Desmoglein 3 and Keratin 14 for Distinguishing Between Lung Adenocarcinoma and Lung Squamous Cell Carcinoma.

{"sci_version": "1.2", "schema": "https://corpus.bntrg.co.uk/sci/1.0/sci.schema.json", "id": "pmid:33149622", "kind": "science-record", "revision": 8, "content_hash": "sha256:0b0172f2695cdbd5445c6cd2ab9391165e9634bf81f4082c21bab5bf9b052120", "created_at": "2026-11-01T15:41:14Z", "updated_at": "2026-11-01T22:45:33Z", "generator": {"name": "corpus-assay-engine", "run_id": "reading-sci-2026-11-01"}, "paper": {"state": "complete", "title": "Desmoglein 3 and Keratin 14 for Distinguishing Between Lung Adenocarcinoma and Lung Squamous Cell Carcinoma.", "doi": "10.2147/OTT.S270398", "pmid": "33149622", "authors": ["Yanting Dong", "Shicheng Li", "Xiao Sun", "Yuanyong Wang", "Tong Lu", "Yang Wo", "Xiaoliang Leng", "Dezhi Kong", "Wenjie Jiao"], "journal": "OncoTargets and therapy", "year": 2020, "abstract": "BACKGROUND: Lung adenocarcinoma (LUAD) and lung squamous cell carcinoma (LUSC) are the leading major histological phenotypes of all non-small cell lung cancer (NSCLC). In this study, the candidate genes and the potential tumorigenesis distinguishing between LUAD and LUSC were analyzed.\nMETHODS: The present study investigated two microarray datasets (GSE28571 and GSE10245) downloaded from the Gene Expression Omnibus (GEO) database. A protein-protein interaction (PPI) network was applied to screen out the candidate genes. In addition, differently expressed genes (DEGs) between lung adenocarcinoma and lung squamous cell carcinoma of the two datasets were functionally analyzed by Gene Ontology (GO) and the Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway enrichment. R 4.0.2 was used to perform Kaplan-Meier analysis of DSG3 (desmoglein 3) and KRT14 (keratin 14) by analyzing the expression and clinical data from The Cancer Genome Atlas (TCGA) database.\nRESULTS: The results revealed that 47 DEGs of the two datasets were ascertained in our study. It was found that the DEGs were mainly involved in pathways related to p63 transcription factor network and validated transcriptional factor targeting TAp63, etc. Based on the analysis, we finally identified DSG3 and KRT14 as potential biomarkers for distinguishing between LUAD and LUSC. These results suggested that DSG3 and KRT14 could have the potential to play an important role in NSCLC patients, as diagnostic markers. At the same time, DSG3 or KRT14 indicated a worse prognosis in LUSC patients, which were associated with pathways relevant to the TRAIL signaling pathway and TNF receptor signaling pathway according to bioinformatic analysis.\nCONCLUSION: The DSG3 and KRT14 have the potential to be used as diagnostic markers, which presented here may facilitate improvements in distinguishing between LUAD and LUSC in advanced NSCLC patients.", "claims": [{"id": "claim-data-access", "statement": "All data generated or analyzed during this study are included in this published article.", "kind": "methodological", "target": null, "evidence": [{"asset": "source:pmid:33149622", "locator": "sections[23] \"Data Sharing Statement\" paragraph 2", "quote": "All data generated or analyzed during this study are included in this published article."