Constructing a 10-core genes panel for diagnosis of pediatric sepsis.

{"sci_version": "1.2", "schema": "https://corpus.bntrg.co.uk/sci/1.0/sci.schema.json", "id": "pmid:33274532", "kind": "science-record", "revision": 7, "content_hash": "sha256:b388a1479dfa10de2be7cf74a33694b80d8d11919fca1461baa64f6d9c88196b", "created_at": "2026-11-01T15:41:17Z", "updated_at": "2026-11-01T22:02:39Z", "generator": {"name": "corpus-assay-engine", "run_id": "reading-sci-2026-11-01"}, "paper": {"state": "complete", "title": "Constructing a 10-core genes panel for diagnosis of pediatric sepsis.", "doi": "10.1002/jcla.23680", "pmid": "33274532", "authors": ["Xiaojie Zhou", "Yumin Wang", "Jie Chen", "Jingye Pan"], "journal": "Journal of clinical laboratory analysis", "year": 2021, "abstract": "BACKGROUND: The lack of sensitivity and specificity of most biomarkers or the lack of relevant studies to demonstrate their effectiveness in sepsis.\nMETHODS: Downloaded three sets of sepsis expression data (GSE13904, GSE25504, GSE26440) from GEO. Then, using the R limma package and WGCNA analysis tocore genes. Finally, the value of these core genes was confirmed by clinical samples.\nRESULTS: Compared to normal samples, we obtain many abnormally expressed genes in the pediatric sepsis. WGCNA co-expression analysis showed that genes from blue and turquoise module were close correlation with pediatric sepsis. The top 20 genes (TIMP2, FLOT1, HCK, NCF4, SERPINA1, IL17RA, PGD, PRKCD, GLT1D1, ALOX5, SIRPA, DOK3, ITGAM, S100A11, ZNF438, PLIN3, LTB4R, TSPO, MAPK14, GAS7) of the blue module of pediatric sepsis were mainly enriched in neutrophil degranulation, etc The top 20 genes (TBC1D4, NOL11, NLRC3, ZNF121, DYRK2, ABCE1, MAGEH1, TMEM263, MCUB, MALT1, DDHD2, TRAC, NOC3L, LCK, TRMT61B, ZNF260, ENOPH1, LOC93622, NAE1, TRBC1) for turquoise module were mainly enriched in rRNA-containing ribonucleoprotein complexes exported from the nucleus, etc The selected hub gene of pediatric sepsis was combined with the markers of cell surface and found 10 core genes (HCK, PRKCD, SIRPA, DOK3, ITGAM, LTB4R, MAPK14, MALT1, NLRC3, LCK). ROC showed that AUC of the 10 core genes for diagnosis of pediatric sepsis was above 0.9.\nCONCLUSION: There were many abnormally expressed genes in patients with pediatric sepsis. The panel constructed by the 10 core genes was expected to become a biomarker panel for clinical application of pediatric sepsis.", "claims": [{"id": "claim-method", "statement": "The receiver operating characteristic (ROC) curve was then used to estimate the classification performance.", "kind": "methodological", "target": null, "evidence": [{"asset": "source:pmid:33274532", "locator": "sections[7] \"Statistical analysis\" paragraph 2", "quote": "The receiver operating characteristic (ROC) curve was then used to estimate the classification performance."}], "state": "complete"}, {"id": "claim-data-access", "statement": "The data that support the findings of this study are available in GEO database: GSE13904 (GPL570 platform), GSE25504 (GPL570, GPL6947, GPL13667 platform), GSE26440 (GPL570 platform) and these data were derived from the GEO database.", "kind": "methodological", "target": null, "evidence": [{"asset": "source:pmid:33274532", "locator": "sections[24] \"DATA AVAILABILITY STATEMENT\" paragraph 2", "quote": "The data that support the findings of this study are available in GEO database: GSE13904 (GPL570 platform), GSE25504 (GPL570, GPL6947, GPL13667 platform), GSE26440 (GPL570 platform) and these data were derived from the GEO database."