β-catenin regulates FOXP2 transcriptional activity via multiple binding sites.

{"sci_version": "1.2", "schema": "https://corpus.bntrg.co.uk/sci/1.0/sci.schema.json", "id": "pmid:33284517", "kind": "science-record", "revision": 8, "content_hash": "sha256:b3aee25cf1b771110823926e2d5ce1819ae05b79ccd0e507b9945771405ca449", "created_at": "2026-11-01T15:41:18Z", "updated_at": "2026-11-01T22:45:44Z", "generator": {"name": "corpus-assay-engine", "run_id": "reading-sci-2026-11-01"}, "paper": {"state": "complete", "title": "β-catenin regulates FOXP2 transcriptional activity via multiple binding sites.", "doi": "10.1111/febs.15656", "pmid": "33284517", "authors": ["Gesa Richter", "Tianshu Gui", "Benjamin Bourgeois", "Chintan N Koyani", "Peter Ulz", "Ellen Heitzer", "Dirk von Lewinski", "Boudewijn M T Burgering", "Ernst Malle", "Tobias Madl"], "journal": "The FEBS journal", "year": 2021, "abstract": "The transcription factor forkhead box protein P2 (FOXP2) is a highly conserved key regulator of embryonal development. The molecular mechanisms of how FOXP2 regulates embryonal development, however, remain elusive. Using RNA sequencing, we identified the Wnt signaling pathway as key target of FOXP2-dependent transcriptional regulation. Using cell-based assays, we show that FOXP2 transcriptional activity is regulated by the Wnt coregulator β-catenin and that β-catenin contacts multiple regions within FOXP2. Using nuclear magnetic resonance spectroscopy, we uncovered the molecular details of these interactions. β-catenin contacts a disordered FOXP2 region with α-helical propensity via its folded armadillo domain, whereas the intrinsically disordered β-catenin N terminus and C terminus bind to the conserved FOXP2 DNA-binding domain. Using RNA sequencing, we confirmed that β-catenin indeed regulates transcriptional activity of FOXP2 and that the FOXP2 α-helical motif acts as a key regulatory element of FOXP2 transcriptional activity. Taken together, our findings provide first insight into novel regulatory interactions and help to understand the intricate mechanisms of FOXP2 function and (mis)-regulation in embryonal development and human diseases. DATABASE: Expression data are available in the GEO database under the accession number GSE138938.", "claims": [{"id": "claim-method", "statement": "Gene read counts are generated using featurecounts [64], and differential expression was analyzed using deseq2 [65].", "kind": "methodological", "target": null, "evidence": [{"asset": "source:pmid:33284517", "locator": "sections[16] \"RNA isolation and RNA‐Seq\" paragraph 2", "quote": "Gene read counts are generated using featurecounts [64], and differential expression was analyzed using deseq2 [65]."}], "state": "complete"}, {"id": "claim-data-access", "statement": "Expression data are available in the GEO database under the accession number GSE138938.", "kind": "methodological", "target": null, "evidence": [{"asset": "source:pmid:33284517", "locator": "sections[0] \"Abstract\" paragraph 3", "quote": "Expression data are available in the GEO database under the accession number GSE138938."