}], "state": "complete"}], "gaps": []}, "experiment": {"state": "complete", "objective": null, "steps": [{"id": "read_published_estimate", "order": 1, "name": "Read the published estimate from the source", "kind": "other", "state": "complete", "blocked_on": null, "description": "The claim, method and evidence span published with the source article.", "duration_hours": null, "parameters": {}, "inputs": ["source:pmid:33149622"], "outputs": ["the published estimate and its evidence"], "instruments": [], "reagents": []}, {"id": "obtain_source_data", "order": 2, "name": "Obtain the source data from the named repository", "kind": "data-preparation", "state": "complete", "blocked_on": null, "description": "The GEO series accession resolves and its sample accessions are listed. This lane did not download the dataset or read its licence.", "duration_hours": null, "parameters": {}, "inputs": ["data:geo:GSE10245"], "outputs": ["the source data with its repository provenance"], "instruments": [], "reagents": []}, {"id": "run_analysis", "order": 3, "name": "Run the published analysis", "kind": "analysis", "state": "complete", "blocked_on": null, "description": "Apply the paper's statistical method to the resolved series and compare the result with the published target.", "duration_hours": null, "parameters": {}, "inputs": ["data:geo:GSE10245"], "outputs": ["the replicated result and its comparison"], "instruments": [], "reagents": []}], "materials": [], "instruments": [], "reagents": [], "conditions": {}, "gaps": []}, "data": {"state": "partial", "assets": [{"id": "source:pmid:33149622", "role": "manuscript", "format": "xml", "media_type": "application/xml", "uri": "https://doi.org/10.2147/OTT.S270398", "sha256": "sha256:6342264a2bfd31f13cad0f2f513f382d9715b8787b973545740f5c66ee9c2467", "bytes": 32496, "access": "open", "state": "resolved", "reader": null, "reader_status": "reader_required", "identifier": "10.2147/OTT.S270398", "version": null, "note": "Full article fetched from PMC; the checksum covers the rendered section body, not the original XML bytes.", "structure": {"pmcid": "PMC7605657", "source": "europe_pmc_fulltext", "coverage": "whole_body", "text_hash_scope": "rendered_section_body"}}, {"id": "data:geo:GSE10245", "role": "raw", "format": "geo-series", "media_type": "application/vnd.ncbi.geo-series+json", "uri": "https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE10245", "sha256": null, "bytes": null, "access": "open", "state": "resolved", "reader": null, "reader_status": "reader_required", "identifier": "GSE10245", "version": null, "note": "All data generated or analyzed during this study are included in this published article.", "structure": {"repository": "GEO", "access_route": "GEO accession URL", "access_statement_verbatim": "All data generated or analyzed during this study are included in this published article.", "access_statement_kind": "data_availability_statement", "sample_accessions": ["GSM258551", "GSM258552", "GSM258553", "GSM258554", "GSM258555", "GSM258556", "GSM258557", "GSM258558", "GSM258559", "GSM258560", "GSM258561", "GSM258562", "GSM258563", "GSM258564", "GSM258565", "GSM258566", "GSM258567", "GSM258568", "GSM258569", "GSM258570", "GSM258571", "GSM258572", "GSM258573", "GSM258574", "GSM258575", "GSM258576", "GSM258577", "GSM258578", "GSM258579", "GSM258580", "GSM258581", "GSM258582", "GSM258583", "GSM258584", "GSM258585", "GSM258586", "GSM258587", "GSM258588", "GSM258589", "GSM258590", "GSM258591", "GSM258592", "GSM258593", "GSM258594", "GSM258595", "GSM258596", "GSM258597", "GSM258598", "GSM258599", "GSM258600", "GSM258601", "GSM258602", "GSM258603", "GSM258604", "GSM258605", "GSM258606", "GSM258607", "GSM258608"], "sample_count": 58, "group_sizes": null, "group_sizes_basis": null, "platform": "570", "taxon": "Homo sapiens", "title": "Gene expression differences between adenocarcinoma and squamous cell carcinoma in human NSCLC", "resolution_checked_at": "2026-11-01T15:39:54Z", "resolution_check": "identifier_resolution_only_no_download_no_licence_read", "downloaded": false, "licence_read": false}}, {"id": "data:geo:GSE28571", "role": "raw", "format": "geo-series", "media_type": "application/vnd.ncbi.geo-series+json", "uri": "https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE28571", "sha256": null, "bytes": null, "access": "open", "state": "resolved", "reader": null, "reader_status": "reader_required", "identifier": "GSE28571", "version": null, "note": "All