}], "state": "complete"}], "gaps": []}, "experiment": {"state": "complete", "objective": null, "steps": [{"id": "read_published_estimate", "order": 1, "name": "Read the published estimate from the source", "kind": "other", "state": "complete", "blocked_on": null, "description": "The claim, method and evidence span published with the source article.", "duration_hours": null, "parameters": {}, "inputs": ["source:pmid:33274532"], "outputs": ["the published estimate and its evidence"], "instruments": [], "reagents": []}, {"id": "obtain_source_data", "order": 2, "name": "Obtain the source data from the named repository", "kind": "data-preparation", "state": "complete", "blocked_on": null, "description": "The GEO series accession resolves and its sample accessions are listed. This lane did not download the dataset or read its licence.", "duration_hours": null, "parameters": {}, "inputs": ["data:geo:GSE13904"], "outputs": ["the source data with its repository provenance"], "instruments": [], "reagents": []}, {"id": "run_analysis", "order": 3, "name": "Run the published analysis", "kind": "analysis", "state": "complete", "blocked_on": null, "description": "Apply the paper's statistical method to the resolved series and compare the result with the published target.", "duration_hours": null, "parameters": {}, "inputs": ["data:geo:GSE13904"], "outputs": ["the replicated result and its comparison"], "instruments": [], "reagents": []}], "materials": [], "instruments": [], "reagents": [], "conditions": {}, "gaps": []}, "data": {"state": "partial", "assets": [{"id": "source:pmid:33274532", "role": "manuscript", "format": "xml", "media_type": "application/xml", "uri": "https://doi.org/10.1002/jcla.23680", "sha256": "sha256:08244abae1891864b8c94c08556d0bdef6fb3c358a9f6422aed383eb30c07b50", "bytes": 25345, "access": "open", "state": "resolved", "reader": null, "reader_status": "reader_required", "identifier": "10.1002/jcla.23680", "version": null, "note": "Full article fetched from PMC; the checksum covers the rendered section body, not the original XML bytes.", "structure": {"pmcid": "PMC7958006", "source": "europe_pmc_fulltext", "coverage": "whole_body", "text_hash_scope": "rendered_section_body"}}, {"id": "data:geo:GSE13904", "role": "raw", "format": "geo-series", "media_type": "application/vnd.ncbi.geo-series+json", "uri": "https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE13904", "sha256": null, "bytes": null, "access": "open", "state": "resolved", "reader": null, "reader_status": "reader_required", "identifier": "GSE13904", "version": null, "note": "The data that support the findings of this study are available in GEO database: GSE13904 (GPL570 platform), GSE25504 (GPL570, GPL6947, GPL13667 platform), GSE26440 (GPL570 platform) and these data were derived from the GEO database.", "structure": {"repository": "GEO", "access_route": "GEO accession URL", "access_statement_verbatim": "The data that support the findings of this study are available in GEO database: GSE13904 (GPL570 platform), GSE25504 (GPL570, GPL6947, GPL13667 platform), GSE26440 (GPL570 platform) and these data were derived from the GEO