GSM177913", "GSM177914", "GSM177915", "GSM177916", "GSM177917", "GSM177918", "GSM177919", "GSM177920", "GSM177921", "GSM177922", "GSM177923", "GSM177924", "GSM177925", "GSM177926", "GSM177927", "GSM177928", "GSM177929", "GSM177930", "GSM177931", "GSM177932", "GSM177933", "GSM177934", "GSM177935", "GSM177936", "GSM177937", "GSM177938", "GSM177939", "GSM177940", "GSM177941", "GSM177942", "GSM177943", "GSM177944", "GSM177945", "GSM177946", "GSM177947", "GSM177948", "GSM177949", "GSM177950", "GSM177951", "GSM177952", "GSM177953", "GSM177954", "GSM177955", "GSM177956", "GSM177957", "GSM177958", "GSM177959", "GSM177960", "GSM177961", "GSM177962", "GSM177963", "GSM177964", "GSM177965", "GSM177966", "GSM177967", "GSM177968", "GSM177969", "GSM177970", "GSM177971", "GSM177972", "GSM177973", "GSM177974", "GSM177975", "GSM177976", "GSM177977", "GSM177978", "GSM177979", "GSM177980", "GSM177981", "GSM177982", "GSM177983", "GSM177984", "GSM177985", "GSM177986", "GSM177987", "GSM177988", "GSM177989", "GSM177990", "GSM177991", "GSM177992", "GSM177993", "GSM177994", "GSM177995", "GSM177996", "GSM177997", "GSM177998", "GSM177999", "GSM178000", "GSM178001", "GSM178002", "GSM178003", "GSM178004", "GSM178005", "GSM178006", "GSM178007", "GSM178008", "GSM178009", "GSM178010", "GSM178011", "GSM178012", "GSM178013", "GSM178014", "GSM178015", "GSM178016", "GSM178017", "GSM178018", "GSM178019", "GSM178020", "GSM178021", "GSM178022", "GSM178023", "GSM178024", "GSM178025", "GSM178026", "GSM178027", "GSM178028", "GSM178029", "GSM178030", "GSM178031", "GSM178032", "GSM178033", "GSM178034", "GSM178035", "GSM178036", "GSM178037", "GSM178038", "GSM178039", "GSM178040", "GSM178041", "GSM178042", "GSM178043", "GSM178044", "GSM178045", "GSM178046", "GSM178047", "GSM178048", "GSM178049", "GSM178050", "GSM178051", "GSM178052", "GSM178053", "GSM178054", "GSM178055", "GSM178056", "GSM178057", "GSM178058", "GSM178059", "GSM178060", "GSM178061", "GSM178062", "GSM178063", "GSM178064", "GSM178065", "GSM178066", "GSM178067", "GSM178068", "GSM178069", "GSM178070", "GSM178071", "GSM178072", "GSM178073", "GSM178074", "GSM178075", "GSM178076", "GSM178077", "GSM178078", "GSM178079", "GSM178080", "GSM178081", "GSM178082"], "sample_count": 198, "group_sizes": null, "group_sizes_basis": null, "platform": "96", "taxon": "Homo sapiens", "title": "Strong Time Dependence of the 76-Gene Prognostic Signature", "resolution_checked_at": "2026-11-01T15:39:55Z", "resolution_check": "identifier_resolution_only_no_download_no_licence_read", "downloaded": false, "licence_read": false}}, {"id": "asset:table:pmid:33080569:1", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:7b5175198965937ec32344bb731ec20346aaee9de02352b3a6202d3beb6622ab", "bytes": 323, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[21]/table-wrap[1]#t1", "version": null, "note": "Primer sequence of UGCG and GAPDH.", "structure": {"pmcid": "PMC7655188", "section_index": 21, "section_title": "Quantitative real-time PCR with reverse transcription (qRT–PCR)", "row_count": 4, "column_count": 2}, "table": {"label": "Table 1", "caption": "Primer sequence of UGCG and GAPDH.", "rows": [["UGCG_F", "TTCTTGGTGCTGTGGCTGATGC"], ["UGCG_R", "AGAGAGACACCTGGGAGCTTGC"], ["GAPDH_F", "AGAAGGCTGGGGCTCATTTG"], ["GAPDH_R", "AGGGGCCATCCACAGTCTTC"]], "row_count": 4, "column_count": 2, "numeric_cells": 0, "header_rows": 0, "locator": "section[21]/table-wrap[1]#t1"}}], "gaps": ["asset:data:geo:GSE37751 not downloaded", "asset:data:geo:GSE37751 licence not read", "asset:data:geo:GSE37754 