MIR155HG Knockdown Inhibited the Progression of Cervical Cancer by Binding SRSF1.

{"sci_version": "1.2", "schema": "https://corpus.bntrg.co.uk/sci/1.0/sci.schema.json", "id": "pmid:33262605", "kind": "science-record", "revision": 8, "content_hash": "sha256:826a0fc6c0e7e3c1f3a70f7db763f823233f76547d82b1c1728992aeea665be7", "created_at": "2026-11-01T15:41:17Z", "updated_at": "2026-11-01T22:45:42Z", "generator": {"name": "corpus-assay-engine", "run_id": "reading-sci-2026-11-01"}, "paper": {"state": "complete", "title": "MIR155HG Knockdown Inhibited the Progression of Cervical Cancer by Binding SRSF1.", "doi": "10.2147/OTT.S267594", "pmid": "33262605", "authors": ["Ling Shen", "Yuancheng Li", "Guiying Hu", "Yihong Huang", "Xinli Song", "Shun Yu", "Xiaoyuan Xu"], "journal": "OncoTargets and therapy", "year": 2020, "abstract": "BACKGROUND: As the fourth most common cancer among women worldwide, cervical cancer lead to 311,000 deaths in 2018. Although the treatments have been developed, the survival rate of cervical cancer remains unsatisfactory. In this study, we aimed to identify differentially expressed lncRNAs (DEIncRNAs) between cervical cancer and adjacent normal tissues using bioinformatics analysis, and further to investigate the biological function of the DEIncRNAs in vitro and in vivo.\nMETHODS: The expression profiles from two microarray datasets (GSE6791 and GSE63514) were downloaded from GEO for analysis of DEIncRNAs between cervical cancer and adjacent normal cervical tissues. Among all DEIncRNAs, MIR155HG upregulation was identified and selected for further investigation. The effect of MIR155HG knockdown on proliferation, apoptosis and invasion in SiHa and Hela cells were evaluated. In addition, Western blot, RNA immunoprecipitation (RIP) and cell cycle assays were performed to determine the binding target of MIR155HG. Furthermore, the effect of MIR155HG knockdown on tumor growth in vivo was investigated.\nRESULTS: The level of MIR155HG was found to be significantly upregulated in cervical cancer tissue compared with adjacent cervical tissue. Knockdown of MIR155HG notably inhibited the proliferation of SiHa and Hela cells by inducing apoptosis. In addition, MIR155HG knockdown decreased cell invasion. Moreover, tumor growth in xenograft was significantly inhibited by MIR155HG knockdown in vivo. Additionally, SRSF1 was identified as the binding protein of MIR155HG.\nCONCLUSION: Our findings demonstrated that MIR155HG knockdown inhibited the progression of cervical cancer by binding SRSF1, inspiring the usage of MIR155HG as a potential novel therapy target for the treatment of cervical cancer.", "claims": [{"id": "claim-method", "statement": "Statistical analysis was performed with one-way analysis of variance (ANOVA) and Tukey’s test using GraphPad prism version 6.0 (Graphpad Software, La Jolla, CA).", "kind": "methodological", "target": null, "evidence": [{"asset": "source:pmid:33262605", "locator": "sections[15] \"Statistical Analysis\" paragraph 2", "quote": "Statistical analysis was performed with one-way analysis of variance (ANOVA) and Tukey’s test using GraphPad prism version 6.0 (Graphpad Software, La Jolla, CA)."}], "state": "complete"}, {"id": "claim-data-access", "statement": "The datasets used in this study are available from the corresponding author on reasonable request.", "kind": "methodological", "target": null, "evidence": [{"asset": "source:pmid:33262605", "locator": "sections[26] \"Data Sharing Statement\" paragraph 2", "quote": "The datasets used in this study are available from the corresponding author on reasonable request."