← All .science files
pmid:33161156
Inflammation-Associated Senescence Promotes Helicobacter pylori-Induced Atrophic Gastritis.
Qinbo Cai · Peng Shi · Yujie Yuan · Jianjun Peng · Xinde Ou · Wen Zhou · Jin Li · Taiqiang Su · Liangliang Lin · Shirong Cai · Yulong He · Jianbo Xu
Cellular and molecular gastroenterology and hepatology · 2021 doi:10.1016/j.jcmgh.2020.10.015
Paper
complete
Experiment
complete
Data
partial
Analysis
partial
Execution
absent
Execution evidence has not yet been added to this .science file. Explore its methods, data and open questions to plan the next step.
Record details sci_version · id · kind · revision · content_hash · schema · created_at · updated_at · generator
paper object · 10 fields
authors array · 12 items
claims array · 2 items
[0] object · 6 fields
[1] object · 6 fields
evidence array · 1 item
[0] object · 3 fields
gaps array · 0 items
experiment object · 8 fields
steps array · 3 items
[0] object · 13 fields
parameters object · 0 fields
inputs array · 1 item
outputs array · 1 item
instruments array · 0 items
reagents array · 0 items
[1] object · 13 fields
parameters object · 0 fields
inputs array · 1 item
outputs array · 1 item
instruments array · 0 items
reagents array · 0 items
[2] object · 13 fields
parameters object · 0 fields
inputs array · 1 item
outputs array · 1 item
instruments array · 0 items
reagents array · 0 items
materials array · 0 items
instruments array · 0 items
reagents array · 0 items
conditions object · 0 fields
gaps array · 0 items
data object · 3 fields
assets array · 8 items
[0] object · 15 fields
structure object · 4 fields
[1] object · 15 fields
structure object · 15 fields
sample_accessions array · 54 items
[2] object · 15 fields
structure object · 15 fields
sample_accessions array · 24 items
[3] object · 15 fields
structure object · 15 fields
sample_accessions array · 24 items
[4] object · 16 fields
structure object · 5 fields
table object · 8 fields
rows array · 37 items
[0] array · 2 items
[1] array · 2 items
[2] array · 2 items
[3] array · 2 items
[4] array · 2 items
[5] array · 2 items
[6] array · 2 items
[7] array · 2 items
[8] array · 2 items
[9] array · 2 items
[10] array · 2 items
[11] array · 2 items
[12] array · 2 items
[13] array · 2 items
[14] array · 2 items
[15] array · 2 items
[16] array · 2 items
[17] array · 2 items
[18] array · 2 items
[19] array · 2 items
[20] array · 2 items
[21] array · 2 items
[22] array · 2 items
[23] array · 2 items
[24] array · 2 items
[25] array · 2 items
[26] array · 2 items
[27] array · 2 items
[28] array · 2 items
[29] array · 2 items
[30] array · 2 items
[31] array · 2 items
[32] array · 2 items
[33] array · 2 items
[34] array · 2 items
[35] array · 2 items
[36] array · 2 items
[5] object · 16 fields
structure object · 5 fields
table object · 8 fields
rows array · 13 items
[0] array · 2 items
[1] array · 2 items
[2] array · 2 items
[3] array · 2 items
[4] array · 2 items
[5] array · 2 items
[6] array · 2 items
[7] array · 2 items
[8] array · 2 items
[9] array · 2 items
[10] array · 2 items
[11] array · 2 items
[12] array · 2 items
[6] object · 16 fields
structure object · 5 fields
table object · 8 fields
rows array · 31 items
[0] array · 3 items
[1] array · 3 items
[2] array · 3 items
[3] array · 3 items
[4] array · 3 items
[5] array · 3 items
[6] array · 3 items
[7] array · 3 items
[8] array · 3 items
[9] array · 3 items
[10] array · 3 items
[11] array · 3 items
[12] array · 3 items
[13] array · 3 items
[14] array · 3 items
[15] array · 3 items
[16] array · 3 items
[17] array · 3 items
[18] array · 3 items
[19] array · 3 items
[20] array · 3 items
[21] array · 3 items
[22] array · 3 items
[23] array · 3 items
[24] array · 3 items
[25] array · 3 items
[26] array · 3 items
[27] array · 3 items
[28] array · 3 items
[29] array · 3 items
[30] array · 3 items
[7] object · 16 fields