}], "state": "complete"}], "gaps": []}, "experiment": {"state": "complete", "objective": null, "steps": [{"id": "read_published_estimate", "order": 1, "name": "Read the published estimate from the source", "kind": "other", "state": "complete", "blocked_on": null, "description": "The claim, method and evidence span published with the source article.", "duration_hours": null, "parameters": {}, "inputs": ["source:pmid:33284517"], "outputs": ["the published estimate and its evidence"], "instruments": [], "reagents": []}, {"id": "obtain_source_data", "order": 2, "name": "Obtain the source data from the named repository", "kind": "data-preparation", "state": "complete", "blocked_on": null, "description": "The GEO series accession resolves and its sample accessions are listed. This lane did not download the dataset or read its licence.", "duration_hours": null, "parameters": {}, "inputs": ["data:geo:GSE138938"], "outputs": ["the source data with its repository provenance"], "instruments": [], "reagents": []}, {"id": "run_analysis", "order": 3, "name": "Run the published analysis", "kind": "analysis", "state": "complete", "blocked_on": null, "description": "Apply the paper's statistical method to the resolved series and compare the result with the published target.", "duration_hours": null, "parameters": {}, "inputs": ["data:geo:GSE138938"], "outputs": ["the replicated result and its comparison"], "instruments": [], "reagents": []}], "materials": [], "instruments": [], "reagents": [], "conditions": {}, "gaps": []}, "data": {"state": "partial", "assets": [{"id": "source:pmid:33284517", "role": "manuscript", "format": "xml", "media_type": "application/xml", "uri": "https://doi.org/10.1111/febs.15656", "sha256": "sha256:01be49a915b3663a8ab30e192177f8d57aaaf8ab8ab26d6286dacbbf52239565", "bytes": 58029, "access": "open", "state": "resolved", "reader": null, "reader_status": "reader_required", "identifier": "10.1111/febs.15656", "version": null, "note": "Full article fetched from PMC; the checksum covers the rendered section body, not the original XML bytes.", "structure": {"pmcid": "PMC8246981", "source": "europe_pmc_fulltext", "coverage": "whole_body_without_references", "text_hash_scope": "rendered_section_body"}}, {"id": "data:geo:GSE138938", "role": "raw", "format": "geo-series", "media_type": "application/vnd.ncbi.geo-series+json", "uri": "https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE138938", "sha256": null, "bytes": null, "access": "open", "state": "resolved", "reader": null, "reader_status": "reader_required", "identifier": "GSE138938", "version": null, "note": "Expression data are available in the GEO database under the accession number GSE138938.", "structure": {"repository": "GEO", "access_route": "GEO accession URL", "access_statement_verbatim": "Expression data are available in the GEO database under the accession number GSE138938.", "access_statement_kind": "data_availability_statement", "sample_accessions": ["GSM4123907", "GSM4123908", "GSM4123909", "GSM4123910", "GSM4123911", "GSM4123912", "GSM4123913", "GSM4123914", "GSM4123915", "GSM4123916", "GSM4123917", "GSM4123918", "GSM4123919", "GSM4123920", "GSM4123921", "GSM4123922", "GSM4123923", "GSM4123924", "GSM4123925", "GSM4123926", "GSM4123927", "GSM4123928", "GSM4123929", "GSM4123930", "GSM4123931", "GSM4123932", "GSM4123933", "GSM4123934", "GSM4123935", "GSM4123936"], "sample_count": 30, "group_sizes": null, "group_sizes_basis": null, "platform": "21697", "taxon": "Homo sapiens", "title": "β-catenin regulates FOXP2 transcriptional activity via multiple binding sites", "resolution_checked_at": "2026-11-01T15:39:54Z", "resolution_check": "identifier_resolution_only_no_download_no_licence_read", "downloaded": false, "licence_read": false}}, {"id": "asset:table:pmid:33284517:1", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:b115d8b15f98041e20136737aa21f7fd4406f4e363f65e968371e70f4a74bac3", "bytes": 