not downloaded", "asset:data:geo:GSE37754 licence not read", "asset:data:geo:GSE42568 not downloaded", "asset:data:geo:GSE42568 licence not read", "asset:data:geo:GSE7390 not downloaded", "asset:data:geo:GSE7390 licence not read"]}, "analysis": {"state": "complete", "methods": [{"id": "method-1", "family": "survival_analysis", "specific": "cox_proportional_hazards", "label": "Survival analysis", "dsl_operations": ["cox_ph"], "missing_operations": [], "expressible": true, "parameters": {}, "data_shapes": ["time_to_event_with_censoring"], "evidence": {"score": 1.0, "band": "verbatim", "quote": "A single factor Cox regression model was used to calculate the influence of clinical characteristics and mRNA expression level on the prognosis of breast cancer patients."}}, {"id": "method-2", "family": "principal_component_analysis", "specific": "pca", "label": "Principal component analysis", "dsl_operations": ["pca_fit"], "missing_operations": [], "expressible": true, "parameters": {}, "data_shapes": ["wide_numeric_matrix"], "evidence": {"score": 0.8, "band": "high", "quote": "PCA"}}, {"id": "method-3", "family": "machine_learning", "specific": "random_forest", "label": "Machine learning", "dsl_operations": [], "missing_operations": ["machine_learning_random_forest"], "expressible": false, "parameters": {}, "data_shapes": ["labelled_feature_matrix"], "evidence": {"score": 0.7, "band": "medium", "quote": "random forest"}}, {"id": "method-4", "family": "diagnostic_evaluation", "specific": "roc", "label": "Diagnostic test evaluation", "dsl_operations": ["confusion_counts", "roc_curve", "sensitivity_specificity", "solve_confusion_matrix", "classification_metrics", "published_precision_envelope"], "missing_operations": [], "expressible": true, "parameters": {}, "data_shapes": ["reference_standard_and_test"], "evidence": {"score": 0.7, "band": "medium", "quote": "ROC curve"}}], "targets": [], "gaps": []}, "capability": {"state": "complete", "requirements": [{"capability_id": "capability:computational_analysis", "label": "Computational analysis platform", "assay_families": ["meta_analysis", "machine_learning", "survival_analysis", "statistical_regression", "pca", "molecular_docking", "network_analysis", "differential_expression", "gwas"], "availability_state": "owned", "tier_unlocked": "R1", "candidate": "Automated Assays Laravel application and simulated adapters"}], "gaps": []}, "readiness": {"state": "complete", "tier": "R1", "blocking_axis": "none", "blocked_on": "nothing:replicable_now", "axes": {"method": {"tier": "R1", "expressible": true, "required_operations": ["cox_ph"], "missing_operations": [], "basis": "The paper names the method it used and the corpus's method extractor maps it onto the DSL catalogue: cox_proportional_hazards."}, "capability": {"tier": "R1", "capability_id": "capability:computational_analysis", "availability_state": "owned", "basis": "The computational analysis is owned. The physical bench the paper used is not, so a physical validation cannot be run here."}, "data": {"tier": "R1", "reachable": true, "accessions": ["GSE42568", "GSE37751", "GSE7390", "GSE37754"], "resolved_accessions": ["GSE42568", "GSE37751", "GSE7390", "GSE37754"], "statements": ["The GEO dataset GSE42568 provided gene expression of 104 breast cancers and 17 normal breast biopsies, among them, there were 64 long survival time and 40 short survival time patients."], "basis": "The paper names GSE42568, GSE37751, GSE7390, GSE37754 in Gene Expression Omnibus (GEO) and the accession resolves in the repository. No dataset was downloaded and no licence was read."