Hub Genes Identification in a Murine Model of Allergic Rhinitis Based on Bioinformatics Analysis.

{"sci_version": "1.2", "schema": "https://corpus.bntrg.co.uk/sci/1.0/sci.schema.json", "id": "pmid:33193578", "kind": "science-record", "revision": 7, "content_hash": "sha256:37b08c7885a514e5795e4612e0647ca1229d35d195d4eeeb396d3cbe754244f0", "created_at": "2026-11-01T15:41:16Z", "updated_at": "2026-11-01T22:02:31Z", "generator": {"name": "corpus-assay-engine", "run_id": "reading-sci-2026-11-01"}, "paper": {"state": "complete", "title": "Hub Genes Identification in a Murine Model of Allergic Rhinitis Based on Bioinformatics Analysis.", "doi": "10.3389/fgene.2020.00970", "pmid": "33193578", "authors": ["Le Chen", "Le Shi", "Yue Ma", "Chunquan Zheng"], "journal": "Frontiers in genetics", "year": 2020, "abstract": "This study aimed to identify allergic rhinitis (AR)-related hub genes and functionally enriched pathways in a murine model. Dataset GSE52804 (including three normal controls and three AR mice) was downloaded from Gene Expression Omnibus (GEO). Differentially expressed genes (DEGs) were identified. Gene ontology (GO), Kyoto Encyclopedia of Genes and Genomes (KEGG) pathways, and protein-protein interaction (PPI) analyses of DEGs were performed to identify the hub genes in AR. The DEGs were classified into different modules by using the weighted gene co-expression network analysis (WGCNA). Moreover, to verify the potential hub genes, nasal mucosa tissues were obtained from murine AR models (n = 5) and controls (n = 5), and qRT-PCR and Western blot were performed. In this study, a total of 634 DEGs were identified. They were significantly enriched in 14 GO terms, such as integral component of membrane, plasma membrane, and G-protein-coupled receptor signaling pathway. Meanwhile, there were eight terms of KEGG pathways significantly enriched, such as Olfactory transduction, Cytokine-cytokine receptor interaction, and TNF signaling pathway. The top 10 hub genes (Rtp1, Rps27a, Penk, Cxcl2, Gng8, Gng3, Cxcl1, Cxcr2, Ccl9, and Anxa1) were identified by the PPI network. DEGs were classified into seven modules by WGCNA. According to qRT-PCR validation of the five genes of interest (Rtp1, Rps27a, Penk, Cxcl2, and Anxa1), the expression level of Rtp1 mRNA was significantly decreased in the AR group compared with the control group, while there are enhanced Rps27a, Penk, Cxcl2, and Anxa1 mRNA expressions in the AR mice group compared with the control group. Western blot was also performed to further explore the expression of Anxa1 in the protein level, and the results showed a similar expression trend.", "claims": [{"id": "claim-method", "statement": "GraphPad Prism software (version 7.0, United States) was applied to statistical analyses.", "kind": "methodological", "target": null, "evidence": [{"asset": "source:pmid:33193578", "locator": "sections[12] \"Statistical Analysis\" paragraph 2", "quote": "GraphPad Prism software (version 7.0, United States) was applied to statistical analyses."}], "state": "complete"}, {"id": "claim-data-access", "statement": "All datasets generated for this study are included in the article/Supplementary Material.", "kind": "methodological", "target": null, "evidence": [{"asset": "source:pmid:33193578", "locator": "sections[22] \"Data Availability Statement\" paragraph 2", "quote": "All datasets generated for this study are included in the article/Supplementary Material."}], "state": "complete"}], "gaps": []}, "experiment": {"state": "complete", "objective": null, "steps": [{"id": "read_published_estimate", "order": 1, "name": "Read the published estimate from the source", "kind": "other", "state": "complete", "blocked_on": null, "description": "The claim, method and evidence span published with the source article.", "duration_hours": null, "parameters": {}, "inputs": ["source:pmid:33193578"], "outputs": ["the published estimate and its evidence"], "instruments": [], "reagents": []}, {"id": "obtain_source_data", "order": 2, "name": "Obtain the source data from the named repository", "kind": "data-preparation", "state": "complete", "blocked_on": null, "description": "The GEO