MicroRNA-126-5p Inhibits the Migration of Breast Cancer Cells by Directly Targeting CNOT7.

{"sci_version": "1.2", "schema": "https://corpus.bntrg.co.uk/sci/1.0/sci.schema.json", "id": "pmid:33256566", "kind": "science-record", "revision": 9, "content_hash": "sha256:217142703d197cc1083098f7b4070327314c784f8c997fd6861d2207147a5b47", "created_at": "2026-11-01T15:41:17Z", "updated_at": "2026-11-01T22:45:42Z", "generator": {"name": "corpus-assay-engine", "run_id": "reading-sci-2026-11-01"}, "paper": {"state": "complete", "title": "MicroRNA-126-5p Inhibits the Migration of Breast Cancer Cells by Directly Targeting CNOT7.", "doi": "10.1177/1533033820977545", "pmid": "33256566", "authors": ["Yuying Miao", "Jiang Lu", "Baozhen Fan", "Lecan Sun"], "journal": "Technology in cancer research & treatment", "year": 2020, "abstract": "BACKGROUND: To assess the effect of microRNA-126-5p (miR-126-5p) on the migration of the breast cancer MCF7 cell line.\nMETHODS: GSE143564 was downloaded from the Gene Expression Omnibus (GEO; http://www.ncbi.nlm.nih.gov/geo) to identify the differentially expressed miRNAs between breast cancer and adjacent tissues. Quantitative reverse transcription PCR (RT-qPCR) was used to assess miR-126-5p levels in the normal 184A1 breast cell line and the breast cancer MCF7 cell line. The MCF7 cell line was then transfected with miR-126-5p mimics or corresponding negative control (NC-mimic). The proliferation and migration abilities of the MCF7 cell line were measured by methyl thiazolyl tetrazolium (MTT), Transwell and scratch healing assays. CCR4-NOT transcription complex and subunit 7 (CNOT7) expression levels in the NC-mimic and miR-126-5p mimic groups were measured by Western blot analysis. Bioinformatic analysis and a dual-luciferase reporter assay were performed to identify the miR-126-5p target gene.\nRESULTS: One hundred forty-eight differentially expressed miRNAs (downregulated = 55, upregulated = 93) were identified. MiR-126-5p expression in the MCF7 cell line was significantly downregulated relative to that of 184A1 cell line (P < 0.05). Compared with that observed in the control and NC-mimic groups, cell proliferation in the miR-126-5p mimic group was significantly decreased at 48 and 72 h posttransfection (P < 0.05). In addition, the scratch healing rate and number of membrane-piercing cells in the miR-126-5p overexpression group were lower than those detected in the control and NC groups (P < 0.05). Furthermore, miR-126-5p could reduce the luciferase activity for the wild-type CNOT7 gene 3'-untranslated region (UTR) reporter (P < 0.05) but had no effect on the mutant 3'UTR reporter (P > 0.05). Compared with that observed in the NC and control groups, the levels of CNOT7 in the miR-126-5p overexpression group decreased (P < 0.05).\nCONCLUSION: Upregulation of miR-126-5p can inhibit the migration of the breast cancer MCF7 cell line, which may involve its direct targeting of the 3'UTR of CNOT7.", "claims": [{"id": "claim-method", "statement": "Differentially expressed miRNAs between breast and adjacent tissues were identified with the Limma package in the R software environment and were plotted using a volcano plot and heatmap using the R packages “ggplot2” and “pheatmap.”", "kind": "methodological", "target": null, "evidence": [{"asset": "source:pmid:33256566", "locator": "sections[3] \"Bioinformatic Analysis of GSE143564\" paragraph 2", "quote": "Differentially expressed miRNAs between breast and adjacent tissues were identified with the Limma package in the R software environment and were plotted using a volcano plot and heatmap using the R packages “ggplot2” and “pheatmap.”"