Microarray analysis identification of key pathways and interaction network of differential gene expressions during osteogenic differentiation.

{"sci_version": "1.2", "schema": "https://corpus.bntrg.co.uk/sci/1.0/sci.schema.json", "id": "pmid:33234152", "kind": "science-record", "revision": 7, "content_hash": "sha256:aab680131d81a621b1abb2a35d591d85d139be149d10b6029c1fbd0c53624546", "created_at": "2026-11-01T15:41:17Z", "updated_at": "2026-11-01T22:02:35Z", "generator": {"name": "corpus-assay-engine", "run_id": "reading-sci-2026-11-01"}, "paper": {"state": "complete", "title": "Microarray analysis identification of key pathways and interaction network of differential gene expressions during osteogenic differentiation.", "doi": "10.1186/s40246-020-00293-1", "pmid": "33234152", "authors": ["Fatemeh Khodabandehloo", "Sara Taleahmad", "Reza Aflatoonian", "Farzad Rajaei", "Zahra Zandieh", "Marjan Nassiri-Asl", "Mohamadreza Baghaban Eslaminejad"], "journal": "Human genomics", "year": 2020, "abstract": "BACKGROUND: Adult bone marrow-derived mesenchymal stem cells (BM-MSCs) are multipotent stem cells that can differentiate into three lineages. They are suitable sources for cell-based therapy and regenerative medicine applications. This study aims to evaluate the hub genes and key pathways of differentially expressed genes (DEGs) related to osteogenesis by bioinformatics analysis in three different days. The DEGs were derived from the three different days compared with day 0.\nRESULTS: Gene expression profiles of GSE37558 were obtained from the Gene Expression Omnibus (GEO) database. A total of 4076 DEGs were acquired on days 8, 12, and 25. Gene ontology (GO) enrichment analysis showed that the non-canonical Wnt signaling pathway and lipopolysaccharide (LPS)-mediated signaling pathway were commonly upregulated DEGs for all 3 days. KEGG pathway analysis indicated that the PI3K-Akt and focal adhesion were also commonly upregulated DEGs for all 3 days. Ten hub genes were identified by CytoHubba on days 8, 12, and 25. Then, we focused on the association of these hub genes with the Wnt pathways that had been enriched from the protein-protein interaction (PPI) by the Cytoscape plugin MCODE.\nCONCLUSIONS: These findings suggested further insights into the roles of the PI3K/AKT and Wnt pathways and their association with osteogenesis. In addition, the stem cell microenvironment via growth factors, extracellular matrix (ECM), IGF1, IGF2, LPS, and Wnt most likely affect osteogenesis by PI3K/AKT.", "claims": [{"id": "claim-method", "statement": "GEO2R (http://www.ncbi.nlm.nih.gov/geo/geo2r/) was used to identify the DEGs between the control group (day 0) and differentiated groups (days 8, 12, and 25).", "kind": "methodological", "target": null, "evidence": [{"asset": "source:pmid:33234152", "locator": "sections[19] \"Identification of differential gene expressions (DEGs)\" paragraph 2", "quote": "GEO2R (http://www.ncbi.nlm.nih.gov/geo/geo2r/) was used to identify the DEGs between the control group (day 0) and differentiated groups (days 8, 12, and 25)."}], "state": "complete"}, {"id": "claim-data-access", "statement": "Availability of data and materialsAll data used and analyzed during this study are included in this published article and its supplementary information files. The other data including real-time PCR data are available from the corresponding author on reasonable request.", "kind": "methodological", "target": null, "evidence": [{"asset": "source:pmid:33234152", "locator": "sections[33] \"notes\" paragraph 1", "quote": "Availability of data and materialsAll data used and analyzed during this study are included in this published article and its supplementary information files. The other data including real-time PCR data are available from the corresponding author on reasonable request."