data generated or analyzed during this study are included in this published article.", "structure": {"repository": "GEO", "access_route": "GEO accession URL", "access_statement_verbatim": "All data generated or analyzed during this study are included in this published article.", "access_statement_kind": "data_availability_statement", "sample_accessions": ["GSM707333", "GSM707334", "GSM707335", "GSM707336", "GSM707337", "GSM707338", "GSM707339", "GSM707340", "GSM707341", "GSM707342", "GSM707343", "GSM707344", "GSM707345", "GSM707346", "GSM707347", "GSM707348", "GSM707349", "GSM707350", "GSM707351", "GSM707352", "GSM707353", "GSM707354", "GSM707355", "GSM707356", "GSM707357", "GSM707358", "GSM707359", "GSM707360", "GSM707361", "GSM707362", "GSM707363", "GSM707364", "GSM707365", "GSM707366", "GSM707367", "GSM707368", "GSM707369", "GSM707370", "GSM707371", "GSM707372", "GSM707373", "GSM707374", "GSM707375", "GSM707376", "GSM707377", "GSM707378", "GSM707379", "GSM707380", "GSM707381", "GSM707382", "GSM707383", "GSM707384", "GSM707385", "GSM707386", "GSM707387", "GSM707388", "GSM707389", "GSM707390", "GSM707391", "GSM707392", "GSM707393", "GSM707394", "GSM707395", "GSM707396", "GSM707397", "GSM707398", "GSM707399", "GSM707400", "GSM707401", "GSM707402", "GSM707403", "GSM707404", "GSM707405", "GSM707406", "GSM707407", "GSM707408", "GSM707409", "GSM707410", "GSM707411", "GSM707412", "GSM707413", "GSM707414", "GSM707415", "GSM707416", "GSM707417", "GSM707418", "GSM707419", "GSM707420", "GSM707421", "GSM707422", "GSM707423", "GSM707424", "GSM707425", "GSM707426", "GSM707427", "GSM707428", "GSM707429", "GSM707430", "GSM707431", "GSM707432"], "sample_count": 100, "group_sizes": null, "group_sizes_basis": null, "platform": "570", "taxon": "Homo sapiens", "title": "Gene Copy Number Aberrations are Associated with Survival in Histological Subgroups of Non-Small Cell Lung Cancer (expression data)", "resolution_checked_at": "2026-11-01T15:39:54Z", "resolution_check": "identifier_resolution_only_no_download_no_licence_read", "downloaded": false, "licence_read": false}}, {"id": "asset:table:pmid:33149622:1", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:c80140ad244bf7125e85a5eb1fa78686835ce3f4b9d145f2bd034f00df81893a", "bytes": 419, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[8]/table-wrap[1]#t0001", "version": null, "note": "The Primer Sequence of Related Genes", "structure": {"pmcid": "PMC7605657", "section_index": 8, "section_title": "Total RNA Extraction and Quantitative Real-Time PCR", "row_count": 4, "column_count": 3}, "table": {"label": "Table 1", "caption": "The Primer Sequence of Related Genes", "rows": [["Gene", "Sense (5ʹ-3ʹ)", "Antisense (5ʹ-3ʹ)"], ["Desmoglein 3", "TATGAACAACTACAAAGCGTGAAAC", "TTGGAAGCAGGACGGAAT"], ["Keratin 14", "AGGAGATCGCCACCTACCGC", "GCTGGGCAGCCTCAGTTCTTG"], ["GAPDH", "CTGACTTCAACAGCGACACC", "TGCTGTAGCCAAATTCGTTGT"]], "row_count": 4, "column_count": 3, "numeric_cells": 4, "header_rows": 1, "locator": "section[8]/table-wrap[1]#t0001"}}], "gaps": ["asset:data:geo:GSE10245 not downloaded", "asset:data:geo:GSE10245 licence not read", "asset:data:geo:GSE28571 not downloaded", "asset:data:geo:GSE28571 licence not read"]}, "analysis": {"state": "partial", "methods": [{"id": "method-1", "family": "differential_expression", "specific": "limma_voom", "label": "Differential expression analysis", "dsl_operations": ["normalise_counts", "differential_expression_fit", "fdr_bh"], "missing_operations": [], "expressible": true, "parameters": {}, "data_shapes": ["count_matrix_with_condition"], "evidence": {"score": 1.0, "band": "reordered", "quote": "“The two gene expression profiles, GSE10245 and GSE28571, were obtained from the National Center for Biotechnology Information (NCBI) Gene Expression Omnibus database (GEO, http://www.ncbi.nlm.nih.gov/geo/), which were submitted by Ruprecht Kuner and Anders Isaksson, respectively.” “The LUAD and LUSC samples were compared by the limma package, a linear regression model.” “Furthermore, the P-value was accessed by the Benjamini-Hochberg method.”"