}], "state": "complete"}, {"id": "claim-data-access", "statement": "GSE143564 was downloaded from the Gene Expression Omnibus (GEO; http://www.ncbi.nlm.nih.gov/geo). GSE143564 was based on the Affymetrix Multispecies miRNA-4 Array [Probe Set ID version] platform and included 6 samples (3 breast tissues and 3 adjacent tissues).", "kind": "methodological", "target": null, "evidence": [{"asset": "source:pmid:33256566", "locator": "sections[3] \"Bioinformatic Analysis of GSE143564\" paragraph 2", "quote": "GSE143564 was downloaded from the Gene Expression Omnibus (GEO; http://www.ncbi.nlm.nih.gov/geo). GSE143564 was based on the Affymetrix Multispecies miRNA-4 Array [Probe Set ID version] platform and included 6 samples (3 breast tissues and 3 adjacent tissues)."}], "state": "complete"}], "gaps": []}, "experiment": {"state": "complete", "objective": null, "steps": [{"id": "read_published_estimate", "order": 1, "name": "Read the published estimate from the source", "kind": "other", "state": "complete", "blocked_on": null, "description": "The claim, method and evidence span published with the source article.", "duration_hours": null, "parameters": {}, "inputs": ["source:pmid:33256566"], "outputs": ["the published estimate and its evidence"], "instruments": [], "reagents": []}, {"id": "obtain_source_data", "order": 2, "name": "Obtain the source data from the named repository", "kind": "data-preparation", "state": "complete", "blocked_on": null, "description": "The GEO series accession resolves and its sample accessions are listed. This lane did not download the dataset or read its licence.", "duration_hours": null, "parameters": {}, "inputs": ["data:geo:GSE143564"], "outputs": ["the source data with its repository provenance"], "instruments": [], "reagents": []}, {"id": "run_analysis", "order": 3, "name": "Run the published analysis", "kind": "analysis", "state": "complete", "blocked_on": null, "description": "Apply the paper's statistical method to the resolved series and compare the result with the published target.", "duration_hours": null, "parameters": {}, "inputs": ["data:geo:GSE143564"], "outputs": ["the replicated result and its comparison"], "instruments": [], "reagents": []}], "materials": [], "instruments": [], "reagents": [], "conditions": {}, "gaps": []}, "data": {"state": "partial", "assets": [{"id": "source:pmid:33256566", "role": "manuscript", "format": "xml", "media_type": "application/xml", "uri": "https://doi.org/10.1177/1533033820977545", "sha256": "sha256:77829324d36ac9cb121bcf674dc64155ff7d5b28196d8b692004f27920d37f8e", "bytes": 28365, "access": "open", "state": "resolved", "reader": null, "reader_status": "reader_required", "identifier": "10.1177/1533033820977545", "version": null, "note": "Full article fetched from PMC; the checksum covers the rendered section body, not the original XML bytes.", "structure": {"pmcid": "PMC7711228", "source": "europe_pmc_fulltext", "coverage": "whole_body", "text_hash_scope": "rendered_section_body"}}, {"id": "data:geo:GSE143564", "role": "raw", "format": "geo-series", "media_type": "application/vnd.ncbi.geo-series+json", "uri": "https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE143564", "sha256": null, "bytes": null, "access": "open", "state": "resolved", "reader": null, "reader_status": "reader_required", "identifier": "GSE143564", "version": null, "note": "GSE143564 was downloaded from the Gene Expression Omnibus (GEO; http://www.ncbi.nlm.nih.gov/geo). GSE143564 was based on the Affymetrix Multispecies miRNA-4 Array [Probe Set ID version] platform and included 6 samples (3 breast tissues and 3 adjacent tissues).", "structure": {"repository": "GEO", "access_route": "GEO accession URL", "access_statement_verbatim": "GSE143564 was downloaded from the Gene Expression Omnibus (GEO; http://www.ncbi.nlm.nih.gov/geo). GSE143564 was based on the Affymetrix Multispecies miRNA-4 Array [Probe Set ID version] platform