structure object · 5 fields
table object · 8 fields
rows array · 16 items
[0] array · 2 items
[1] array · 2 items
[2] array · 2 items
[3] array · 2 items
[4] array · 2 items
[5] array · 2 items
[6] array · 2 items
[7] array · 2 items
[8] array · 2 items
[9] array · 2 items
[10] array · 2 items
[11] array · 2 items
[12] array · 2 items
[13] array · 2 items
[14] array · 2 items
[15] array · 2 items
gaps array · 6 items
analysis object · 4 fields
methods array · 1 item
[0] object · 10 fields
dsl_operations array · 0 items
missing_operations array · 0 items
parameters object · 0 fields
data_shapes array · 0 items
targets array · 0 items
gaps array · 1 item
capability object · 3 fields
requirements array · 1 item
[0] object · 6 fields
assay_families array · 9 items
gaps array · 0 items
readiness object · 8 fields
axes object · 3 fields
method object · 5 fields
required_operations array · 0 items
missing_operations array · 0 items
capability object · 4 fields
data object · 6 fields
accessions array · 3 items
resolved_accessions array · 3 items
statements array · 1 item
can_run object · 3 fields
dsl_operations array · 0 items
assets array · 6 items
steps array · 1 item
must_build object · 5 fields
dsl_operations array · 0 items
converters array · 0 items
readers array · 0 items
capabilities array · 0 items
data_gaps array · 1 item
gaps array · 1 item
review object · 5 fields
machine_critique object · 5 fields
reader object · 5 fields
evidence_check object · 2 fields
usage object · 3 fields
stages array · 1 item
[0] object · 4 fields
gaps array · 3 items
provenance object · 7 fields
entities array · 3 items
activities array · 3 items
[0] object · 4 fields
used array · 3 items
[0] object · 3 fields
[1] object · 3 fields
[2] object · 3 fields
[1] object · 4 fields
agents array · 2 items
lineage object · 4 fields
gaps array · 11 items
assays array · 3 items
[0] object · 11 fields
required_operations array · 0 items
source_hashes object · 1 field
evidence array · 4 items
[1] object · 11 fields
required_operations array · 0 items
source_hashes object · 1 field
evidence array · 1 item
[2] object · 11 fields
required_operations array · 0 items
source_hashes object · 1 field
evidence array · 1 item
Complete file
{"sci_version": "1.2", "schema": "https://corpus.bntrg.co.uk/sci/1.0/sci.schema.json", "id": "pmid:33161156", "kind": "science-record", "revision": 7, "content_hash": "sha256:52a1a7b373c1e42a480452130c24de7b3cb302b196f50a197d1163852baeb1ec", "created_at": "2026-11-01T15:41:15Z", "updated_at": "2026-11-01T21:24:03Z", "generator": {"name": "corpus-assay-engine", "run_id": "reading-sci-2026-11-01"}, "paper": {"state": "complete", "title": "Inflammation-Associated Senescence Promotes Helicobacter pylori-Induced Atrophic Gastritis.", "doi": "10.1016/j.jcmgh.2020.10.015", "pmid": "33161156", "authors": ["Qinbo Cai", "Peng Shi", "Yujie Yuan", "Jianjun Peng", "Xinde Ou", "Wen Zhou", "Jin Li", "Taiqiang Su", "Liangliang Lin", "Shirong Cai", "Yulong He", "Jianbo Xu"], "journal": "Cellular and molecular gastroenterology and hepatology", "year": 2021, "abstract": "BACKGROUND & AIMS: The association between cellular senescence and Helicobacter pylori-induced atrophic gastritis is not clear. Here, we explore the role of cellular senescence in H pylori-induced atrophic gastritis and the underlying mechanism.\nMETHODS: C57BL/6J mice were infected with H pylori for biological and mechanistic studies in vivo. Gastric precancerous lesions from patients and mouse models were collected and analyzed using senescence-associated beta-galactosidase, Sudan Black B, and immunohistochemical staining to analyze senescent cells, signaling pathways, and H pylori infection. Chromatin immunoprecipitation, luciferase reporter assays, and other techniques were used to explore the underlying mechanism in vitro.