}], "state": "complete"}], "gaps": []}, "experiment": {"state": "complete", "objective": null, "steps": [{"id": "read_published_estimate", "order": 1, "name": "Read the published estimate from the source", "kind": "other", "state": "complete", "blocked_on": null, "description": "The claim, method and evidence span published with the source article.", "duration_hours": null, "parameters": {}, "inputs": ["source:pmid:33234152"], "outputs": ["the published estimate and its evidence"], "instruments": [], "reagents": []}, {"id": "obtain_source_data", "order": 2, "name": "Obtain the source data from the named repository", "kind": "data-preparation", "state": "complete", "blocked_on": null, "description": "The GEO series accession resolves and its sample accessions are listed. This lane did not download the dataset or read its licence.", "duration_hours": null, "parameters": {}, "inputs": ["data:geo:GSE37558"], "outputs": ["the source data with its repository provenance"], "instruments": [], "reagents": []}, {"id": "run_analysis", "order": 3, "name": "Run the published analysis", "kind": "analysis", "state": "complete", "blocked_on": null, "description": "Apply the paper's statistical method to the resolved series and compare the result with the published target.", "duration_hours": null, "parameters": {}, "inputs": ["data:geo:GSE37558"], "outputs": ["the replicated result and its comparison"], "instruments": [], "reagents": []}], "materials": [], "instruments": [], "reagents": [], "conditions": {}, "gaps": []}, "data": {"state": "partial", "assets": [{"id": "source:pmid:33234152", "role": "manuscript", "format": "xml", "media_type": "application/xml", "uri": "https://doi.org/10.1186/s40246-020-00293-1", "sha256": "sha256:b1dcf7340fcf979e3df57e3ef1ee14a5a0b979cdc89c21b0bd970e66027b1b20", "bytes": 36392, "access": "open", "state": "resolved", "reader": null, "reader_status": "reader_required", "identifier": "10.1186/s40246-020-00293-1", "version": null, "note": "Full article fetched from PMC; the checksum covers the rendered section body, not the original XML bytes.", "structure": {"pmcid": "PMC7687700", "source": "europe_pmc_fulltext", "coverage": "whole_body_without_references", "text_hash_scope": "rendered_section_body"}}, {"id": "data:geo:GSE37558", "role": "raw", "format": "geo-series", "media_type": "application/vnd.ncbi.geo-series+json", "uri": "https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE37558", "sha256": null, "bytes": null, "access": "open", "state": "resolved", "reader": null, "reader_status": "reader_required", "identifier": "GSE37558", "version": null, "note": "Availability of data and materialsAll data used and analyzed during this study are included in this published article and its supplementary information files. The other data including real-time PCR data are available from the corresponding author on reasonable request.", "structure": {"repository": "GEO", "access_route": "GEO accession URL", "access_statement_verbatim": "Availability of data and materialsAll data used and analyzed during this study are included in this published article and its supplementary information files. The other data including real-time PCR data are available from the corresponding author on reasonable request.", "access_statement_kind": "data_availability_statement", "sample_accessions": ["GSM921574", "GSM921575", "GSM921576", "GSM921577", "GSM921578", "GSM921579", "GSM921580", "GSM921581", "GSM921582", "GSM921583", "GSM921584", "GSM921585", "GSM921586", "GSM921587", "GSM921588", "GSM921589", "GSM921590", "GSM921591", "GSM921592", "GSM921593", "GSM921594", "GSM921595", "GSM921596", "GSM921597", "GSM921598", "GSM921599", "GSM921600", "GSM921601", "GSM921602", "GSM921603", "GSM921604", "GSM921605"], "sample_count": 32, "group_sizes": null, "group_sizes_basis": null, "platform": "6947", "taxon": "Homo sapiens", "title": "Calcifying vascular smooth muscle cells and osteoblasts: independent cell types exhibiting extracellular matrix and biomineralization-related mimicries", "resolution_checked_at": "2026-11-01T15:39:54Z", "resolution_check": "identifier_resolution_only_no_download_no_licence_read", "downloaded": false, "licence_read": false}}, {"id": "asset:table:pmid:33234152:1", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:53c923cd3b0b8519ac58d9c53a15287cb89ded45d0663082ae99b41ec2ad5089", "bytes": 462, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[18]/table-wrap[1]#Tab1", "version": null, "note": "List of samples accession (GSM) used at different four-time points (days 0, 8, 12, and 25)", "structure": {"pmcid": "PMC7687700", "section_index": 18, "section_title": "Microarray data analysis", "row_count": 5, "column_count": 2}, "table": {"label": "Table 