2302, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[8]/table-wrap[1]#febs15656-tbl-0001", "version": null, "note": "List of most significantly differentially expressed genes in all tested conditions and according to our RNA‐Seq data. The fold change is indicated in bracket.", "structure": {"pmcid": "PMC8246981", "section_index": 8, "section_title": "Deletion of the disordered β‐catenin‐binding site alters FOXP2 transcriptional activity in the presence and absence of β‐catenin", "row_count": 12, "column_count": 10}, "table": {"label": "Table 1", "caption": "List of most significantly differentially expressed genes in all tested conditions and according to our RNA‐Seq data. The fold change is indicated in bracket.", "rows": [["FOXP2", "CHIR", "FOXP2Δhelix", "FOXP2 + CHIR", "FOXP2Δhelix + CHIR"], ["FOXP2 (13)", "PRND (−10.5)", "GZMB (12)", "MYOCD (−9.2)", "FOXP2 (12.6)", "PRND (−9.7)", "FOXP2 (14)", "PRND (−10.5)", "FOXP2 (13.8)", "PRND (−9.2)"], ["MMP1 (11.3)", "KANK4 (−9.3)", "MUCL1 (11.4)", "FOXS1 (−8.8)", "MAL (11.4)", "PLP1 (−9.7)", "LPAR6 (13)", "SOSTDC1 (−10)", "MAL (12.7)", "SOSTDC1 (−8.7)"], ["LAPR6 (11.2)", "HTR2A (−9.2)", "CXCL6 (10.7)", "NWD1 (−8.5)", "LPAR6 (11.4)", "KANK4 (−9.1)", "MYCT1 (12.1)", "IGFBP5 (−9.1)", "LPAR6 (12.6)", "IGFBP5 (−8.7)"], ["CTD‐2532D 12.4 (9.4)", "SOSTDC1 (−8.9)", "MTHFD2P1 (10.7)", "GALNT15 (−8.3)", "MMP1 (10.9)", "ABCB5 (−8.3)", "SERPINB2 (12)", "PLP1 (−8.2)", "MYCT1 (11.9)", "ABCB5 (−8.3)"], ["MYCT1 (9.3)", "AC074289.1 (−8.5)", "C1orf168 (10.1)", "CD180 (−8.1)", "MUC5AC (9.7)", "CCDC67 (−8)", "RP11‐753N 8.1 (11.9)", "HTR2A (−8)", "RP11‐753N 8.1 (11.9)", "APOL4 (−8.2)"], ["IL24 (9)", "MYOCD (−8.1)", "LINC00161 (9.9)", "YPEL4 (−7.9)", "AGXT (9.5)", "CXCL14 (−7.8)", "SPRR2D (11.3)", "CXCL14 (−8)", "MUC5AC (11.6)", "GABRR1 (−7.7)"], ["ENAM (9)", "CXCL14 (−8.1)", "RP11‐415C 15.2 (9.8)", "SYT8 (−7.7)", "MYCT1 (9.4)", "RP11‐798L 4.1 (−7.7)", "CTD‐2532D 12.4 (11.2)", "SLC2A12 (−8)", "AGXT (11.5)", "RP1‐193H 18.2 (−7.7)"], ["AF121898.3 (9)", "FOXS1 (−8)", "RP11‐95P 13.1 (9.7)", "HRT2A (−7.2)", "CTD‐2532D 12.4 (9.1)", "GABRR1 (−7.7)", "MAL (11.2)", "AC074289.1 (−7.9)", "GZMB (11.5)", "CXCL14 (−7.7)"], ["SPRR2D (8.6)", "RP11‐798L 4.1 (−7.9)", "CST1 (9.6)", "TNFSF15 (−7.2)", "LINC00659 (9)", "AC074289.1 (−7.6)", "MMP1 (10.8)", "R3HDML (−7.8)", "SERPINB2 (11.1)", "GALNT15 (−7.6)"], ["MAL (8.6)", "ABCB5 (−7.9)", "FILIP1 (9.5)", "CTD‐2334D 19.1 (−6.8)", "SRL (8.9)", "MYOCD (−7.6)", "GZMB (10.8)", "GALNT15 (−7.6)", "SPRR2D (10.7)", "FABP7 (−7.6)"], ["MMP3 (8.4)", "GABRR1 (−7.9)", "IGFL2 (9.2)", "LINC00961 (−6.8)", "ENAM (8.9)", "HMGB3P18 (−7.5)", "AC006372.1 (10.7)", "MAP2K6 (−7.5)", "MUCL1 (10.5)", "KIAA1210 (−7.5)"]], "row_count": 12, "column_count": 10, "numeric_cells": 110, "header_rows": 1, "locator": "section[8]/table-wrap[1]#febs15656-tbl-0001"}}, {"id": "asset:table:pmid:33284517:2", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:03d22a3b9db6a7a5207c3e8a8f8c569ebbde642b89650fe4c05f3437e0eefbf2", "bytes": 872, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[17]/table-wrap[1]#febs15656-tbl-0002", "version": null, "note": "Primer sequences used for site‐directed mutagenesis.", "structure": {"pmcid": "PMC8246981", "section_index": 17, "section_title": "Quantitative real‐time PCR (qPCR)", "row_count": 6, "column_count": 