and included 6 samples (3 breast tissues and 3 adjacent tissues).", "access_statement_kind": "repository_route_statement", "sample_accessions": ["GSM4262013", "GSM4262014", "GSM4262015", "GSM4262016", "GSM4262017", "GSM4262018"], "sample_count": 6, "group_sizes": null, "group_sizes_basis": null, "platform": "21572", "taxon": "Homo sapiens; synthetic construct", "title": "miRNA expession data in breast cancer and adjacent normal tissues", "resolution_checked_at": "2026-11-01T15:39:54Z", "resolution_check": "identifier_resolution_only_no_download_no_licence_read", "downloaded": false, "licence_read": false}}, {"id": "asset:table:pmid:33256566:1", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:61672c207a7a0f28ed329198a1ef681a202656a662217247b94d356ba5fb3222", "bytes": 452, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[9]/table-wrap[1]#table1-1533033820977545", "version": null, "note": "Primer That Used for PCR.", "structure": {"pmcid": "PMC7711228", "section_index": 9, "section_title": "PCR", "row_count": 5, "column_count": 3}, "table": {"label": "Table 1.", "caption": "Primer That Used for PCR.", "rows": [["Gene", "Forward (5’-3’)", "Reverse (5’-3’)"], ["miR-126-5p", "TCGTACCGTGAGTAATAATGCG", ""], ["U6", "CTCGCTTCGGCAGCACATA", "CTCGCTTCGGCAGCACATA"], ["CNOT7", "CACAAATGCTCACCGAAGAA", "TTCGATTTCCCTGAGGACTG"], ["GAPDH", "GCGGTGGAACTGAAGGATTC", "TGGCAGTTTGGGTGTACTGG"]], "row_count": 5, "column_count": 3, "numeric_cells": 3, "header_rows": 1, "locator": "section[9]/table-wrap[1]#table1-1533033820977545"}}], "gaps": ["asset:data:geo:GSE143564 not downloaded", "asset:data:geo:GSE143564 licence not read"]}, "analysis": {"state": "partial", "methods": [{"id": "method-1", "family": "differential_expression", "specific": "limma_voom", "label": "Differential expression analysis", "dsl_operations": ["normalise_counts", "differential_expression_fit", "fdr_bh"], "missing_operations": [], "expressible": true, "parameters": {}, "data_shapes": ["count_matrix_with_condition"], "evidence": {"score": 1.0, "band": "verbatim", "quote": "Differentially expressed miRNAs between breast and adjacent tissues were identified with the Limma package in the R software environment and were plotted using a volcano plot and heatmap using the R packages “ggplot2” and “pheatmap.”"}}, {"id": "method-2", "family": "group_comparison", "specific": "mann_whitney", "label": "Group comparison", "dsl_operations": [], "missing_operations": ["group_comparison_mann_whitney"], "expressible": false, "parameters": {}, "data_shapes": ["two_or_more_groups_continuous"], "evidence": {"score": 0.8, "band": "high", "quote": "Mann-Whitney"}}, {"id": "method-3", "family": "group_comparison", "specific": "anova", "label": "Group comparison", "dsl_operations": ["group_summary", "welch_t", "bootstrap_mean_difference", "group_comparison_anova"], "missing_operations": [], "expressible": true, "parameters": {}, "data_shapes": ["two_or_more_groups_continuous"], "evidence": {"score": 0.8, "band": "high", "quote": "ANOVA"}}, {"id": "method-4", "family": "correlation_analysis", "specific": "pearson", "label": "Correlation analysis", "dsl_operations": ["pearson_r"], "missing_operations": [], "expressible": true, "parameters": {}, "data_shapes": ["paired_numeric_columns"], "evidence": {"score": 0.8, "band": "high", "quote": "Pearson correlation"}}], "targets": [], "gaps": ["method.reader_differs_from_extractor"]}, "capability": {"state": "complete", "requirements": [{"capability_id": "capability:computational_analysis", "label": "Computational analysis platform", "assay_families": ["meta_analysis", "machine_learning", "survival_analysis", "statistical_regression", "pca", "molecular_docking", "network_analysis", "differential_expression", "gwas"], "availability_state": "owned", "tier_unlocked": "R1", "candidate": "Automated Assays Laravel application and simulated adapters"}], "gaps": []}, "readiness": {"state": "complete", "tier": "R1", "blocking_axis": "none", "blocked_on": "nothing:replicable_now", "axes": {"method": {"tier": "R1", "expressible": true, "required_operations": ["normalise_counts", "differential_expression_fit", "fdr_bh"], "missing_operations": [], "basis": "The paper names the method it used and the corpus's method extractor maps it onto the DSL catalogue: limma_voom."