\nRESULTS: Gastric mucosa atrophy was highly associated with cellular senescence. H pylori promoted gastric epithelial cell senescence in vitro and in vivo in a manner that depended on C-X-C motif chemokine receptor 2 (CXCR2) signaling. Interestingly, H pylori infection not only up-regulated the expression of CXCR2 ligands, C-X-C motif chemokine ligands 1 and 8, but also transcriptionally up-regulated the expression of CXCR2 via the nuclear factor-κB subunit 1 directly. In addition, CXCR2 formed a positive feedback loop with p53 to continually enhance senescence. Pharmaceutical inhibition of CXCR2 in an H pylori-infected mouse model attenuated mucosal senescence and atrophy, and delayed further precancerous lesion progression.\nCONCLUSIONS: Our study showed a new mechanism of H pylori-induced atrophic gastritis through CXCR2-mediated cellular senescence. Inhibition of CXCR2 signaling is suggested as a potential preventive therapy for targeting H pylori-induced atrophic gastritis. GEO data set accession numbers: GSE47797 and GSE3556.", "claims": [{"id": "claim-method", "statement": "Data were analyzed using GSEA.", "kind": "methodological", "target": null, "evidence": [{"asset": "source:pmid:33161156", "locator": "sections[28] \"GEO Data Analysis and Transcription Factor Prediction\" paragraph 2", "quote": "Data were analyzed using GSEA."}], "state": "complete"}, {"id": "claim-data-access", "statement": "GSEA of senescence-associated pathways in H pylori infection using GSE47797 (human samples with H pylori–associated gastritis) and GSE3556 (AGS cell line infected with wild-type H pylori G27, which is CagA positive) from the GEO data set.", "kind": "methodological", "target": null, "evidence": [{"asset": "source:pmid:33161156", "locator": "sections[7] \"H pylori Promotes Senescence in Gastric Mucosa via CXCR2 Signaling\" paragraph 3", "quote": "GSEA of senescence-associated pathways in H pylori infection using GSE47797 (human samples with H pylori–associated gastritis) and GSE3556 (AGS cell line infected with wild-type H pylori G27, which is CagA positive) from the GEO data set."}], "state": "complete"}], "gaps": []}, "experiment": {"state": "complete", "objective": null, "steps": [{"id": "read_published_estimate", "order": 1, "name": "Read the published estimate from the source", "kind": "other", "state": "complete", "blocked_on": null, "description": "The claim, method and evidence span published with the source article.", "duration_hours": null, "parameters": {}, "inputs": ["source:pmid:33161156"], "outputs": ["the published estimate and its evidence"], "instruments": [], "reagents": []}, {"id": "obtain_source_data", "order": 2, "name": "Obtain the source data from the named repository", "kind": "data-preparation", "state": "complete", "blocked_on": null, "description": "The GEO series accession resolves and its sample accessions are listed. This lane did not download the dataset or read its licence.", "duration_hours": null, "parameters": {}, "inputs": ["data:geo:GSE3556"], "outputs": ["the source data with its repository provenance"], "instruments": [], "reagents": []}, {"id": "run_analysis", "order": 3, "name": "Run the published analysis", "kind": "analysis", "state": "complete", "blocked_on": null, "description": "Apply the paper's statistical method to the resolved series and compare the result with the published target.", "duration_hours": null, "parameters": {}, "inputs": ["data:geo:GSE3556"], "outputs": ["the replicated result and its comparison"], "instruments": [], "reagents": []}], "materials": [], "instruments": [], "reagents": [], "conditions": {}, "gaps": []}, "data": {"state": "partial", "assets": [{"id": "source:pmid:33161156", "role": "manuscript", "format": "xml", "media_type": "application/xml", "uri": "https://doi.org/10.1016/j.jcmgh.2020.10.015", "sha256": "sha256:64bb7266d23d5512d9c1922d5df5ed930ee914fd1672c2adafdc72c43b6bdc90", "bytes": 