database.", "access_statement_kind": "data_availability_statement", "sample_accessions": ["GSM350139", "GSM350140", "GSM350141", "GSM350142", "GSM350143", "GSM350144", "GSM350145", "GSM350146", "GSM350147", "GSM350148", "GSM350149", "GSM350150", "GSM350151", "GSM350152", "GSM350153", "GSM350154", "GSM350155", "GSM350156", "GSM350157", "GSM350158", "GSM350159", "GSM350160", "GSM350161", "GSM350162", "GSM350163", "GSM350164", "GSM350165", "GSM350166", "GSM350167", "GSM350168", "GSM350169", "GSM350170", "GSM350171", "GSM350172", "GSM350173", "GSM350174", "GSM350175", "GSM350176", "GSM350177", "GSM350178", "GSM350179", "GSM350180", "GSM350181", "GSM350182", "GSM350183", "GSM350184", "GSM350185", "GSM350186", "GSM350187", "GSM350188", "GSM350189", "GSM350190", "GSM350191", "GSM350192", "GSM350193", "GSM350194", "GSM350195", "GSM350196", "GSM350197", "GSM350198", "GSM350199", "GSM350200", "GSM350201", "GSM350202", "GSM350203", "GSM350204", "GSM350205", "GSM350206", "GSM350207", "GSM350208", "GSM350209", "GSM350210", "GSM350211", "GSM350212", "GSM350213", "GSM350214", "GSM350215", "GSM350216", "GSM350217", "GSM350218", "GSM350219", "GSM350220", "GSM350221", "GSM350222", "GSM350223", "GSM350224", "GSM350225", "GSM350226", "GSM350227", "GSM350228", "GSM350229", "GSM350230", "GSM350231", "GSM350232", "GSM350233", "GSM350234", "GSM350235", "GSM350236", "GSM350237", "GSM350238", "GSM350239", "GSM350240", "GSM350241", "GSM350242", "GSM350243", "GSM350244", "GSM350245", "GSM350246", "GSM350247", "GSM350248", "GSM350249", "GSM350250", "GSM350251", "GSM350252", "GSM350253", "GSM350254", "GSM350255", "GSM350256", "GSM350257", "GSM350258", "GSM350259", "GSM350260", "GSM350261", "GSM350262", "GSM350263", "GSM350264", "GSM350265", "GSM350266", "GSM350267", "GSM350268", "GSM350269", "GSM350270", "GSM350271", "GSM350272", "GSM350273", "GSM350274", "GSM350275", "GSM350276", "GSM350277", "GSM350278", "GSM350279", "GSM350280", "GSM350281", "GSM350282", "GSM350283", "GSM350284", "GSM350285", "GSM350286", "GSM350287", "GSM350288", "GSM350289", "GSM350290", "GSM350291", "GSM350292", "GSM350293", "GSM350294", "GSM350295", "GSM350296", "GSM350297", "GSM350298", "GSM350299", "GSM350300", "GSM350301", "GSM350302", "GSM350303", "GSM350304", "GSM350305", "GSM350306", "GSM350307", "GSM350308", "GSM350309", "GSM350310", "GSM350311", "GSM350312", "GSM350313", "GSM350314", "GSM350315", "GSM350316", "GSM350317", "GSM350318", "GSM350319", "GSM350320", "GSM350321", "GSM350322", "GSM350323", "GSM350324", "GSM350325", "GSM350326", "GSM350327", "GSM350328", "GSM350329", "GSM350330", "GSM350331", "GSM350332", "GSM350333", "GSM350334", "GSM350335", "GSM350336", "GSM350337", "GSM350338", "GSM350339", "GSM350340", "GSM350341", "GSM350342", "GSM350343", "GSM350344", "GSM350345", "GSM350346", "GSM350347", "GSM350348", "GSM350349", "GSM350350", "GSM350351", "GSM350352", "GSM350353", "GSM350354", "GSM350355", "GSM350356", "GSM350357", "GSM350358", "GSM350359", "GSM350360", "GSM350361", "GSM350362", "GSM350363", "GSM350364", "GSM350365"], "sample_count": 227, "group_sizes": null, "group_sizes_basis": null, "platform": "570", "taxon": "Homo sapiens", "title": "Expression profiling across the pediatric systemic inflammatory response syndrome, sepsis, and septic shock