}], "state": "complete"}], "gaps": []}, "experiment": {"state": "complete", "objective": null, "steps": [{"id": "read_published_estimate", "order": 1, "name": "Read the published estimate from the source", "kind": "other", "state": "complete", "blocked_on": null, "description": "The claim, method and evidence span published with the source article.", "duration_hours": null, "parameters": {}, "inputs": ["source:pmid:33262605"], "outputs": ["the published estimate and its evidence"], "instruments": [], "reagents": []}, {"id": "obtain_source_data", "order": 2, "name": "Obtain the source data from the named repository", "kind": "data-preparation", "state": "complete", "blocked_on": null, "description": "The GEO series accession resolves and its sample accessions are listed. This lane did not download the dataset or read its licence.", "duration_hours": null, "parameters": {}, "inputs": ["data:geo:GSE63514"], "outputs": ["the source data with its repository provenance"], "instruments": [], "reagents": []}, {"id": "run_analysis", "order": 3, "name": "Run the published analysis", "kind": "analysis", "state": "complete", "blocked_on": null, "description": "Apply the paper's statistical method to the resolved series and compare the result with the published target.", "duration_hours": null, "parameters": {}, "inputs": ["data:geo:GSE63514"], "outputs": ["the replicated result and its comparison"], "instruments": [], "reagents": []}], "materials": [], "instruments": [], "reagents": [], "conditions": {}, "gaps": []}, "data": {"state": "partial", "assets": [{"id": "source:pmid:33262605", "role": "manuscript", "format": "xml", "media_type": "application/xml", "uri": "https://doi.org/10.2147/OTT.S267594", "sha256": "sha256:f89bba61fd584055ba3840eacc960838526c2848ea2053c52545807c5d6e08a5", "bytes": 30797, "access": "open", "state": "resolved", "reader": null, "reader_status": "reader_required", "identifier": "10.2147/OTT.S267594", "version": null, "note": "Full article fetched from PMC; the checksum covers the rendered section body, not the original XML bytes.", "structure": {"pmcid": "PMC7695692", "source": "europe_pmc_fulltext", "coverage": "whole_body_without_references", "text_hash_scope": "rendered_section_body"}}, {"id": "data:geo:GSE63514", "role": "raw", "format": "geo-series", "media_type": "application/vnd.ncbi.geo-series+json", "uri": "https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE63514", "sha256": null, "bytes": null, "access": "open", "state": "resolved", "reader": null, "reader_status": "reader_required", "identifier": "GSE63514", "version": null, "note": "The datasets used in this study are available from the corresponding author on reasonable request.", "structure": {"repository": "GEO", "access_route": "GEO accession URL", "access_statement_verbatim": "The datasets used in this study are available from the corresponding author on reasonable request.", "access_statement_kind": "data_availability_statement", "sample_accessions": ["GSM1551311", "GSM1551312", "GSM1551313", "GSM1551314", "GSM1551315", "GSM1551316", "GSM1551317", "GSM1551318", "GSM1551319", "GSM1551320", "GSM1551321", "GSM1551322", "GSM1551323", "GSM1551324", "GSM1551325", "GSM1551326", "GSM1551327", "GSM1551328", "GSM1551329", "GSM1551330", "GSM1551331", "GSM1551332", "GSM1551333", "GSM1551334", "GSM1551335", "GSM1551336", "GSM1551337", "GSM1551338", "GSM1551339", "GSM1551340", "GSM1551341", "GSM1551342", "GSM1551343", "GSM1551344", "GSM1551345", "GSM1551346", "GSM1551347", "GSM1551348", "GSM1551349", "GSM1551350", "GSM1551351", "GSM1551352", "GSM1551353", "GSM1551354", "GSM1551355", "GSM1551356", "GSM1551357", "GSM1551358", "GSM1551359", "GSM1551360", "GSM1551361", "GSM1551362", "GSM1551363", "GSM1551364", "GSM1551365", "GSM1551366", "GSM1551367", "GSM1551368", "GSM1551369", "GSM1551370", "GSM1551371", "GSM1551372", "GSM1551373", "GSM1551374", "GSM1551375", "GSM1551376", "GSM1551377", "GSM1551378", "GSM1551379", "GSM1551380", "GSM1551381", "GSM1551382", "GSM1551383", "GSM1551384", "GSM1551385", "GSM1551386", "GSM1551387", "GSM1551388", "GSM1551389", "GSM1551390", "GSM1551391", "GSM1551392", "GSM1551393", "GSM1551394", "GSM1551395", "GSM1551396", "GSM1551397", "GSM1551398", "GSM1551399", "GSM1551400", "GSM1551401", "GSM1551402", "GSM1551403", "GSM1551404", "GSM1551405", "GSM1551406", "GSM1551407", "GSM1551408", "GSM1551409", "GSM1551410", "GSM1551411", "GSM1551412", "GSM1551413", "GSM1551414", "GSM1551415", "GSM1551416", "GSM1551417", "GSM1551418", "GSM1551419", "GSM1551420", "GSM1551421", "GSM1551422", "GSM1551423", "GSM1551424", "GSM1551425", "GSM1551426", "GSM1551427", "GSM1551428", "GSM1551429", "GSM1551430", "GSM1551431", "GSM1551432", "GSM1551433", "GSM1551434", "GSM1551435", "GSM1551436", "GSM1551437", "GSM1551438"], "sample_count": 128, "group_sizes": null, "group_sizes_basis": null, "platform": "570", "taxon": "Homo sapiens", "title": "Gene expression analysis of cervical cancer progression", "resolution_checked_at": "2026-11-01T15:39:55Z", "resolution_check": "identifier_resolution_only_no_download_no_licence_read", "downloaded": false, "licence_read": false}}, {"id": "data:geo:GSE6791", "role": "raw", "format": "geo-series", "media_type": "application/vnd.ncbi.geo-series+json", "uri": "https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE6791", "sha256": null, "bytes": null, "access": "open", "state": "resolved", "reader": null, "reader_status": "reader_required", "identifier": "GSE6791", "version": null, "note": "The datasets used in this study are available from the corresponding author on reasonable request.", "structure": {"repository": "GEO", "access_route": "GEO accession URL", "access_statement_verbatim": "The datasets used in this study are available from the corresponding author on reasonable request.", "access_statement_kind": "data_availability_statement", "sample_accessions": ["GSM155645", "GSM155646", "GSM155647", "GSM155648", "GSM155649", "GSM155650", "GSM155651", "GSM155652", "GSM155653", "GSM155654", "GSM155655", "GSM155656", "GSM155657", "GSM155658", "GSM155659", "GSM155660", "GSM155661", "GSM155662", "GSM155663", "GSM155664", "GSM155665", "GSM155666", "GSM155667", "GSM155668", "GSM155669", "GSM155670", "GSM155671", "GSM155672", "GSM155673", "GSM155674", "GSM155675", "GSM155676", "GSM155677", "GSM155678", "GSM155679", "GSM155680", "GSM155681", "GSM155682", "GSM155683", "GSM155684", "GSM155685", "GSM155686", "GSM155687", "GSM155688", "GSM155689", "GSM155690", "GSM155691", "GSM155692", "GSM155693", "GSM155694", "GSM155695", "GSM155696", "GSM155697", "GSM155698", "GSM155699", "GSM155700", "GSM155701", "GSM155702", "GSM155703", "GSM155704", "GSM155705", "GSM155706", "GSM155707", "GSM155708", "GSM155709", "GSM155710", "GSM155711", "GSM155712", "GSM155713", "GSM155714", "GSM155715", "GSM155716", "GSM155717", "GSM155718", "GSM155719", "GSM155720", "GSM155721", "GSM155722", "GSM155723", "GSM155724", "GSM155725", "GSM155726", "GSM155727", "GSM155728"], "sample_count": 