81324, "access": "open", "state": "resolved", "reader": null, "reader_status": "reader_required", "identifier": "10.1016/j.jcmgh.2020.10.015", "version": null, "note": "Full article fetched from PMC; the checksum covers the rendered section body, not the original XML bytes.", "structure": {"pmcid": "PMC7859172", "source": "europe_pmc_fulltext", "coverage": "whole_body", "text_hash_scope": "rendered_section_body"}}, {"id": "data:geo:GSE3556", "role": "raw", "format": "geo-series", "media_type": "application/vnd.ncbi.geo-series+json", "uri": "https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE3556", "sha256": null, "bytes": null, "access": "open", "state": "resolved", "reader": null, "reader_status": "reader_required", "identifier": "GSE3556", "version": null, "note": "GSEA of senescence-associated pathways in H pylori infection using GSE47797 (human samples with H pylori–associated gastritis) and GSE3556 (AGS cell line infected with wild-type H pylori G27, which is CagA positive) from the GEO data set.", "structure": {"repository": "GEO", "access_route": "GEO accession URL", "access_statement_verbatim": "GSEA of senescence-associated pathways in H pylori infection using GSE47797 (human samples with H pylori–associated gastritis) and GSE3556 (AGS cell line infected with wild-type H pylori G27, which is CagA positive) from the GEO data set.", "access_statement_kind": "repository_route_statement", "sample_accessions": ["GSM81696", "GSM81697", "GSM81698", "GSM81699", "GSM81700", "GSM81701", "GSM81702", "GSM81703", "GSM81704", "GSM81705", "GSM81706", "GSM81707", "GSM81708", "GSM81709", "GSM81710", "GSM81711", "GSM81712", "GSM81713", "GSM81714", "GSM81715", "GSM81716", "GSM81717", "GSM81718", "GSM81719", "GSM81720", "GSM81721", "GSM81722", "GSM81723", "GSM81724", "GSM81725", "GSM81726", "GSM81727", "GSM81728", "GSM81729", "GSM81730", "GSM81731", "GSM81732", "GSM81733", "GSM81734", "GSM81735", "GSM81736", "GSM81737", "GSM81738", "GSM81739", "GSM81740", "GSM81741", "GSM81742", "GSM81743", "GSM81744", "GSM81745", "GSM81746", "GSM81747", "GSM81748", "GSM81749"], "sample_count": 54, "group_sizes": null, "group_sizes_basis": null, "platform": "3002;3011;178;2935", "taxon": "Homo sapiens", "title": "Cag pathogenicity island-specific responses of gastric epithelial cells to Helicobacter pylori infection.", "resolution_checked_at": "2026-11-01T15:39:54Z", "resolution_check": "identifier_resolution_only_no_download_no_licence_read", "downloaded": false, "licence_read": false}}, {"id": "data:geo:GSE47797", "role": "raw", "format": "geo-series", "media_type": "application/vnd.ncbi.geo-series+json", "uri": "https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE47797", "sha256": null, "bytes": null, "access": "open", "state": "resolved", "reader": null, "reader_status": "reader_required", "identifier": "GSE47797", "version": null, "note": "GSEA of senescence-associated pathways in H pylori infection using GSE47797 (human samples with H pylori–associated gastritis) and GSE3556 (AGS cell line infected with wild-type H pylori G27, which is CagA positive) from the GEO data set.", "structure": {"repository": "GEO", "access_route": "GEO accession URL", "access_statement_verbatim": "GSEA of senescence-associated pathways in H pylori infection using GSE47797 (human samples with H pylori–associated gastritis) and GSE3556 (AGS cell line infected with wild-type H pylori G27, which is CagA positive) from the GEO data set.", "access_statement_kind": "repository_route_statement", "sample_accessions": ["GSM1159807", "GSM1159808", "GSM1159809", "GSM1159810", "GSM1159811", "GSM1159812", "GSM1159813", "GSM1159814", "GSM1159815", "GSM1159816", "GSM1159817", "GSM1159818", "GSM1159819", "GSM1159820", "GSM1159821", "GSM1159822", "GSM1484286", "GSM1484287", "GSM1484288", "GSM1484289", "GSM1484290", "GSM1484291", "GSM1484292", "GSM1484293"], "sample_count": 