spectrum", "resolution_checked_at": "2026-11-01T15:39:54Z", "resolution_check": "identifier_resolution_only_no_download_no_licence_read", "downloaded": false, "licence_read": false}}, {"id": "data:geo:GSE25504", "role": "raw", "format": "geo-series", "media_type": "application/vnd.ncbi.geo-series+json", "uri": "https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE25504", "sha256": null, "bytes": null, "access": "open", "state": "resolved", "reader": null, "reader_status": "reader_required", "identifier": "GSE25504", "version": null, "note": "The data that support the findings of this study are available in GEO database: GSE13904 (GPL570 platform), GSE25504 (GPL570, GPL6947, GPL13667 platform), GSE26440 (GPL570 platform) and these data were derived from the GEO database.", "structure": {"repository": "GEO", "access_route": "GEO accession URL", "access_statement_verbatim": "The data that support the findings of this study are available in GEO database: GSE13904 (GPL570 platform), GSE25504 (GPL570, GPL6947, GPL13667 platform), GSE26440 (GPL570 platform) and these data were derived from the GEO database.", "access_statement_kind": "data_availability_statement", "sample_accessions": ["GSM1404208", "GSM1404209", "GSM1404210", "GSM1404211", "GSM1404212", "GSM1404213", "GSM1404214", "GSM1404215", "GSM1404216", "GSM1404217", "GSM1404218", "GSM1404219", "GSM1404220", "GSM1404221", "GSM1404222", "GSM1404223", "GSM1404224", "GSM1404225", "GSM1404226", "GSM1404227", "GSM1404228", "GSM1404229", "GSM1404230", "GSM1404231", "GSM1404232", "GSM1404233", "GSM1404234", "GSM1404235", "GSM1404236", "GSM1404237", "GSM1404238", "GSM1404239", "GSM1404240", "GSM1404241", "GSM1404242", "GSM1404243", "GSM1404244", "GSM1404245", "GSM1404246", "GSM1404247", "GSM1404248", "GSM1404249", "GSM1404250", "GSM1404251", "GSM1404252", "GSM1404253", "GSM1404254", "GSM1404255", "GSM1404256", "GSM1404257", "GSM1404258", "GSM1404259", "GSM1404260", "GSM1404261", "GSM1404262", "GSM1404263", "GSM1404264", "GSM1404265", "GSM1404266", "GSM1404267", "GSM1404268", "GSM1404269", "GSM1404270", "GSM1404271", "GSM1404272", "GSM1404273", "GSM1404274", "GSM1404275", "GSM1404276", "GSM1404277", "GSM1404278", "GSM1404279", "GSM1404280", "GSM1404281", "GSM1404282", "GSM1404283", "GSM1404284", "GSM1404285", "GSM1404286", "GSM1404287", "GSM1404288", "GSM1404289", "GSM1404290", "GSM1404291", "GSM1404292", "GSM1404293", "GSM1404294", "GSM1404295", "GSM1404296", "GSM1404297", "GSM1404298", "GSM1404299", "GSM1404300", "GSM1404301", "GSM1404302", "GSM1404303", "GSM1404304", "GSM1404305", "GSM1404306", "GSM1404307", "GSM1404308", "GSM1404309", "GSM1404310", "GSM1404311", "GSM1404312", "GSM1404313", "GSM1404314", "GSM627008", "GSM627009", "GSM627010", "GSM627011", "GSM627012", "GSM627013", "GSM627014", "GSM627015", "GSM627016", "GSM627017", "GSM627018", "GSM627019", "GSM627020", "GSM627021", "GSM627022", "GSM627023", "GSM627024", "GSM627025", "GSM627026", "GSM627027", "GSM627028", "GSM627029", "GSM627030", "GSM627031", "GSM627032", "GSM627033", "GSM627034", "GSM627035", "GSM627036", "GSM627037", "GSM627038", "GSM627039", "GSM627040", "GSM627041", "GSM627042", "GSM627043", "GSM627044", "GSM627045", "GSM627046", "GSM627047", "GSM627048", "GSM627049", "GSM627050", "GSM627051", "GSM627052", "GSM627053", "GSM627054", "GSM627055", "GSM627056", "GSM627057", "GSM627058", "GSM627059", "GSM627060", "GSM627061", "GSM627062", "GSM627063", "GSM627064", "GSM627065", "GSM627066", "GSM627067", "GSM627068", "GSM627069", "GSM627070"], "sample_count": 