series accession resolves and its sample accessions are listed. This lane did not download the dataset or read its licence.", "duration_hours": null, "parameters": {}, "inputs": ["data:geo:GSE52804"], "outputs": ["the source data with its repository provenance"], "instruments": [], "reagents": []}, {"id": "run_analysis", "order": 3, "name": "Run the published analysis", "kind": "analysis", "state": "complete", "blocked_on": null, "description": "Apply the paper's statistical method to the resolved series and compare the result with the published target.", "duration_hours": null, "parameters": {}, "inputs": ["data:geo:GSE52804"], "outputs": ["the replicated result and its comparison"], "instruments": [], "reagents": []}], "materials": [], "instruments": [], "reagents": [], "conditions": {}, "gaps": []}, "data": {"state": "partial", "assets": [{"id": "source:pmid:33193578", "role": "manuscript", "format": "xml", "media_type": "application/xml", "uri": "https://doi.org/10.3389/fgene.2020.00970", "sha256": "sha256:84a5d815307e0e7045df71429d5f825582520eede23d20e8e57e22fc8db7a41c", "bytes": 34310, "access": "open", "state": "resolved", "reader": null, "reader_status": "reader_required", "identifier": "10.3389/fgene.2020.00970", "version": null, "note": "Full article fetched from PMC; the checksum covers the rendered section body, not the original XML bytes.", "structure": {"pmcid": "PMC7477359", "source": "europe_pmc_fulltext", "coverage": "whole_body", "text_hash_scope": "rendered_section_body"}}, {"id": "data:geo:GSE52804", "role": "raw", "format": "geo-series", "media_type": "application/vnd.ncbi.geo-series+json", "uri": "https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE52804", "sha256": null, "bytes": null, "access": "open", "state": "resolved", "reader": null, "reader_status": "reader_required", "identifier": "GSE52804", "version": null, "note": "All datasets generated for this study are included in the article/Supplementary Material.", "structure": {"repository": "GEO", "access_route": "GEO accession URL", "access_statement_verbatim": "All datasets generated for this study are included in the article/Supplementary Material.", "access_statement_kind": "data_availability_statement", "sample_accessions": ["GSM1276474", "GSM1276475", "GSM1276476", "GSM1276477", "GSM1276478", "GSM1276479", "GSM1276480", "GSM1276481", "GSM1276482"], "sample_count": 9, "group_sizes": null, "group_sizes_basis": null, "platform": "6246", "taxon": "Mus musculus", "title": "Genes related to allergen avoidance in allergic rhinitis mouse model", "resolution_checked_at": "2026-11-01T15:39:54Z", "resolution_check": "identifier_resolution_only_no_download_no_licence_read", "downloaded": false, "licence_read": false}}, {"id": "asset:table:pmid:33193578:1", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:e69b4818037d01e699d052977d81eae6dcf32de70b2e19f38d0ca23fc3b74de7", "bytes": 669, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[10]/table-wrap[1]#T1", "version": null, "note": "Primers used in this study.", "structure": {"pmcid": "PMC7477359", "section_index": 10, "section_title": "RNA Extraction and Quantitative Reverse Transcription-Polymerase Chain Reaction (qRT-PCR) Analyses", "row_count": 13, "column_count": 2}, "table": {"label": "TABLE 1", "caption": "Primers used in this study.", "rows": [["Primers", "Sequence (5′ → 3′)"], ["Rtp1 (F)", "GCTGCCCTGCCTTACACTTAC"], ["Rtp1 (R)", "CACCTGTGGTCACACTCTTAC"], ["Rps27a (F)", "ACTCCCAAGAAGAACAAGCATA"], ["Rps27a (R)", "CAGTAAGTCAGACAACACTTGC"], ["Penk (F)", "GGACTGCGCTAAATGCAGCTA"], ["Penk (R)", "GAAGCCTCCGTACCGTTTCAT"], ["Cxcl2 (F)", "CCAACCACCAGGCTACAGG"], ["Cxcl2 (R)", "GCGTCACACTCAAGCTCTG"], ["Anxa1 (F)", "ATGTATCCTCGGATGTTGCTGC"], ["Anxa1 (R)", "TGAGCATTGGTCCTCTTGGTA"], ["GAPDH (F)", "AGGTCGGTGTGAACGGATTTG"], ["GAPDH (R)", "TGTAGACCATGTAGTTGAGGTCA"]], "row_count": 13, "column_count": 2, "numeric_cells": 3, "header_rows": 1, "locator": "section[10]/table-wrap[1]#T1"}}, {"id": "asset:table:pmid:33193578:2", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:08ba42008b77d72a597f0b2dfb3180fc2f185ad7b164c727e82009e65bf1cfe5", "bytes": 605, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[17]/table-wrap[1]#T2", "version": null, "note": "Gene ontology (GO) analysis results of modules constructed by WGCNA.", "structure": {"pmcid": "PMC7477359", "section_index": 17, "section_title": "WGCNA Results", "row_count": 8, "column_count": 3}, "table": {"label": "TABLE 2", "caption": "Gene ontology (GO) analysis results of modules constructed by WGCNA.", "rows": [["Module", "GO_Term", "p-value"], ["Yellow", "Extracellular exosome", "9.25E-04"], ["Turquoise", "Olfactory receptor activity", "4.99E-65"], ["Red", "G-protein-coupled receptor activity", "3.04E-07"], ["Brown", "Cellular response to lipopolysaccharide", "1.22E-05"], ["Blue", "Inflammatory response", "2.39E-09"], ["Green", "Plasma membrane", "3.74E-06"], ["Gray", "Defense response to bacterium", "0.023411247"]], "row_count": 8, "column_count": 3, "numeric_cells": 7, "header_rows": 1, "locator": "section[17]/table-wrap[1]#T2"}}], "gaps": ["asset:data:geo:GSE52804 not downloaded", "asset:data:geo:GSE52804 licence not read"]}, "analysis": {"state": "partial", "methods": [{"id": "method-1", "family": "network_analysis", "specific": "ppi_network", "label": "Network / pathway analysis", "dsl_operations": ["build_graph", "centrality_scores", "pathway_enrich"], "missing_operations": [], "expressible": true, "parameters": {}, "data_shapes": ["edge_list"], "evidence": {"score": 0.7, "band": "medium", "quote": "protein-protein interaction"}}, {"id": "method-2", "family": null, "specific": null, "label": "GraphPad Prism software (version 7.0, United States)", "dsl_operations": [], "missing_operations": [], "expressible": null, "parameters": {}, "data_shapes": [], "evidence": {"score": 1.0, "band": "verbatim", "quote": "GraphPad Prism software (version 7.0, United States) was applied to statistical analyses."}}], "targets": [], "gaps": ["method.reader_named_unmapped"]}, "capability": {"state": "complete", "requirements": [{"capability_id": "capability:computational_analysis", "label": "Computational analysis platform", "assay_families": ["meta_analysis", "machine_learning", "survival_analysis", "statistical_regression", "pca", "molecular_docking", "network_analysis", "differential_expression", "gwas"], "availability_state": "owned", "tier_unlocked": "R1", "candidate": "Automated Assays Laravel application and simulated adapters"}], "gaps": []}, "readiness": {"state": "complete", "tier": "R1", "blocking_axis": "none", "blocked_on": "nothing:replicable_now", "axes": {"method": {"tier": "R1", "expressible": true, "required_operations": ["build_graph", "centrality_scores", "pathway_enrich"], "missing_operations": [], "basis": "The paper names the method it used and the corpus's method extractor maps it onto the DSL catalogue: ppi_network."}, "capability": {"tier": "R1", "capability_id": "capability:computational_analysis", "availability_state": "owned", "basis": "The computational analysis is owned. The physical bench the paper used is not, so a physical validation cannot be run here."}, "data": {"tier": "R1", "reachable": true, "accessions": ["GSE52804"], "resolved_accessions": ["GSE52804"], "statements": ["All datasets generated for this study are included in the article/Supplementary Material."], "basis": "The paper names GSE52804 in Gene Expression Omnibus (GEO) and the accession resolves in the repository. No dataset was downloaded and no licence was read."}}, "can_run": {"dsl_operations": ["build_graph", "centrality_scores", "pathway_enrich"], "assets": ["source:pmid:33193578", "data:geo:GSE52804", "asset:table:pmid:33193578:1", "asset:table:pmid:33193578:2"], "steps": ["run_analysis"]}, "must_build": {"dsl_operations": [], "converters": [], "readers": [], "capabilities": [], "data_gaps": ["data:geo:GSE52804"]}, "gaps": []}, "review": {"state": "partial", "machine_critique": {"kind": "extraction_review", "reader": {"model": "MiniMax-M3.1-Flash", "provider": "minimax", "provider_family": "minimax", "read_at": "2026-10-31T18:24:26Z", "independence": "single_reader"}, "evidence_check": {"method": "verbatim", "availability": "verbatim"}, "calls": 3, "usage": {"prompt_tokens": 29926, "completion_tokens": 1729, "cached_tokens": 