}}, {"id": "method-2", "family": "survival_analysis", "specific": "kaplan_meier", "label": "Survival analysis", "dsl_operations": ["survival_km"], "missing_operations": [], "expressible": true, "parameters": {}, "data_shapes": ["time_to_event_with_censoring"], "evidence": {"score": 0.7, "band": "medium", "quote": "Kaplan-Meier"}}, {"id": "method-3", "family": "regression_modelling", "specific": "ols", "label": "Regression modelling", "dsl_operations": ["ols_fit"], "missing_operations": [], "expressible": true, "parameters": {}, "data_shapes": ["predictors_and_outcome"], "evidence": {"score": 0.8, "band": "high", "quote": "linear regression"}}, {"id": "method-4", "family": "network_analysis", "specific": "ppi_network", "label": "Network / pathway analysis", "dsl_operations": ["build_graph", "centrality_scores", "pathway_enrich"], "missing_operations": [], "expressible": true, "parameters": {}, "data_shapes": ["edge_list"], "evidence": {"score": 0.7, "band": "medium", "quote": "protein-protein interaction"}}, {"id": "method-5", "family": "network_analysis", "specific": "pathway_enrichment", "label": "Network / pathway analysis", "dsl_operations": ["pathway_enrich"], "missing_operations": [], "expressible": true, "parameters": {}, "data_shapes": ["edge_list"], "evidence": {"score": 0.7, "band": "medium", "quote": "pathway enrichment"}}], "targets": [], "gaps": ["method.reader_differs_from_extractor"]}, "capability": {"state": "complete", "requirements": [{"capability_id": "capability:computational_analysis", "label": "Computational analysis platform", "assay_families": ["meta_analysis", "machine_learning", "survival_analysis", "statistical_regression", "pca", "molecular_docking", "network_analysis", "differential_expression", "gwas"], "availability_state": "owned", "tier_unlocked": "R1", "candidate": "Automated Assays Laravel application and simulated adapters"}], "gaps": []}, "readiness": {"state": "complete", "tier": "R1", "blocking_axis": "none", "blocked_on": "nothing:replicable_now", "axes": {"method": {"tier": "R1", "expressible": true, "required_operations": ["normalise_counts", "differential_expression_fit", "fdr_bh"], "missing_operations": [], "basis": "The paper names the method it used and the corpus's method extractor maps it onto the DSL catalogue: limma_voom."}, "capability": {"tier": "R1", "capability_id": "capability:computational_analysis", "availability_state": "owned", "basis": "The computational analysis is owned. The physical bench the paper used is not, so a physical validation cannot be run here."}, "data": {"tier": "R1", "reachable": true, "accessions": ["GSE10245", "GSE28571"], "resolved_accessions": ["GSE10245", "GSE28571"], "statements": ["All data generated or analyzed during this study are included in this published article."], "basis": "The paper names GSE10245, GSE28571 in NCBI Gene Expression Omnibus (GEO) and the accession resolves in the repository. No dataset was downloaded and no licence was read."