170, "group_sizes": null, "group_sizes_basis": null, "platform": "15158;570;6947;13667", "taxon": "Homo sapiens", "title": "Whole blood mRNA expression profiling of host molecular networks in neonatal sepsis", "resolution_checked_at": "2026-11-01T15:39:54Z", "resolution_check": "identifier_resolution_only_no_download_no_licence_read", "downloaded": false, "licence_read": false}}, {"id": "data:geo:GSE26440", "role": "raw", "format": "geo-series", "media_type": "application/vnd.ncbi.geo-series+json", "uri": "https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE26440", "sha256": null, "bytes": null, "access": "open", "state": "resolved", "reader": null, "reader_status": "reader_required", "identifier": "GSE26440", "version": null, "note": "The data that support the findings of this study are available in GEO database: GSE13904 (GPL570 platform), GSE25504 (GPL570, GPL6947, GPL13667 platform), GSE26440 (GPL570 platform) and these data were derived from the GEO database.", "structure": {"repository": "GEO", "access_route": "GEO accession URL", "access_statement_verbatim": "The data that support the findings of this study are available in GEO database: GSE13904 (GPL570 platform), GSE25504 (GPL570, GPL6947, GPL13667 platform), GSE26440 (GPL570 platform) and these data were derived from the GEO database.", "access_statement_kind": "data_availability_statement", "sample_accessions": ["GSM648590", "GSM648591", "GSM648592", "GSM648593", "GSM648594", "GSM648595", "GSM648596", "GSM648597", "GSM648598", "GSM648599", "GSM648600", "GSM648601", "GSM648602", "GSM648603", "GSM648604", "GSM648605", "GSM648606", "GSM648607", "GSM648608", "GSM648609", "GSM648610", "GSM648611", "GSM648612", "GSM648613", "GSM648614", "GSM648615", "GSM648616", "GSM648617", "GSM648618", "GSM648619", "GSM648620", "GSM648621", "GSM648622", "GSM648623", "GSM648624", "GSM648625", "GSM648626", "GSM648627", "GSM648628", "GSM648629", "GSM648630", "GSM648631", "GSM648632", "GSM648633", "GSM648634", "GSM648635", "GSM648636", "GSM648637", "GSM648638", "GSM648639", "GSM648640", "GSM648641", "GSM648642", "GSM648643", "GSM648644", "GSM648645", "GSM648646", "GSM648647", "GSM648648", "GSM648649", "GSM648650", "GSM648651", "GSM648652", "GSM648653", "GSM648654", "GSM648655", "GSM648656", "GSM648657", "GSM648658", "GSM648659", "GSM648660", "GSM648661", "GSM648662", "GSM648663", "GSM648664", "GSM648665", "GSM648666", "GSM648667", "GSM648668", "GSM648669", "GSM648670", "GSM648671", "GSM648672", "GSM648673", "GSM648674", "GSM648675", "GSM648676", "GSM648677", "GSM648678", "GSM648679", "GSM648680", "GSM648681", "GSM648682", "GSM648683", "GSM648684", "GSM648685", "GSM648686", "GSM648687", "GSM648688", "GSM648689", "GSM648690", "GSM648691", "GSM648692", "GSM648693", "GSM648694", "GSM648695", "GSM648696", "GSM648697", "GSM648698", "GSM648699", "GSM648700", "GSM648701", "GSM648702", "GSM648703", "GSM648704", "GSM648705", "GSM648706", "GSM648707", "GSM648708", "GSM648709", "GSM648710", "GSM648711", "GSM648712", "GSM648713", "GSM648714", "GSM648715", "GSM648716", "GSM648717", "GSM648718", "GSM648719"], "sample_count": 130, "group_sizes": null, "group_sizes_basis": null, "platform": "570", "taxon": "Homo sapiens", "title": "Expression data for derivation of septic shock