84, "group_sizes": null, "group_sizes_basis": null, "platform": "570", "taxon": "Homo sapiens", "title": "Gene Expression Profiles of HPV-Positive and -Negative Head/Neck and Cervical Cancers", "resolution_checked_at": "2026-11-01T15:39:55Z", "resolution_check": "identifier_resolution_only_no_download_no_licence_read", "downloaded": false, "licence_read": false}}, {"id": "asset:table:pmid:33262605:1", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:1a8d305c47fa2cb90a8fcac6d275e52418a9e17dd2cc2f9c8f2fb864f84601c2", "bytes": 601, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[10]/table-wrap[1]#t0001", "version": null, "note": "Sequences of Primers", "structure": {"pmcid": "PMC7695692", "section_index": 10, "section_title": "Real-Time qRT-PCR (RT-qPCR)", "row_count": 11, "column_count": 2}, "table": {"label": "Table 1", "caption": "Sequences of Primers", "rows": [["Primer Name", "Sequence (5ʹ-3ʹ)"], ["MIR155HG", "Forward: TGGAGATGGCTCTAATGGTGG"], ["Reverse: TCAGTTGGAGGCAAAAACCC"], ["SRSF1", "Forward: GCGACGGCTATGATTACGATG"], ["Reverse: ACATACATCACCTGCTTCACGC"], ["PTBP1", "Forward: ACCCTGTGACCCTGGATGT"], ["Reverse: TGTACTTGACGTTGAGGCTGGT"], ["IGF2BP2", "Forward: CAGACAATGGCGATGACCACT"], ["Reverse: AGTGACCTTCTCCCGGAACAC"], ["ACTIN:", "Forward: GTCCACCGCAAATGCTTCTA"], ["Reverse: TGCTGTCACCTTCACCGTTC"]], "row_count": 11, "column_count": 2, "numeric_cells": 2, "header_rows": 1, "locator": "section[10]/table-wrap[1]#t0001"}}], "gaps": ["asset:data:geo:GSE63514 not downloaded", "asset:data:geo:GSE63514 licence not read", "asset:data:geo:GSE6791 not downloaded", "asset:data:geo:GSE6791 licence not read"]}, "analysis": {"state": "complete", "methods": [{"id": "method-1", "family": "group_comparison", "specific": "anova", "label": "Group comparison", "dsl_operations": ["group_summary", "welch_t", "bootstrap_mean_difference", "group_comparison_anova"], "missing_operations": [], "expressible": true, "parameters": {}, "data_shapes": ["two_or_more_groups_continuous"], "evidence": {"score": 1.0, "band": "verbatim", "quote": "Statistical analysis was performed with one-way analysis of variance (ANOVA) and Tukey’s test using GraphPad prism version 6.0 (Graphpad Software, La Jolla, CA)."}}], "targets": [], "gaps": []}, "capability": {"state": "complete", "requirements": [{"capability_id": "capability:computational_analysis", "label": "Computational analysis platform", "assay_families": ["meta_analysis", "machine_learning", "survival_analysis", "statistical_regression", "pca", "molecular_docking", "network_analysis", "differential_expression", "gwas"], "availability_state": "owned", "tier_unlocked": "R1", "candidate": "Automated Assays Laravel application and simulated adapters"}], "gaps": []}, "readiness": {"state": "complete", "tier": "R1", "blocking_axis": "none", "blocked_on": "nothing:replicable_now", "axes": {"method": {"tier": "R1", "expressible": true, "required_operations": ["group_summary", "welch_t", "bootstrap_mean_difference", "group_comparison_anova"], "missing_operations": [], "basis": "The paper names the method it used and the corpus's method extractor maps it onto the DSL catalogue: anova."}, "capability": {"tier": "R1", "capability_id": "capability:computational_analysis", "availability_state": "owned", "basis": "The computational analysis is owned. The physical bench the paper used is not, so a physical validation cannot be run here."