}}, "can_run": {"dsl_operations": ["normalise_counts", "differential_expression_fit", "fdr_bh"], "assets": ["source:pmid:33149622", "data:geo:GSE10245", "asset:table:pmid:33149622:1"], "steps": ["run_analysis"]}, "must_build": {"dsl_operations": [], "converters": [], "readers": [], "capabilities": [], "data_gaps": ["data:geo:GSE10245"]}, "gaps": []}, "review": {"state": "partial", "machine_critique": {"kind": "extraction_review", "reader": {"model": "MiniMax-M3.1-Flash", "provider": "minimax", "provider_family": "minimax", "read_at": "2026-10-31T18:23:50Z", "independence": "single_reader"}, "evidence_check": {"method": "reordered", "availability": "verbatim"}, "calls": 3, "usage": {"prompt_tokens": 25807, "completion_tokens": 1347, "cached_tokens": 784}}, "human_critique": null, "stages": [{"id": "extraction", "state": "complete", "reader": "MiniMax-M3.1-Flash", "provider": "minimax"}], "gaps": ["review.independent_reader", "review.machine_critique", "review.human_critique"]}, "execution": {"state": "absent", "status": "not_run", "mode": null, "runs": [], "gaps": ["execution.not_run"]}, "provenance": {"entities": [{"id": "pmid:33149622", "type": "paper", "label": "pmid:33149622"}, {"id": "source:pmid:33149622", "type": "manuscript", "label": "PMID 33149622 full text"}, {"id": "data:geo:GSE10245", "type": "dataset", "label": "GEO GSE10245"}], "activities": [{"id": "activity-reading-sci-2026-11-01", "type": "classification", "used": [{"id": "pmid:33149622", "type": "paper", "label": "pmid:33149622"}, {"id": "source:pmid:33149622", "type": "manuscript", "label": "PMID 33149622 full text"}, {"id": "data:geo:GSE10245", "type": "dataset", "label": "GEO GSE10245"}], "agent": "agent:corpus-assay-engine"}, {"id": "activity-read-33149622", "type": "extraction", "used": ["source:pmid:33149622"], "agent": "agent:minimax-reader"}, {"id": "activity-resolve-GSE10245", "type": "accession_resolution", "used": ["data:geo:GSE10245"], "agent": "agent:corpus-assay-engine"}], "agents": [{"id": "agent:corpus-assay-engine", "type": "software", "label": "Corpus assay engine"}, {"id": "agent:minimax-reader", "type": "software", "label": "MiniMax literature reader"}], "source_run_id": "reading-sci-2026-11-01", "dsl_catalogue_fingerprint": "343fb30756ba6ec3", "capability_table_fingerprint": "2cb3e42f047d2ecf", "snapshot_id": "ba34b49490d9bfaf"}, "lineage": {"parent_id": "pmid:33149622", "parent_hash": "sha256:b91c0eeaadad55b038211fe4f8e2d8d371302b20fbbc9a1ffcc3fa6b8b1b9fc1", "fork_of": null, "generation": 7}, "gaps": ["asset:data:geo:GSE10245 licence not read", "asset:data:geo:GSE10245 not downloaded", "asset:data:geo:GSE28571 licence not read", "asset:data:geo:GSE28571 not downloaded", "execution.not_run", "method.reader_differs_from_extractor", "review.human_critique", "review.independent_reader", "review.machine_critique"], "assays": [{"role": "data_generation", "definition_id": "microarray", "definition_version": "99e1195c7d6f", "definition_digest": null, "required_operations": [], "support_state": "partial", "source_hashes": {"assay_lexicon": "99e1195c7d6f"}, "confidence": 0.93, "evidence": ["METHODS: The present study investigated two microarray datasets (GSE28571 and GSE10245) downloaded"], "order_basis": "paper_text_order:396", "id": "assay:1"}, {"role": "analysis", "definition_id": "differential_expression", "definition_version": "f2132e96ae6c7a4e", "definition_digest": null, "required_operations": ["normalise_counts", "differential_expression_fit", "fdr_bh"], "support_state": "supported", "source_hashes": {"dsl_catalogue": "f2132e96ae6c7a4e"}, "confidence": 1.0, "evidence": ["“The two gene expression profiles, GSE10245 and GSE28571, were obtained from the National Center for Biotechnology Information (NCBI) Gene Expression Omnibus database (GEO, http://www.ncbi.nlm.nih.gov/geo/), which were submitted by Ruprecht Kuner and Anders Isaksson, respectively.” “The LUAD and LUSC samples were compared by the limma package, a linear regression model.” “Furthermore, the P-value was accessed by the Benjamini-Hochberg method.”"], "order_basis": "consumes_earlier_output", "id": "assay:2"}]}