}, "capability": {"tier": "R1", "capability_id": "capability:computational_analysis", "availability_state": "owned", "basis": "The computational analysis is owned. The physical bench the paper used is not, so a physical validation cannot be run here."}, "data": {"tier": "R1", "reachable": true, "accessions": ["GSE143564"], "resolved_accessions": ["GSE143564"], "statements": ["GSE143564 was downloaded from the Gene Expression Omnibus (GEO; http://www.ncbi.nlm.nih.gov/geo). GSE143564 was based on the Affymetrix Multispecies miRNA-4 Array [Probe Set ID version] platform and included 6 samples (3 breast tissues and 3 adjacent tissues)."], "basis": "The paper names GSE143564 in Gene Expression Omnibus (GEO) and the accession resolves in the repository. No dataset was downloaded and no licence was read."}}, "can_run": {"dsl_operations": ["normalise_counts", "differential_expression_fit", "fdr_bh"], "assets": ["source:pmid:33256566", "data:geo:GSE143564", "asset:table:pmid:33256566:1"], "steps": ["run_analysis"]}, "must_build": {"dsl_operations": [], "converters": [], "readers": [], "capabilities": [], "data_gaps": ["data:geo:GSE143564"]}, "gaps": []}, "review": {"state": "partial", "machine_critique": {"kind": "extraction_review", "reader": {"model": "MiniMax-M3.1-Flash", "provider": "minimax", "provider_family": "minimax", "read_at": "2026-10-31T18:24:39Z", "independence": "single_reader"}, "evidence_check": {"method": "verbatim", "availability": null}, "calls": 3, "usage": {"prompt_tokens": 24164, "completion_tokens": 979, "cached_tokens": 776}}, "human_critique": null, "stages": [{"id": "extraction", "state": "complete", "reader": "MiniMax-M3.1-Flash", "provider": "minimax"}], "gaps": ["review.independent_reader", "review.machine_critique", "review.human_critique"]}, "execution": {"state": "absent", "status": "not_run", "mode": null, "runs": [], "gaps": ["execution.not_run"]}, "provenance": {"entities": [{"id": "pmid:33256566", "type": "paper", "label": "pmid:33256566"}, {"id": "source:pmid:33256566", "type": "manuscript", "label": "PMID 33256566 full text"}, {"id": "data:geo:GSE143564", "type": "dataset", "label": "GEO GSE143564"}], "activities": [{"id": "activity-reading-sci-2026-11-01", "type": "classification", "used": [{"id": "pmid:33256566", "type": "paper", "label": "pmid:33256566"}, {"id": "source:pmid:33256566", "type": "manuscript", "label": "PMID 33256566 full text"}, {"id": "data:geo:GSE143564", "type": "dataset", "label": "GEO GSE143564"}], "agent": "agent:corpus-assay-engine"}, {"id": "activity-read-33256566", "type": "extraction", "used": ["source:pmid:33256566"], "agent": "agent:minimax-reader"}, {"id": "activity-resolve-GSE143564", "type": "accession_resolution", "used": ["data:geo:GSE143564"], "agent": "agent:corpus-assay-engine"}], "agents": [{"id": "agent:corpus-assay-engine", "type": "software", "label": "Corpus assay engine"}, {"id": "agent:minimax-reader", "type": "software", "label": "MiniMax literature reader"}], "source_run_id": "reading-sci-2026-11-01", "dsl_catalogue_fingerprint": "343fb30756ba6ec3", "capability_table_fingerprint": "2cb3e42f047d2ecf", "snapshot_id": "ba34b49490d9bfaf"}, "lineage": {"parent_id": "pmid:33256566", "parent_hash": "sha256:53c3d1c394431f05bf9e5bc82100d449b025663ca8f65bf8964efd79b718e95d", "fork_of": null, "generation": 