4}, "table": {"label": "Table 2", "caption": "Primer sequences used for site‐directed mutagenesis.", "rows": [["Constructs", "Primer sequences (5′–3′)", "Optimized for", "Vectors"], ["FOXP2FH", "Fw1: CGTCCGCCGTTCACCTAC Rv1: GGATCCTTATTCCAGGTCTTCTG Fw2: CCCGACGCTGtaaAAAAACATTCC Rv2: GAGCCGGTAATTTTCTGAC", "E. coli cells", "pETM11"], ["FOXP2 Construct247–715", "Fw: GGCCAGGCAGCACTTCCT Rv: TTAGGTTTCACAAGTCTCGAGTCATTC", "Mammalian cells", "pCMV 3Tag"], ["FOXP2 Construct342–715", "Fw: TCTCTATGGCCATGGAGTTT Rv: AAGCCGAATTCCACCACA", "Mammalian cells", "pCMV 3Tag"], ["FOXP2 Construct504–715", "Fw: TCAGACCTCCATTTACTTATGC Rv: AGCCGAATTCCACCACAC", "Mammalian cells", "pCMV 3Tag"], ["FOXP2Δhelix", "Fw: GTGACTGGAGTTCACAGTATG Rv: AGGACTTAAGCCAGCTTG", "Mammalian cells", "pCMV 3Tag"]], "row_count": 6, "column_count": 4, "numeric_cells": 9, "header_rows": 1, "locator": "section[17]/table-wrap[1]#febs15656-tbl-0002"}}, {"id": "asset:table:pmid:33284517:3", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:1124ae72070e393f31ecccb43a2896f38c716040db53ad627a3db538c6e8a6e7", "bytes": 669, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[17]/table-wrap[2]#febs15656-tbl-0003", "version": null, "note": "Primer sequences used for qPCR.", "structure": {"pmcid": "PMC8246981", "section_index": 17, "section_title": "Quantitative real‐time PCR (qPCR)", "row_count": 8, "column_count": 3}, "table": {"label": "Table 3", "caption": "Primer sequences used for qPCR.", "rows": [["Gene", "Forward primer (5′–3′)", "Reverse primer (5′–3′)"], ["BMP4", "ATGATTCCTGGTAACCGAATGC", "CCCCGTCTCAGGTATCAAACT"], ["CCND1", "GCTGCGAAGTGGAAACCATC", "CCTCCTTCTGCACACATTTGAA"], ["CD44", "CTGCCGCTTTGCAGGTGTA", "CATTGTGGGCAAGGTGCTATT"], ["HPRT1", "CCTGGCGTCGTGATTAGTGAT", "AGACGTTCAGTCCTGTCCATAA"], ["JUN", "TCCAAGTGCCGAAAAAGGAAG", "CGAGTTCTGAGCTTTCAAGGT"], ["LEF1", "TGCCAAATATGAATAACGACCCA", "GAGAAAAGTGCTCGTCACTGT"], ["TIAM1", "CCTGTGTCTTACACTGACTCTTC", "CATCCCCGTAAAGCCTGCTC"]], "row_count": 8, "column_count": 3, "numeric_cells": 3, "header_rows": 1, "locator": "section[17]/table-wrap[2]#febs15656-tbl-0003"}}], "gaps": ["asset:data:geo:GSE138938 not downloaded", "asset:data:geo:GSE138938 licence not read"]}, "analysis": {"state": "complete", "methods": [{"id": "method-1", "family": "differential_expression", "specific": "deseq2", "label": "Differential expression analysis", "dsl_operations": ["normalise_counts", "differential_expression_fit", "fdr_bh"], "missing_operations": [], "expressible": true, "parameters": {}, "data_shapes": ["count_matrix_with_condition"], "evidence": {"score": 1.0, "band": "verbatim", "quote": "Gene read counts are generated using featurecounts [64], and differential expression was analyzed using deseq2 [65]."}}], "targets": [], "gaps": []}, "capability": {"state": "complete", "requirements": [{"capability_id": "capability:computational_analysis", "label": "Computational analysis platform", "assay_families": ["meta_analysis", "machine_learning", "survival_analysis", "statistical_regression", "pca", "molecular_docking", "network_analysis", "differential_expression", "gwas"], "availability_state": "owned", "tier_unlocked": "R1", "candidate": "Automated Assays Laravel application and simulated adapters"}], "gaps": []}, "readiness": {"state": "complete", "tier": "R1", "blocking_axis": "none", "blocked_on": "nothing:replicable_now", "axes": {"method": {"tier": "R1", "expressible": true, "required_operations": ["normalise_counts", "differential_expression_fit", "fdr_bh"], "missing_operations": [], "basis": "The paper names the method it used and the corpus's method extractor maps it onto the DSL catalogue: deseq2."