}, "data": {"tier": "R1", "reachable": true, "accessions": ["GSE6791", "GSE63514"], "resolved_accessions": ["GSE6791", "GSE63514"], "statements": ["The datasets used in this study are available from the corresponding author on reasonable request."], "basis": "The paper names GSE6791, GSE63514 in Gene Expression Omnibus (GEO) and the accession resolves in the repository. No dataset was downloaded and no licence was read."}}, "can_run": {"dsl_operations": ["group_summary", "welch_t", "bootstrap_mean_difference", "group_comparison_anova"], "assets": ["source:pmid:33262605", "data:geo:GSE63514", "asset:table:pmid:33262605:1"], "steps": ["run_analysis"]}, "must_build": {"dsl_operations": [], "converters": [], "readers": [], "capabilities": [], "data_gaps": ["data:geo:GSE63514"]}, "gaps": []}, "review": {"state": "partial", "machine_critique": {"kind": "extraction_review", "reader": {"model": "MiniMax-M3.1-Flash", "provider": "minimax", "provider_family": "minimax", "read_at": "2026-10-31T18:24:48Z", "independence": "single_reader"}, "evidence_check": {"method": "verbatim", "availability": "verbatim"}, "calls": 3, "usage": {"prompt_tokens": 24393, "completion_tokens": 1051, "cached_tokens": 792}}, "human_critique": null, "stages": [{"id": "extraction", "state": "complete", "reader": "MiniMax-M3.1-Flash", "provider": "minimax"}], "gaps": ["review.independent_reader", "review.machine_critique", "review.human_critique"]}, "execution": {"state": "absent", "status": "not_run", "mode": null, "runs": [], "gaps": ["execution.not_run"]}, "provenance": {"entities": [{"id": "pmid:33262605", "type": "paper", "label": "pmid:33262605"}, {"id": "source:pmid:33262605", "type": "manuscript", "label": "PMID 33262605 full text"}, {"id": "data:geo:GSE63514", "type": "dataset", "label": "GEO GSE63514"}], "activities": [{"id": "activity-reading-sci-2026-11-01", "type": "classification", "used": [{"id": "pmid:33262605", "type": "paper", "label": "pmid:33262605"}, {"id": "source:pmid:33262605", "type": "manuscript", "label": "PMID 33262605 full text"}, {"id": "data:geo:GSE63514", "type": "dataset", "label": "GEO GSE63514"}], "agent": "agent:corpus-assay-engine"}, {"id": "activity-read-33262605", "type": "extraction", "used": ["source:pmid:33262605"], "agent": "agent:minimax-reader"}, {"id": "activity-resolve-GSE63514", "type": "accession_resolution", "used": ["data:geo:GSE63514"], "agent": "agent:corpus-assay-engine"}], "agents": [{"id": "agent:corpus-assay-engine", "type": "software", "label": "Corpus assay engine"}, {"id": "agent:minimax-reader", "type": "software", "label": "MiniMax literature reader"}], "source_run_id": "reading-sci-2026-11-01", "dsl_catalogue_fingerprint": "343fb30756ba6ec3", "capability_table_fingerprint": "2cb3e42f047d2ecf", "snapshot_id": "ba34b49490d9bfaf"}, "lineage": {"parent_id": "pmid:33262605", "parent_hash": "sha256:0d70af5be92672c2ee6ab9938ebe77b3ad7f39304e47ed0f1b3b022c03292e4a", "fork_of": null, "generation": 7}, "gaps": ["asset:data:geo:GSE63514 licence not read", "asset:data:geo:GSE63514 not downloaded", "asset:data:geo:GSE6791 licence not read", "asset:data:geo:GSE6791 not downloaded", "execution.not_run", "review.human_critique", "review.independent_reader", "review.machine_critique"], "assays": [{"role": "data_generation", "definition_id": "transfection", "definition_version": "99e1195c7d6f", "definition_digest": null, "required_operations": [], "support_state": "partial", "source_hashes": {"assay_lexicon": "99e1195c7d6f"}, "confidence": 0.99, "evidence": ["MIR155HG Knockdown Inhibited the Progression of Cervical Cancer", "urther investigation. The effect of MIR155HG