24, "group_sizes": null, "group_sizes_basis": null, "platform": "17077;13497", "taxon": "Homo sapiens", "title": "Effect of Helicobacter pylori on ATM-dependent DNA damage responses", "resolution_checked_at": "2026-11-01T15:39:54Z", "resolution_check": "identifier_resolution_only_no_download_no_licence_read", "downloaded": false, "licence_read": false}}, {"id": "data:geo:GSE65458", "role": "raw", "format": "geo-series", "media_type": "application/vnd.ncbi.geo-series+json", "uri": "https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE65458", "sha256": null, "bytes": null, "access": "open", "state": "resolved", "reader": null, "reader_status": "reader_required", "identifier": "GSE65458", "version": null, "note": "GSEA of senescence-associated pathways in H pylori infection using GSE47797 (human samples with H pylori–associated gastritis) and GSE3556 (AGS cell line infected with wild-type H pylori G27, which is CagA positive) from the GEO data set.", "structure": {"repository": "GEO", "access_route": "GEO accession URL", "access_statement_verbatim": "GSEA of senescence-associated pathways in H pylori infection using GSE47797 (human samples with H pylori–associated gastritis) and GSE3556 (AGS cell line infected with wild-type H pylori G27, which is CagA positive) from the GEO data set.", "access_statement_kind": "repository_route_statement", "sample_accessions": ["GSM1597988", "GSM1597989", "GSM1597990", "GSM1597991", "GSM1597992", "GSM1597993", "GSM1597994", "GSM1597995", "GSM1597996", "GSM1597997", "GSM1597998", "GSM1597999", "GSM1598000", "GSM1598001", "GSM1598002", "GSM1598003", "GSM1598004", "GSM1598005", "GSM1598006", "GSM1598007", "GSM1598008", "GSM1598009", "GSM1598010", "GSM1598011"], "sample_count": 24, "group_sizes": null, "group_sizes_basis": null, "platform": "10558", "taxon": "Homo sapiens", "title": "Proteasome machinery is instrumental in a common gain-of-function program of the p53 missense mutants in cancer.", "resolution_checked_at": "2026-11-01T15:39:55Z", "resolution_check": "identifier_resolution_only_no_download_no_licence_read", "downloaded": false, "licence_read": false}}, {"id": "asset:table:pmid:33161156:1", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:e4569a2a1f2691cfcb1161387ea228b2ddd92a562fa9d8d30cf43f1fbebf2628", "bytes": 1335, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[18]/table-wrap[1]#tbl4", "version": null, "note": "Primers Used for Quantitative Real-Time PCR", "structure": {"pmcid": "PMC7859172", "section_index": 18, "section_title": "Lentiviral Transduction, Plasmid Transfection, and RNA Interference", "row_count": 37, "column_count": 2}, "table": {"label": "Table 4", "caption": "Primers Used for Quantitative Real-Time PCR", "rows": [["Gene (protein name)", "Primer sequence"], ["CXCR2 (CXCR2)", ""], ["Forward", "CCTGTCTTACTTTTCCGAAGGAC"], ["Reverse", "TTGCTGTATTGTTGCCCATGT"], ["CXCL1 (CXCL1)", ""], ["Forward", "ATTCACCCCAAGAACATCCA"], ["Reverse", "GATGCAGGATTGAGGCAAG"], ["CXCL8 (CXCL8)", ""], ["Forward", "ACTGAGAGTGATTGAGAGTGGAC"], ["Reverse", "AACCCTCTGCACCCAGTTTTC"], ["TP53 (p53)", ""], ["Forward", "GAGGTTGGCTCTGACTGTACC"], ["Reverse", "TCCGTCCCAGTAGATTACCAC"], ["CDKN1A (p21)", ""], ["Forward", "TGTCCGTCAGAACCCATGC"], ["Reverse", "AAAGTCGAAGTTCCATCGCTC"], ["CDKN2A (p16)", ""], ["Forward", "ATGGAGCCTTCGGCTGACT"], ["Reverse", "GTAACTATTCGGTGCGTTGGG"], ["CDKN1B (p27)", ""], ["Forward", "ATCACAAACCCCTAGAGGGCA"], ["Reverse", "GGGTCTGTAGTAGAACTCGGG"], ["RB1 (Rb)", ""], ["Forward", "CACTTTGTGAACGCCTTCTGT"], ["Reverse", "CACGTTTGAATGTCTCCTGAACA"], ["GAPDH (GAPDH)", ""], ["Forward", "ACAACTTTGGTATCGTGGAAGG"], ["Reverse", "GCCATCACGCCACAGTTTC"], ["Cxcr2 (Cxcr2)", ""], ["Forward", "ATGCCCTCTATTCTGCCAGAT"], ["Reverse", "GTGCTCCGGTTGTATAAGATGAC"], ["Cxcl1 (Cxcl1)", ""], ["Forward", "CTGGGATTCACCTCAAGAACATC"], ["Reverse", "CAGGGTCAAGGCAAGCCTC"], ["Gapdh (Gapdh)", ""], ["Forward", "GAACGGGAAGCTCACTGG"], ["Reverse", "GCCTGCTTCACCACCTTCT"]], "row_count": 37, "column_count": 2, "numeric_cells": 4, "header_rows": 1, "locator": "section[18]/table-wrap[1]#tbl4"}}, {"id": "asset:table:pmid:33161156:2", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:e7f76e03c6c5d72d5114efb6e1ae0d529984a3d219be096cd726a470fdbb9e64", "bytes": 609, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[21]/table-wrap[1]#tbl1", "version": null, "note": "siRNA Information", "structure": {"pmcid": "PMC7859172", "section_index": 21, "section_title": "Quantitative Real-Time PCR", "row_count": 13, "column_count": 2}, "table": {"label": "Table 1", "caption": "siRNA Information", "rows": [["Target gene", "Sequence"], ["CXCR2-#1", "GCTACTTGGTCAAATTCAT"], ["CXCR2-#2", "GCTATACATGGCTTGATCAGC"], ["MEF2A-#1", "GCTCAACGTTAACAGATTC"], ["MEF2A-#2", "GAAACCAGATCTTCGAGTT"], ["CEBPB-#1", "GCCCTGAGTAATCGCTTAA"], ["CEBPB-#2", "GTGGCCAACTTCTACTACG"], ["YY1-#1", "CGACGACTACATTGAACAA"], ["YY1-#2", "CCTGAAATCTCACATCTTA"], ["VDR-#1", "GTCAGTTACAGCATCCAAA"], ["VDR-#2", "CCCACCATAAGACCTACGA"], ["TP53-#1", "GAGAAUAUUUCACCCUUAA"], ["TP53-#2", "UGGUUCACUGAAGACCCAGUU"]], "row_count": 13, "column_count": 2, "numeric_cells": 12, "header_rows": 1, "locator": "section[21]/table-wrap[1]#tbl1"}}, {"id": "asset:table:pmid:33161156:3", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:eca17485163c28879ecf562497c44f9f3f40ad50e2777282cec48c069addd5c6", "bytes": 1493, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[22]/table-wrap[1]#tbl2", "version": null, "note": "Antibody Information", "structure": {"pmcid": "PMC7859172", "section_index": 22, "section_title": "IHC Analysis", "row_count": 31, "column_count": 3}, "table": {"label": "Table 2", "caption": "Antibody Information", "rows": [["Antibody", "Final dilution", "Manufacturer and cat no"], ["p53", "Western blot (WB) 1:4000, IHC 1:1500", "Abcam ab1101, CA"], ["p-p53(Ser15)", "WB 1:500", "Abcam ab1431"], ["p-p53(Ser392)", "WB 1:500", "CST 9281, Danvers, MA"], ["p21", "WB 1:1000, IHC 1:100", "CST 2947"], ["p21", "IHC 1:100", "Abclone A2691, Wuhan, China"], ["Anti–H pylori", "IHC 1:200", "ZSGB-BIO ZA-0127, Beijing, China"], ["CagA", "WB 1:500", "GeneTex GTX42382, CA"], ["BrdU", "Immunofluorescence (IF) 1:250", "Abcam ab6326"], ["CXCR2", "WB 1:500", "Abcam ab65968"], ["CXCR2", "IHC 1:100", "Abcam ab14935"], ["Cxcl1", "IHC 1:100", "Santa Cruz sc-365870, CA"], ["β-tubulin", "WB 1:1000", "CST 2128"], ["γH2AX", "IHC 1:100", "Abcam ab26350"], ["GAPDH", "WB 1:2000", "JETWAY SF-PA005, Guangzhou, China"], ["IKK", "WB 1:1000", "CST 8943"], ["pIKK", "WB 1:1000", "CST 2697"], ["IKBα", "WB 1:1000", "CST 4814"], ["pIKBα (Ser32)", "WB 1:1000", "CST 2859"], ["RELA", "WB 1:1000", "CST 8242"], ["p-RELA (Ser536)", "WB 1:500", "CST 3037"], ["NFKB1", "WB 1:1000", "CST 13586"], ["STAT1", "WB 1:1000", "CST 1499"], ["pSTAT1(Tyr701)", "WB 1:500", "CST 7649"], ["MEF2A", "WB 1:2000", "Abcam ab76063"], ["CEBPB", "WB 1:1000", "Abcam ab32358"], ["YY1", "WB 1:1000", "Abcam ab109228"], ["VDR", "WB 1:1000", "Abcam ab109234"], ["Erk", "WB 1:1000", "CST 46953"], ["pErk (Thr202/Tyr204)", "WB 1:2000", "CST 4370"], ["Cyclin D1", "WB 1:1000", "CST 2978"]], "row_count": 31, "column_count": 3, "numeric_cells": 69, "header_rows": 1, "locator": "section[22]/table-wrap[1]#tbl2"}}, {"id": "asset:table:pmid:33161156:4", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:5e5fe297ee3c708fbeca40376780a71265556b29f0c29bfeedf8b4d34b0993c5", "bytes": 642, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[27]/table-wrap[1]#tbl3", "version": null, "note": "Primers Used in ChIP", "structure": {"pmcid": "PMC7859172", "section_index": 27, "section_title": "ChIP", "row_count": 16, "column_count": 