subgroups", "resolution_checked_at": "2026-11-01T15:39:54Z", "resolution_check": "identifier_resolution_only_no_download_no_licence_read", "downloaded": false, "licence_read": false}}, {"id": "asset:table:pmid:33274532:1", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:399daecfefd8000d8568c47fbda4f64c8ec923d9c6c85cdd90bf977d59fc4293", "bytes": 958, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[6]/table-wrap[1]#jcla23680-tbl-0001", "version": null, "note": "Primer sequence of core genes", "structure": {"pmcid": "PMC7958006", "section_index": 6, "section_title": "qPCR detected the 10 core genes in sepsis", "row_count": 12, "column_count": 4}, "table": {"label": "Table 1", "caption": "Primer sequence of core genes", "rows": [["Gene name", "Sense 5′‐3′", "Antisense 5′‐3′", "Product length (bp)"], ["HCK", "GCAACACACCAGGAATCAGG", "CCCGGATTCCTCTAGGACCA", "134"], ["PRKCD", "TGGTGGTTGGTGCGTTGTAG", "TTTTCCCACGCTCTGTGCT", "214"], ["SIRPA", "AAATACCGCCGCTGAGAACA", "TGTGATATCATTTGTGTCCTGTGT", "200"], ["DOK3", "CAGCACAGTGGTCTTGAAGC", "CTGATGGGCCTCCTGCATAC", "160"], ["ITGAM", "TAACATCACCAACGGAGCCC", "CTCCCACCCCAATGACGTAG", "149"], ["LTB4R", "CTCTACGTCTTCACCGCTGG", "GGAGGACCTCTGGAGGGTG", "189"], ["MAPK14", "CAGCTTCAGCAGATTATGCGTC", "AGTCGACAGCCAGGGGATTG", "160"], ["MALT1", "AGTGGAGTGCACTGAAGATGAA", "AAGGAGCTTTGAGCTTGGGG", "146"], ["NLRC3", "AGGATCTCACAATCTCAGGGAC", "TCATCCCTAACGGTGTTGCC", "202"], ["LCK", "AGATCAGCTTGGCGGAGAAC", "CACCTCAGAGCCATTTCGGA", "155"], ["B‐actin", "ACAGAGCCTCGCCTTTGC", "CCACCATCACGCCCTGG", "191"]], "row_count": 12, "column_count": 4, "numeric_cells": 14, "header_rows": 1, "locator": "section[6]/table-wrap[1]#jcla23680-tbl-0001"}}, {"id": "asset:table:pmid:33274532:2", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:2a57e3d9e06549a10535d3ced85ffe27a82f16b93c9b68e6791d77d92c7320cd", "bytes": 419, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[15]/table-wrap[1]#jcla23680-tbl-0002", "version": null, "note": "The AUC, cutoff value, sensitivity, and specificity of parameters for the diagnosis of sepsis", "structure": {"pmcid": "PMC7958006", "section_index": 15, "section_title": "The result of clinical sample verification", "row_count": 2, "column_count": 6}, "table": {"label": "Table 2", "caption": "The AUC, cutoff value, sensitivity, and specificity of parameters for the diagnosis of sepsis", "rows": [["Parameters", "AUC", "95% confidence Interval", "Cutoff", "Sensitivity (%)", "Specificity (%)"], ["10 core genes panel", "0.936", "0.904–0.968", "14.363", "96.6", "58.7"]], "row_count": 2, "column_count": 6, "numeric_cells": 7, "header_rows": 1, "locator": "section[15]/table-wrap[1]#jcla23680-tbl-0002"}}], "gaps": ["asset:data:geo:GSE13904 not downloaded", "asset:data:geo:GSE13904 licence not read", "asset:data:geo:GSE25504 not downloaded", "asset:data:geo:GSE25504 licence not read", "asset:data:geo:GSE26440 not downloaded", "asset:data:geo:GSE26440 licence not read"]}, "analysis": {"state": "partial", "methods": [{"id": "method-1", "family": "group_comparison", "specific": "anova", "label": "Group comparison", "dsl_operations": ["group_summary", "welch_t", "bootstrap_mean_difference", "group_comparison_anova"], "missing_operations": [], "expressible": true, "parameters": {}, "data_shapes": ["two_or_more_groups_continuous"], "evidence": {"score": 0.8, "band": "high", "quote": "analysis of