}, "capability": {"tier": "R1", "capability_id": "capability:computational_analysis", "availability_state": "owned", "basis": "The computational analysis is owned. The physical bench the paper used is not, so a physical validation cannot be run here."}, "data": {"tier": "R1", "reachable": true, "accessions": ["GSE138938"], "resolved_accessions": ["GSE138938"], "statements": ["Expression data are available in the GEO database under the accession number GSE138938."], "basis": "The paper names GSE138938 in GEO database and the accession resolves in the repository. No dataset was downloaded and no licence was read."}}, "can_run": {"dsl_operations": ["normalise_counts", "differential_expression_fit", "fdr_bh"], "assets": ["source:pmid:33284517", "data:geo:GSE138938", "asset:table:pmid:33284517:1", "asset:table:pmid:33284517:2", "asset:table:pmid:33284517:3"], "steps": ["run_analysis"]}, "must_build": {"dsl_operations": [], "converters": [], "readers": [], "capabilities": [], "data_gaps": ["data:geo:GSE138938"]}, "gaps": []}, "review": {"state": "partial", "machine_critique": {"kind": "extraction_review", "reader": {"model": "MiniMax-M3.1-Flash", "provider": "minimax", "provider_family": "minimax", "read_at": "2026-10-31T18:24:52Z", "independence": "single_reader"}, "evidence_check": {"method": "verbatim", "availability": "verbatim"}, "calls": 3, "usage": {"prompt_tokens": 46308, "completion_tokens": 811, "cached_tokens": 776}}, "human_critique": null, "stages": [{"id": "extraction", "state": "complete", "reader": "MiniMax-M3.1-Flash", "provider": "minimax"}], "gaps": ["review.independent_reader", "review.machine_critique", "review.human_critique"]}, "execution": {"state": "absent", "status": "not_run", "mode": null, "runs": [], "gaps": ["execution.not_run"]}, "provenance": {"entities": [{"id": "pmid:33284517", "type": "paper", "label": "pmid:33284517"}, {"id": "source:pmid:33284517", "type": "manuscript", "label": "PMID 33284517 full text"}, {"id": "data:geo:GSE138938", "type": "dataset", "label": "GEO GSE138938"}], "activities": [{"id": "activity-reading-sci-2026-11-01", "type": "classification", "used": [{"id": "pmid:33284517", "type": "paper", "label": "pmid:33284517"}, {"id": "source:pmid:33284517", "type": "manuscript", "label": "PMID 33284517 full text"}, {"id": "data:geo:GSE138938", "type": "dataset", "label": "GEO GSE138938"}], "agent": "agent:corpus-assay-engine"}, {"id": "activity-read-33284517", "type": "extraction", "used": ["source:pmid:33284517"], "agent": "agent:minimax-reader"}, {"id": "activity-resolve-GSE138938", "type": "accession_resolution", "used": ["data:geo:GSE138938"], "agent": "agent:corpus-assay-engine"}], "agents": [{"id": "agent:corpus-assay-engine", "type": "software", "label": "Corpus assay engine"}, {"id": "agent:minimax-reader", "type": "software", "label": "MiniMax literature reader"}], "source_run_id": "reading-sci-2026-11-01", "dsl_catalogue_fingerprint": "343fb30756ba6ec3", "capability_table_fingerprint": "2cb3e42f047d2ecf", "snapshot_id": "ba34b49490d9bfaf"}, "lineage": {"parent_id": "pmid:33284517", "parent_hash": "sha256:c0a7b7715df53a89ba41a5c2c829ab97a1d8d68f9b1743cc4fa69836f218e50b", "fork_of": null, "generation": 7}, "gaps": ["asset:data:geo:GSE138938 licence not read", "asset:data:geo:GSE138938 not