}}, "can_run": {"dsl_operations": ["cox_ph"], "assets": ["source:pmid:33080569", "data:geo:GSE37751", "asset:table:pmid:33080569:1"], "steps": ["run_analysis"]}, "must_build": {"dsl_operations": [], "converters": [], "readers": [], "capabilities": [], "data_gaps": ["data:geo:GSE37751"]}, "gaps": []}, "review": {"state": "partial", "machine_critique": {"kind": "extraction_review", "reader": {"model": "MiniMax-M3.1-Flash", "provider": "minimax", "provider_family": "minimax", "read_at": "2026-10-31T18:23:18Z", "independence": "single_reader"}, "evidence_check": {"method": "verbatim", "availability": null}, "calls": 3, "usage": {"prompt_tokens": 35980, "completion_tokens": 1620, "cached_tokens": 784}}, "human_critique": null, "stages": [{"id": "extraction", "state": "complete", "reader": "MiniMax-M3.1-Flash", "provider": "minimax"}], "gaps": ["review.independent_reader", "review.machine_critique", "review.human_critique"]}, "execution": {"state": "absent", "status": "not_run", "mode": null, "runs": [], "gaps": ["execution.not_run"]}, "provenance": {"entities": [{"id": "pmid:33080569", "type": "paper", "label": "pmid:33080569"}, {"id": "source:pmid:33080569", "type": "manuscript", "label": "PMID 33080569 full text"}, {"id": "data:geo:GSE37751", "type": "dataset", "label": "GEO GSE37751"}], "activities": [{"id": "activity-reading-sci-2026-11-01", "type": "classification", "used": [{"id": "pmid:33080569", "type": "paper", "label": "pmid:33080569"}, {"id": "source:pmid:33080569", "type": "manuscript", "label": "PMID 33080569 full text"}, {"id": "data:geo:GSE37751", "type": "dataset", "label": "GEO GSE37751"}], "agent": "agent:corpus-assay-engine"}, {"id": "activity-read-33080569", "type": "extraction", "used": ["source:pmid:33080569"], "agent": "agent:minimax-reader"}, {"id": "activity-resolve-GSE37751", "type": "accession_resolution", "used": ["data:geo:GSE37751"], "agent": "agent:corpus-assay-engine"}], "agents": [{"id": "agent:corpus-assay-engine", "type": "software", "label": "Corpus assay engine"}, {"id": "agent:minimax-reader", "type": "software", "label": "MiniMax literature reader"}], "source_run_id": "reading-sci-2026-11-01", "dsl_catalogue_fingerprint": "343fb30756ba6ec3", "capability_table_fingerprint": "2cb3e42f047d2ecf", "snapshot_id": "ba34b49490d9bfaf"}, "lineage": {"parent_id": "pmid:33080569", "parent_hash": "sha256:2219d3b59e3d705ddd558f606474d0734a244b0701164793bc2146f36fad436e", "fork_of": null, "generation": 7}, "gaps": ["asset:data:geo:GSE37751 licence not read", "asset:data:geo:GSE37751 not downloaded", "asset:data:geo:GSE37754 licence not read", "asset:data:geo:GSE37754 not downloaded", "asset:data:geo:GSE42568 licence not read", "asset:data:geo:GSE42568 not downloaded", "asset:data:geo:GSE7390 licence not read", "asset:data:geo:GSE7390 not downloaded", "execution.not_run", "review.human_critique", "review.independent_reader", "review.machine_critique"], "assays": [{"role": "analysis", "definition_id": "survival_analysis", "definition_version": "f2132e96ae6c7a4e", "definition_digest": null, "required_operations": ["cox_ph"], "support_state": "supported", "source_hashes": {"dsl_catalogue": "f2132e96ae6c7a4e"}, "confidence": 1.0, "evidence": ["A single factor Cox regression model was used to calculate the influence of clinical characteristics and mRNA expression level on the prognosis of breast cancer patients."], "order_basis": "analysis_only", "id": "assay:1"}]}