variance"}}, {"id": "method-2", "family": "differential_expression", "specific": "limma_voom", "label": "Differential expression analysis", "dsl_operations": ["normalise_counts", "differential_expression_fit", "fdr_bh"], "missing_operations": [], "expressible": true, "parameters": {}, "data_shapes": ["count_matrix_with_condition"], "evidence": {"score": 0.7, "band": "medium", "quote": "limma"}}, {"id": "method-3", "family": "network_analysis", "specific": "pathway_enrichment", "label": "Network / pathway analysis", "dsl_operations": ["pathway_enrich"], "missing_operations": [], "expressible": true, "parameters": {}, "data_shapes": ["edge_list"], "evidence": {"score": 0.8, "band": "high", "quote": "pathway enrichment"}}, {"id": "method-4", "family": "diagnostic_evaluation", "specific": "roc", "label": "Diagnostic test evaluation", "dsl_operations": ["confusion_counts", "roc_curve", "sensitivity_specificity", "solve_confusion_matrix", "classification_metrics", "published_precision_envelope"], "missing_operations": [], "expressible": true, "parameters": {}, "data_shapes": ["reference_standard_and_test"], "evidence": {"score": 0.8, "band": "high", "quote": "ROC curve"}}, {"id": "method-5", "family": null, "specific": null, "label": "Receiver operating characteristic (ROC) curve analysis", "dsl_operations": [], "missing_operations": [], "expressible": null, "parameters": {}, "data_shapes": [], "evidence": {"score": 1.0, "band": "verbatim", "quote": "The receiver operating characteristic (ROC) curve was then used to estimate the classification performance."}}], "targets": [], "gaps": ["method.reader_named_unmapped"]}, "capability": {"state": "complete", "requirements": [{"capability_id": "capability:computational_analysis", "label": "Computational analysis platform", "assay_families": ["meta_analysis", "machine_learning", "survival_analysis", "statistical_regression", "pca", "molecular_docking", "network_analysis", "differential_expression", "gwas"], "availability_state": "owned", "tier_unlocked": "R1", "candidate": "Automated Assays Laravel application and simulated adapters"}], "gaps": []}, "readiness": {"state": "complete", "tier": "R1", "blocking_axis": "none", "blocked_on": "nothing:replicable_now", "axes": {"method": {"tier": "R1", "expressible": true, "required_operations": ["group_summary", "welch_t", "bootstrap_mean_difference", "group_comparison_anova"], "missing_operations": [], "basis": "The paper names the method it used and the corpus's method extractor maps it onto the DSL catalogue: anova."}, "capability": {"tier": "R1", "capability_id": "capability:computational_analysis", "availability_state": "owned", "basis": "The computational analysis is owned. The physical bench the paper used is not, so a physical validation cannot be run here."}, "data": {"tier": "R1", "reachable": true, "accessions": ["GSE13904", "GSE25504", "GSE26440"], "resolved_accessions": ["GSE13904", "GSE25504", "GSE26440"], "statements": ["The data that support the findings of this study are available in GEO database: GSE13904 (GPL570 platform), GSE25504 (GPL570, GPL6947, GPL13667 platform), GSE26440 (GPL570 platform) and these data were derived from the GEO database."], "basis": "The paper names GSE13904, GSE25504, GSE26440 in GEO database and the accession resolves in the repository. No dataset was downloaded and no licence was read."