784}}, "human_critique": null, "stages": [{"id": "extraction", "state": "complete", "reader": "MiniMax-M3.1-Flash", "provider": "minimax"}], "gaps": ["review.independent_reader", "review.machine_critique", "review.human_critique"]}, "execution": {"state": "absent", "status": "not_run", "mode": null, "runs": [], "gaps": ["execution.not_run"]}, "provenance": {"entities": [{"id": "pmid:33193578", "type": "paper", "label": "pmid:33193578"}, {"id": "source:pmid:33193578", "type": "manuscript", "label": "PMID 33193578 full text"}, {"id": "data:geo:GSE52804", "type": "dataset", "label": "GEO GSE52804"}], "activities": [{"id": "activity-reading-sci-2026-11-01", "type": "classification", "used": [{"id": "pmid:33193578", "type": "paper", "label": "pmid:33193578"}, {"id": "source:pmid:33193578", "type": "manuscript", "label": "PMID 33193578 full text"}, {"id": "data:geo:GSE52804", "type": "dataset", "label": "GEO GSE52804"}], "agent": "agent:corpus-assay-engine"}, {"id": "activity-read-33193578", "type": "extraction", "used": ["source:pmid:33193578"], "agent": "agent:minimax-reader"}, {"id": "activity-resolve-GSE52804", "type": "accession_resolution", "used": ["data:geo:GSE52804"], "agent": "agent:corpus-assay-engine"}], "agents": [{"id": "agent:corpus-assay-engine", "type": "software", "label": "Corpus assay engine"}, {"id": "agent:minimax-reader", "type": "software", "label": "MiniMax literature reader"}], "source_run_id": "reading-sci-2026-11-01", "dsl_catalogue_fingerprint": "343fb30756ba6ec3", "capability_table_fingerprint": "2cb3e42f047d2ecf", "snapshot_id": "ba34b49490d9bfaf"}, "lineage": {"parent_id": "pmid:33193578", "parent_hash": "sha256:5c4d79019844ada7ddd9ec2442789f4b287be944126c165df4dba0eb44f08ba4", "fork_of": null, "generation": 6}, "gaps": ["asset:data:geo:GSE52804 licence not read", "asset:data:geo:GSE52804 not downloaded", "execution.not_run", "method.reader_named_unmapped", "review.human_critique", "review.independent_reader", "review.machine_critique"], "assays": [{"role": "data_generation", "definition_id": "animal_model", "definition_version": "99e1195c7d6f", "definition_digest": null, "required_operations": [], "support_state": "partial", "source_hashes": {"assay_lexicon": "99e1195c7d6f"}, "confidence": 0.99, "evidence": ["Hub Genes Identification in a Murine Model of Allergic Rhinitis Based on Bioinfor", "enes and functionally enriched pathways in a murine model. Dataset GSE52804 (including three nor", "nes, nasal mucosa tissues were obtained from murine AR models (n = 5) and controls (n = 5), and", "the GSE52804 dataset was GPL6246 (Affymetrix Mouse Gene 1.0 ST Array). This dataset included th"], "order_basis": "paper_text_order:0", "id": "assay:1"}, {"role": "data_generation", "definition_id": "western_blot", "definition_version": "99e1195c7d6f", "definition_digest": null, "required_operations": [], "support_state": "partial", "source_hashes": {"assay_lexicon": "99e1195c7d6f"}, "confidence": 0.99, "evidence": ["n = 5) and controls (n = 5), and qRT-PCR and Western blot were performed. In this study, a total of 63", "mice group compared with the control group. Western blot was also performed to further explore the ex"], "order_basis": "paper_text_order:795", "id": "assay:2"}, {"role": "data_generation", "definition_id": "microarray", "definition_version": "99e1195c7d6f", "definition_digest": null, "required_operations": [], "support_state": "partial", "source_hashes": {"assay_lexicon": "99e1195c7d6f"}, "confidence": 0.99, "evidence": ["Materials and Methods Microarray Data Processing Series matrix files of GSE52", "latform of the GSE52804 dataset was GPL6246 (Affymetrix Mouse Gene 1.0 ST Array). This dataset inclu"], "order_basis": "paper_text_order:1917", "id": "assay:3"}, {"role": "analysis", "definition_id": "network_analysis", "definition_version": "f2132e96ae6c7a4e", "definition_digest": null, "required_operations": ["build_graph", "centrality_scores", "pathway_enrich"], "support_state": "supported", "source_hashes": {"dsl_catalogue": "f2132e96ae6c7a4e"}, "confidence": 0.7, "evidence": ["protein-protein interaction"], "order_basis": "consumes_earlier_output", "id": "assay:4"}]}