1", "caption": "List of samples accession (GSM) used at different four-time points (days 0, 8, 12, and 25)", "rows": [["Time point", "Sample accession"], ["0", "GSM921574, GSM921575, GSM921576, and GSM921577"], ["8", "GSM921581, GSM921582, and GSM921583"], ["12", "GSM921584, GSM921585, and GSM921586"], ["25", "GSM921587, GSM921588, and GSM921589"]], "row_count": 5, "column_count": 2, "numeric_cells": 8, "header_rows": 1, "locator": "section[18]/table-wrap[1]#Tab1"}}, {"id": "asset:table:pmid:33234152:2", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:32281c3dfa32c92e26457c72d86dfa97fc63a44e10e7a42dabba05d808c067c3", "bytes": 870, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[23]/table-wrap[1]#Tab2", "version": null, "note": "List of primers used for real-time PCR to validate microarray analysis", "structure": {"pmcid": "PMC7687700", "section_index": 23, "section_title": "Validation of microarrays data by real-time PCR", "row_count": 8, "column_count": 4}, "table": {"label": "Table 2", "caption": "List of primers used for real-time PCR to validate microarray analysis", "rows": [["Target gene", "Primer sequence", "Accession number", "Product size"], ["GAPDH", "F: CTCATTTCCTGGTATGACAACGAR: CTTCCTCTTGTGCTCTTG", "NM_001357943.2", "122 bp"], ["CTNNB1", "F: AATGCTTGGTTCACCAGTGR: GGCAGTCTGTCGTAATAGCC", "NM_001330729.2", "176 bp"], ["MAPK3", "F: TGACCATATCTGCTACTTCCTCR: GGTATAGCCCTTGGAGTTCAG", "NM_001040056.3", "250 bp"], ["ITGAV", "F: GCAACAGGCAATAGAGATR: TGCTGAATCCTCCTTGACAA", "NM_002210.5", "262 bp"], ["ITGA5", "F: GCTGTGACTACTTTGCCGTGR: CGAGTTGTTGAGATTCTTGCTG", "NM_002205.5", "176 bp"], ["CCNB1", "F: GCTGGGTGTAGGTCCTTGR: CCTGCCATGTTGATCTTCG", "NM_031966.4", "149 bp"], ["TLR4", "F: TGATGTCTGCCTCGCGCCTGR: AACCACCTCCACGCAGGGCT", "NM_138554.5", "98 bp"]], "row_count": 8, "column_count": 4, "numeric_cells": 14, "header_rows": 1, "locator": "section[23]/table-wrap[1]#Tab2"}}], "gaps": ["asset:data:geo:GSE37558 not downloaded", "asset:data:geo:GSE37558 licence not read"]}, "analysis": {"state": "partial", "methods": [{"id": "method-1", "family": "network_analysis", "specific": "ppi_network", "label": "Network / pathway analysis", "dsl_operations": ["build_graph", "centrality_scores", "pathway_enrich"], "missing_operations": [], "expressible": true, "parameters": {}, "data_shapes": ["edge_list"], "evidence": {"score": 0.7, "band": "medium", "quote": "protein-protein interaction"}}, {"id": "method-2", "family": null, "specific": null, "label": "GEO2R", "dsl_operations": [], "missing_operations": [], "expressible": null, "parameters": {}, "data_shapes": [], "evidence": {"score": 1.0, "band": "verbatim", "quote": "GEO2R (http://www.ncbi.nlm.nih.gov/geo/geo2r/) was used to identify the DEGs between the control group (day 0) and differentiated groups (days 8, 12, and 25)."}}], "targets": [], "gaps": ["method.reader_named_unmapped"]}, "capability": {"state": "complete", "requirements": [{"capability_id": "capability:computational_analysis", "label": "Computational analysis platform", "assay_families": ["meta_analysis", "machine_learning", "survival_analysis", "statistical_regression", "pca", "molecular_docking", "network_analysis", "differential_expression", "gwas"], "availability_state": "owned", "tier_unlocked": "R1", "candidate": "Automated Assays Laravel application and simulated adapters"}], "gaps": []}, "readiness": {"state": "complete", "tier": "R1", "blocking_axis": "none", "blocked_on": "nothing:replicable_now", "axes": {"method": {"tier": "R1", "expressible": true, "required_operations": ["build_graph", "centrality_scores", "pathway_enrich"], "missing_operations": [], "basis": "The paper names the method it used and the corpus's method extractor maps it onto the DSL catalogue: ppi_network."}, "capability": {"tier": "R1", "capability_id": "capability:computational_analysis", "availability_state": "owned", "basis": "The computational analysis is owned. The physical bench the paper used is not, so a physical validation cannot be run here."