2}, "table": {"label": "Table 3", "caption": "Primers Used in ChIP", "rows": [["Gene", "Primer sequence"], ["ChIP-NFKB1-RE1", ""], ["Forward", "CATCAATGCTGCGTTCCT"], ["Reverse", "TCTGGTATTGTGAAGGGTC"], ["ChIP-NFKB1-RE2", ""], ["Forward", "CTCTAAGACCCTTCACAATAC"], ["Reverse", "GAATACCCTGTGGAACAAA"], ["ChIP-NFKB1-RE3", ""], ["Forward", "TCCAGAAGCCATCAGACA"], ["Reverse", "GGGAGGTATTCCCACAGA"], ["ChIP-TP53-RE1", ""], ["Forward", "CGTGCGAGTTCAGACAAG"], ["Reverse", "TGGAGGAGCCTACCAGTC"], ["ChIP-TP53-RE2", ""], ["Forward", "CTAAGACCCTTCACAATACC"], ["Reverse", "AATACCCTGTGGAACAAA"]], "row_count": 16, "column_count": 2, "numeric_cells": 2, "header_rows": 1, "locator": "section[27]/table-wrap[1]#tbl3"}}], "gaps": ["asset:data:geo:GSE3556 not downloaded", "asset:data:geo:GSE3556 licence not read", "asset:data:geo:GSE47797 not downloaded", "asset:data:geo:GSE47797 licence not read", "asset:data:geo:GSE65458 not downloaded", "asset:data:geo:GSE65458 licence not read"]}, "analysis": {"state": "partial", "methods": [{"id": "method-1", "family": null, "specific": null, "label": "Gene set enrichment analysis (GSEA)", "dsl_operations": [], "missing_operations": [], "expressible": null, "parameters": {}, "data_shapes": [], "evidence": {"score": 1.0, "band": "verbatim", "quote": "Data were analyzed using GSEA."}}], "targets": [], "gaps": ["method.reader_named_unmapped"]}, "capability": {"state": "complete", "requirements": [{"capability_id": "capability:computational_analysis", "label": "Computational analysis platform", "assay_families": ["meta_analysis", "machine_learning", "survival_analysis", "statistical_regression", "pca", "molecular_docking", "network_analysis", "differential_expression", "gwas"], "availability_state": "owned", "tier_unlocked": "R1", "candidate": "Automated Assays Laravel application and simulated adapters"}], "gaps": []}, "readiness": {"state": "blocked", "tier": "R4", "blocking_axis": "method", "blocked_on": "method:not_determinable", "axes": {"method": {"tier": "R4", "expressible": false, "required_operations": [], "missing_operations": [], "basis": "The reader quoted the method the paper names (Gene set enrichment analysis (GSEA)), but the corpus's method extractor could not map it onto a DSL operation, so the method is published but not expressible."}, "capability": {"tier": "R1", "capability_id": "capability:computational_analysis", "availability_state": "owned", "basis": "The computational analysis is owned. The physical bench the paper used is not, so a physical validation cannot be run here."}, "data": {"tier": "R1", "reachable": true, "accessions": ["GSE47797", "GSE3556", "GSE65458"], "resolved_accessions": ["GSE47797", "GSE3556", "GSE65458"], "statements": ["GSEA of senescence-associated pathways in H pylori infection using GSE47797 (human samples with H pylori–associated gastritis) and GSE3556 (AGS cell line infected with wild-type H pylori G27, which is CagA positive) from the GEO data set."], "basis": "The paper names GSE47797, GSE3556, GSE65458 in Gene Expression Omnibus (GEO) and the accession resolves in the repository. No dataset was downloaded and no licence was read."}}, "can_run": {"dsl_operations": [], "assets": ["source:pmid:33161156", "data:geo:GSE3556", "asset:table:pmid:33161156:1", "asset:table:pmid:33161156:2", "asset:table:pmid:33161156:3", "asset:table:pmid:33161156:4"], "steps": ["run_analysis"]}, "must_build": {"dsl_operations": [], "converters": [], "readers": [], "capabilities": [], "data_gaps": ["data:geo:GSE3556"]}, "gaps": ["method:not_determinable"]}, "review": {"state": "partial", "machine_critique": {"kind": "extraction_review", "reader": {"model": "MiniMax-M3.1-Flash", "provider": "minimax", "provider_family": "minimax", "read_at": "2026-10-31T18:24:00Z", "independence": "single_reader"}, "evidence_check": {"method": "verbatim", "availability": null}, "calls": 