knockdown on proliferation, apoptosis and invasion in", "IR155HG. Furthermore, the effect of MIR155HG knockdown on tumor growth in vivo was investigated. RE", "ssue compared with adjacent cervical tissue. Knockdown of MIR155HG notably inhibited the proliferat"], "order_basis": "paper_text_order:0", "id": "assay:1"}, {"role": "data_generation", "definition_id": "animal_model", "definition_version": "99e1195c7d6f", "definition_digest": null, "required_operations": [], "support_state": "partial", "source_hashes": {"assay_lexicon": "99e1195c7d6f"}, "confidence": 0.99, "evidence": ["gical function of the DEIncRNAs in vitro and in vivo. METHODS: The expression profiles from two m", "effect of MIR155HG knockdown on tumor growth in vivo was investigated. RESULTS: The level of MIR1", "ignificantly inhibited by MIR155HG knockdown in vivo. Additionally, SRSF1 was identified as the b"], "order_basis": "paper_text_order:504", "id": "assay:2"}, {"role": "data_generation", "definition_id": "microarray", "definition_version": "99e1195c7d6f", "definition_digest": null, "required_operations": [], "support_state": "partial", "source_hashes": {"assay_lexicon": "99e1195c7d6f"}, "confidence": 0.93, "evidence": ["o. METHODS: The expression profiles from two microarray datasets (GSE6791 and GSE63514) were downloa"], "order_basis": "paper_text_order:555", "id": "assay:3"}, {"role": "data_generation", "definition_id": "apoptosis_assay", "definition_version": "99e1195c7d6f", "definition_digest": null, "required_operations": [], "support_state": "partial", "source_hashes": {"assay_lexicon": "99e1195c7d6f"}, "confidence": 0.93, "evidence": ["fect of MIR155HG knockdown on proliferation, apoptosis and invasion in SiHa and Hela cells were eva", "iferation of SiHa and Hela cells by inducing apoptosis. In addition, MIR155HG knockdown decreased c"], "order_basis": "paper_text_order:860", "id": "assay:4"}, {"role": "data_generation", "definition_id": "cell_culture", "definition_version": "99e1195c7d6f", "definition_digest": null, "required_operations": [], "support_state": "partial", "source_hashes": {"assay_lexicon": "99e1195c7d6f"}, "confidence": 0.99, "evidence": ["feration, apoptosis and invasion in SiHa and Hela cells were evaluated. In addition, Western b", "ably inhibited the proliferation of SiHa and Hela cells by inducing apoptosis. In addition, MI", "Materials and Methods Cell Culture SiHa and HeLa cells were obtained from American Type Cultu"], "order_basis": "paper_text_order:895", "id": "assay:5"}, {"role": "data_generation", "definition_id": "western_blot", "definition_version": "99e1195c7d6f", "definition_digest": null, "required_operations": [], "support_state": "partial", "source_hashes": {"assay_lexicon": "99e1195c7d6f"}, "confidence": 0.93, "evidence": ["and Hela cells were evaluated. In addition, Western blot, RNA immunoprecipitation (RIP) and cell cycl"], "order_basis": "paper_text_order:936", "id": "assay:6"}, {"role": "analysis", "definition_id": "group_comparison", "definition_version": "f2132e96ae6c7a4e", "definition_digest": null, "required_operations": ["group_summary", "welch_t", "bootstrap_mean_difference", "group_comparison_anova"], "support_state": "supported", "source_hashes": {"dsl_catalogue": "f2132e96ae6c7a4e"}, "confidence": 1.0, "evidence": ["Statistical analysis was performed with one-way analysis of variance (ANOVA) and Tukey’s test using GraphPad prism version 6.0 (Graphpad Software, La Jolla, CA)."], "order_basis": "consumes_earlier_output", "id": "assay:7"}]}