}, "data": {"tier": "R1", "reachable": true, "accessions": ["GSE37558"], "resolved_accessions": ["GSE37558"], "statements": ["Availability of data and materialsAll data used and analyzed during this study are included in this published article and its supplementary information files. The other data including real-time PCR data are available from the corresponding author on reasonable request."], "basis": "The paper names GSE37558 in Gene Expression Omnibus (GEO) and the accession resolves in the repository. No dataset was downloaded and no licence was read."}}, "can_run": {"dsl_operations": ["build_graph", "centrality_scores", "pathway_enrich"], "assets": ["source:pmid:33234152", "data:geo:GSE37558", "asset:table:pmid:33234152:1", "asset:table:pmid:33234152:2"], "steps": ["run_analysis"]}, "must_build": {"dsl_operations": [], "converters": [], "readers": [], "capabilities": [], "data_gaps": ["data:geo:GSE37558"]}, "gaps": []}, "review": {"state": "partial", "machine_critique": {"kind": "extraction_review", "reader": {"model": "MiniMax-M3.1-Flash", "provider": "minimax", "provider_family": "minimax", "read_at": "2026-10-31T18:24:32Z", "independence": "single_reader"}, "evidence_check": {"method": "verbatim", "availability": "verbatim"}, "calls": 3, "usage": {"prompt_tokens": 29424, "completion_tokens": 1302, "cached_tokens": 784}}, "human_critique": null, "stages": [{"id": "extraction", "state": "complete", "reader": "MiniMax-M3.1-Flash", "provider": "minimax"}], "gaps": ["review.independent_reader", "review.machine_critique", "review.human_critique"]}, "execution": {"state": "absent", "status": "not_run", "mode": null, "runs": [], "gaps": ["execution.not_run"]}, "provenance": {"entities": [{"id": "pmid:33234152", "type": "paper", "label": "pmid:33234152"}, {"id": "source:pmid:33234152", "type": "manuscript", "label": "PMID 33234152 full text"}, {"id": "data:geo:GSE37558", "type": "dataset", "label": "GEO GSE37558"}], "activities": [{"id": "activity-reading-sci-2026-11-01", "type": "classification", "used": [{"id": "pmid:33234152", "type": "paper", "label": "pmid:33234152"}, {"id": "source:pmid:33234152", "type": "manuscript", "label": "PMID 33234152 full text"}, {"id": "data:geo:GSE37558", "type": "dataset", "label": "GEO GSE37558"}], "agent": "agent:corpus-assay-engine"}, {"id": "activity-read-33234152", "type": "extraction", "used": ["source:pmid:33234152"], "agent": "agent:minimax-reader"}, {"id": "activity-resolve-GSE37558", "type": "accession_resolution", "used": ["data:geo:GSE37558"], "agent": "agent:corpus-assay-engine"}], "agents": [{"id": "agent:corpus-assay-engine", "type": "software", "label": "Corpus assay engine"}, {"id": "agent:minimax-reader", "type": "software", "label": "MiniMax literature reader"}], "source_run_id": "reading-sci-2026-11-01", "dsl_catalogue_fingerprint": "343fb30756ba6ec3", "capability_table_fingerprint": "2cb3e42f047d2ecf", "snapshot_id": "ba34b49490d9bfaf"}, "lineage": {"parent_id": "pmid:33234152", "parent_hash": "sha256:732b2b61eb99d907840c5d303f53e104933619f0d2a20d472048ce3248df60a1", "fork_of": null, "generation": 6}, "gaps": ["asset:data:geo:GSE37558 licence not read", "asset:data:geo:GSE37558 not downloaded", "execution.not_run", "method.reader_named_unmapped", "review.human_critique", "review.independent_reader", "review.machine_critique"], "assays": [{"role": "data_generation", "definition_id": "microarray", "definition_version": "99e1195c7d6f", "definition_digest": null, "required_operations": [], "support_state": "partial", "source_hashes": {"assay_lexicon": "99e1195c7d6f"}, "confidence": 0.93, "evidence": ["Microarray analysis identification of key pathways and"], "order_basis": "paper_text_order:0", "id": "assay:1"}, {"role": "data_generation", "definition_id": "cell_culture", "definition_version": "99e1195c7d6f", "definition_digest": null, "required_operations": [], "support_state": "partial", "source_hashes": {"assay_lexicon": "99e1195c7d6f"}, "confidence": 0.77, "evidence": ["three biological replicates. The cells were cultured in α-MEM (Gibco, cat. no. 12571) with 10%FBS (G"], "order_basis": "paper_text_order:1862", "id": "assay:2"}, {"role": "analysis", "definition_id": "network_analysis", "definition_version": "f2132e96ae6c7a4e", "definition_digest": null, "required_operations": ["build_graph", "centrality_scores", "pathway_enrich"], "support_state": "supported", "source_hashes": {"dsl_catalogue": "f2132e96ae6c7a4e"}, "confidence": 0.7, "evidence": ["protein-protein interaction"], "order_basis": "consumes_earlier_output", "id": "assay:3"}]}