8}, "gaps": ["asset:data:geo:GSE143564 licence not read", "asset:data:geo:GSE143564 not downloaded", "execution.not_run", "method.reader_differs_from_extractor", "review.human_critique", "review.independent_reader", "review.machine_critique"], "assays": [{"role": "data_generation", "definition_id": "cell_culture", "definition_version": "99e1195c7d6f", "definition_digest": null, "required_operations": [], "support_state": "partial", "source_hashes": {"assay_lexicon": "99e1195c7d6f"}, "confidence": 0.99, "evidence": ["26-5p) on the migration of the breast cancer MCF7 cell line. METHODS: GSE143564 was downloaded", "184A1 breast cell line and the breast cancer MCF7 cell line. The MCF7 cell line was then trans", "ne and the breast cancer MCF7 cell line. The MCF7 cell line was then transfected with miR-126-", "proliferation and migration abilities of the MCF7 cell line were measured by methyl thiazolyl"], "order_basis": "paper_text_order:149", "id": "assay:1"}, {"role": "data_generation", "definition_id": "qpcr", "definition_version": "99e1195c7d6f", "definition_digest": null, "required_operations": [], "support_state": "partial", "source_hashes": {"assay_lexicon": "99e1195c7d6f"}, "confidence": 0.99, "evidence": ["ues. Quantitative reverse transcription PCR (RT-qPCR) was used to assess miR-126-5p levels in the", ". Quantitative reverse transcription PCR (RT-qPCR) was used to assess miR-126-5p levels in the", "between breast cancer and adjacent tissues. Quantitative reverse transcription PCR (RT-qPCR) was used to assess miR-126-5p leve"], "order_basis": "paper_text_order:364", "id": "assay:2"}, {"role": "data_generation", "definition_id": "transfection", "definition_version": "99e1195c7d6f", "definition_digest": null, "required_operations": [], "support_state": "partial", "source_hashes": {"assay_lexicon": "99e1195c7d6f"}, "confidence": 0.99, "evidence": ["MCF7 cell line. The MCF7 cell line was then transfected with miR-126-5p mimics or corresponding nega", "ttp://apps.cytoscape.org/). Cell Culture and Transfection MCF7 cells were cultured in DMEM supplemente", "oximately 50∼60% confluency. MCF7 cells were transfected with miR-126-5p mimics (overexpression group"], "order_basis": "paper_text_order:553", "id": "assay:3"}, {"role": "data_generation", "definition_id": "apoptosis_assay", "definition_version": "99e1195c7d6f", "definition_digest": null, "required_operations": [], "support_state": "partial", "source_hashes": {"assay_lexicon": "99e1195c7d6f"}, "confidence": 0.93, "evidence": ["re measured by methyl thiazolyl tetrazolium (MTT), Transwell and scratch healing assays. CCR4"], "order_basis": "paper_text_order:744", "id": "assay:4"}, {"role": "data_generation", "definition_id": "western_blot", "definition_version": "99e1195c7d6f", "definition_digest": null, "required_operations": [], "support_state": "partial", "source_hashes": {"assay_lexicon": "99e1195c7d6f"}, "confidence": 0.93, "evidence": ["and miR-126-5p mimic groups were measured by Western blot analysis. Bioinformatic analysis and a dual-"], "order_basis": "paper_text_order:920", "id": "assay:5"}, {"role": "analysis", "definition_id": "differential_expression", "definition_version": "f2132e96ae6c7a4e", "definition_digest": null, "required_operations": ["normalise_counts", "differential_expression_fit", "fdr_bh"], "support_state": "supported", "source_hashes": {"dsl_catalogue": "f2132e96ae6c7a4e"}, "confidence": 1.0, "evidence": ["Differentially expressed miRNAs between breast and adjacent tissues were identified with the Limma package in the R software environment and were plotted using a volcano plot and heatmap using the R packages “ggplot2” and “pheatmap.”"], "order_basis": "consumes_earlier_output", "id": "assay:6"}]}