3, "usage": {"prompt_tokens": 63233, "completion_tokens": 1375, "cached_tokens": 791}}, "human_critique": null, "stages": [{"id": "extraction", "state": "complete", "reader": "MiniMax-M3.1-Flash", "provider": "minimax"}], "gaps": ["review.independent_reader", "review.machine_critique", "review.human_critique"]}, "execution": {"state": "absent", "status": "not_run", "mode": null, "runs": [], "gaps": ["execution.not_run"]}, "provenance": {"entities": [{"id": "pmid:33161156", "type": "paper", "label": "pmid:33161156"}, {"id": "source:pmid:33161156", "type": "manuscript", "label": "PMID 33161156 full text"}, {"id": "data:geo:GSE3556", "type": "dataset", "label": "GEO GSE3556"}], "activities": [{"id": "activity-reading-sci-2026-11-01", "type": "classification", "used": [{"id": "pmid:33161156", "type": "paper", "label": "pmid:33161156"}, {"id": "source:pmid:33161156", "type": "manuscript", "label": "PMID 33161156 full text"}, {"id": "data:geo:GSE3556", "type": "dataset", "label": "GEO GSE3556"}], "agent": "agent:corpus-assay-engine"}, {"id": "activity-read-33161156", "type": "extraction", "used": ["source:pmid:33161156"], "agent": "agent:minimax-reader"}, {"id": "activity-resolve-GSE3556", "type": "accession_resolution", "used": ["data:geo:GSE3556"], "agent": "agent:corpus-assay-engine"}], "agents": [{"id": "agent:corpus-assay-engine", "type": "software", "label": "Corpus assay engine"}, {"id": "agent:minimax-reader", "type": "software", "label": "MiniMax literature reader"}], "source_run_id": "reading-sci-2026-11-01", "dsl_catalogue_fingerprint": "343fb30756ba6ec3", "capability_table_fingerprint": "2cb3e42f047d2ecf", "snapshot_id": "ba34b49490d9bfaf"}, "lineage": {"parent_id": "pmid:33161156", "parent_hash": "sha256:296a50f6fe0960696711fe1978f571101f162d84a40b58427e8c8153d2493d72", "fork_of": null, "generation": 6}, "gaps": ["asset:data:geo:GSE3556 licence not read", "asset:data:geo:GSE3556 not downloaded", "asset:data:geo:GSE47797 licence not read", "asset:data:geo:GSE47797 not downloaded", "asset:data:geo:GSE65458 licence not read", "asset:data:geo:GSE65458 not downloaded", "execution.not_run", "method.reader_named_unmapped", "review.human_critique", "review.independent_reader", "review.machine_critique"], "assays": [{"role": "data_generation", "definition_id": "animal_model", "definition_version": "99e1195c7d6f", "definition_digest": null, "required_operations": [], "support_state": "partial", "source_hashes": {"assay_lexicon": "99e1195c7d6f"}, "confidence": 0.99, "evidence": ["the underlying mechanism. METHODS: C57BL/6J mice were infected with H pylori for biological and me", "inhibition of CXCR2 in an H pylori-infected mouse model attenuated mucosal senescence and atrophy, a", "ylori for biological and mechanistic studies in vivo. Gastric precancerous lesions from patients", "tric epithelial cell senescence in vitro and in vivo in a manner that depended on C-X-C motif che"], "order_basis": "paper_text_order:312", "id": "assay:1"}, {"role": "data_generation", "definition_id": "ihc", "definition_version": "99e1195c7d6f", "definition_digest": null, "required_operations": [], "support_state": "partial", "source_hashes": {"assay_lexicon": "99e1195c7d6f"}, "confidence": 0.93, "evidence": ["iated beta-galactosidase, Sudan Black B, and immunohistochemical staining to analyze senescent cells, signali"], "order_basis": "paper_text_order:547", "id": "assay:2"}, {"role": "data_generation", "definition_id": "cell_culture", "definition_version": "99e1195c7d6f", "definition_digest": null, "required_operations": [], "support_state": "partial", "source_hashes": {"assay_lexicon": "99e1195c7d6f"}, "confidence": 0.77, "evidence": ["was given to the control group. H pylori was cultured in Brucella Agar (Hopebio, Shandong, China) wit"], "order_basis": "paper_text_order:7717", "id": "assay:3"}]}