}}, "can_run": {"dsl_operations": ["group_summary", "welch_t", "bootstrap_mean_difference", "group_comparison_anova"], "assets": ["source:pmid:33274532", "data:geo:GSE13904", "asset:table:pmid:33274532:1", "asset:table:pmid:33274532:2"], "steps": ["run_analysis"]}, "must_build": {"dsl_operations": [], "converters": [], "readers": [], "capabilities": [], "data_gaps": ["data:geo:GSE13904"]}, "gaps": []}, "review": {"state": "partial", "machine_critique": {"kind": "extraction_review", "reader": {"model": "MiniMax-M3.1-Flash", "provider": "minimax", "provider_family": "minimax", "read_at": "2026-10-31T18:24:42Z", "independence": "single_reader"}, "evidence_check": {"method": "verbatim", "availability": "verbatim"}, "calls": 3, "usage": {"prompt_tokens": 20278, "completion_tokens": 1181, "cached_tokens": 792}}, "human_critique": null, "stages": [{"id": "extraction", "state": "complete", "reader": "MiniMax-M3.1-Flash", "provider": "minimax"}], "gaps": ["review.independent_reader", "review.machine_critique", "review.human_critique"]}, "execution": {"state": "absent", "status": "not_run", "mode": null, "runs": [], "gaps": ["execution.not_run"]}, "provenance": {"entities": [{"id": "pmid:33274532", "type": "paper", "label": "pmid:33274532"}, {"id": "source:pmid:33274532", "type": "manuscript", "label": "PMID 33274532 full text"}, {"id": "data:geo:GSE13904", "type": "dataset", "label": "GEO GSE13904"}], "activities": [{"id": "activity-reading-sci-2026-11-01", "type": "classification", "used": [{"id": "pmid:33274532", "type": "paper", "label": "pmid:33274532"}, {"id": "source:pmid:33274532", "type": "manuscript", "label": "PMID 33274532 full text"}, {"id": "data:geo:GSE13904", "type": "dataset", "label": "GEO GSE13904"}], "agent": "agent:corpus-assay-engine"}, {"id": "activity-read-33274532", "type": "extraction", "used": ["source:pmid:33274532"], "agent": "agent:minimax-reader"}, {"id": "activity-resolve-GSE13904", "type": "accession_resolution", "used": ["data:geo:GSE13904"], "agent": "agent:corpus-assay-engine"}], "agents": [{"id": "agent:corpus-assay-engine", "type": "software", "label": "Corpus assay engine"}, {"id": "agent:minimax-reader", "type": "software", "label": "MiniMax literature reader"}], "source_run_id": "reading-sci-2026-11-01", "dsl_catalogue_fingerprint": "343fb30756ba6ec3", "capability_table_fingerprint": "2cb3e42f047d2ecf", "snapshot_id": "ba34b49490d9bfaf"}, "lineage": {"parent_id": "pmid:33274532", "parent_hash": "sha256:49519e5ca531c0d1a313fd9711b3931faa87b5b4aab2424bc21a0a692e66795e", "fork_of": null, "generation": 6}, "gaps": ["asset:data:geo:GSE13904 licence not read", "asset:data:geo:GSE13904 not downloaded", "asset:data:geo:GSE25504 licence not read", "asset:data:geo:GSE25504 not downloaded", "asset:data:geo:GSE26440 licence not read", "asset:data:geo:GSE26440 not downloaded", "execution.not_run", "method.reader_named_unmapped", "review.human_critique", "review.independent_reader", "review.machine_critique"], "assays": [{"role": "analysis", "definition_id": "group_comparison", "definition_version": "f2132e96ae6c7a4e", "definition_digest": null, "required_operations": ["group_summary", "welch_t", "bootstrap_mean_difference", "group_comparison_anova"], "support_state": "supported", "source_hashes": {"dsl_catalogue": "f2132e96ae6c7a4e"}, "confidence": 0.8, "evidence": ["analysis of variance"], "order_basis": "analysis_only", "id": "assay:1"}]}