downloaded", "execution.not_run", "review.human_critique", "review.independent_reader", "review.machine_critique"], "assays": [{"role": "data_generation", "definition_id": "rna_seq", "definition_version": "99e1195c7d6f", "definition_digest": null, "required_operations": [], "support_state": "partial", "source_hashes": {"assay_lexicon": "99e1195c7d6f"}, "confidence": 0.99, "evidence": ["development, however, remain elusive. Using RNA sequencing, we identified the Wnt signaling pathway as", "he conserved FOXP2 DNA-binding domain. Using RNA sequencing, we confirmed that β-catenin indeed regulate"], "order_basis": "paper_text_order:256", "id": "assay:1"}, {"role": "data_generation", "definition_id": "transfection", "definition_version": "99e1195c7d6f", "definition_digest": null, "required_operations": [], "support_state": "partial", "source_hashes": {"assay_lexicon": "99e1195c7d6f"}, "confidence": 0.99, "evidence": ["Materials and methods Cell culture and transfection For the Co‐IP with endogenous FOXP2 and β‐ca", "plate, approx. 80% confluent U2OS cells were transfected with various FOXP2 construct plasmids (500 n", "IR 99021 was added in the medium 72 h before transfection with FOXP2 construct plasmids. For the qPCR", "986 for FOXP2; Qiagen, Vienna, Austria) were transfected to HEK293T cell with Lipofectamine RNAiMAX ("], "order_basis": "paper_text_order:1441", "id": "assay:2"}, {"role": "data_generation", "definition_id": "cell_culture", "definition_version": "99e1195c7d6f", "definition_digest": null, "required_operations": [], "support_state": "partial", "source_hashes": {"assay_lexicon": "99e1195c7d6f"}, "confidence": 0.99, "evidence": ["or the qPCR experiments, HEK 293T cells were cultured in DMEM supplemented with 100 U·mL−1 penicillin", "−1 penicillin, and 100 µg·mL−1 streptomycin. U2OS cells were maintained at 37 °C under 5% CO2", ". In a six‐well plate, approx. 80% confluent U2OS cells were transfected with various FOXP2 co"], "order_basis": "paper_text_order:1675", "id": "assay:3"}, {"role": "data_generation", "definition_id": "qpcr", "definition_version": "99e1195c7d6f", "definition_digest": null, "required_operations": [], "support_state": "partial", "source_hashes": {"assay_lexicon": "99e1195c7d6f"}, "confidence": 0.99, "evidence": ["ction with FOXP2 construct plasmids. For the qPCR experiments, HEK 293T cells were cultured in", "ollected two days after transfection. For RT–qPCR, GSK inhibitor CHIR99021 (final concentratio"], "order_basis": "paper_text_order:2250", "id": "assay:4"}, {"role": "data_generation", "definition_id": "western_blot", "definition_version": "99e1195c7d6f", "definition_digest": null, "required_operations": [], "support_state": "partial", "source_hashes": {"assay_lexicon": "99e1195c7d6f"}, "confidence": 0.93, "evidence": ["CGACUAAACACAUCAA) was used as a control. For western blot, cells were collected two days after transfe"], "order_basis": "paper_text_order:2803", "id": "assay:5"}, {"role": "analysis", "definition_id": "differential_expression", "definition_version": "f2132e96ae6c7a4e", "definition_digest": null, "required_operations": ["normalise_counts", "differential_expression_fit", "fdr_bh"], "support_state": "supported", "source_hashes": {"dsl_catalogue": "f2132e96ae6c7a4e"}, "confidence": 1.0, "evidence": ["Gene read counts are generated using featurecounts [64], and differential expression was analyzed using deseq2 [65]."], "order_basis": "consumes_earlier_output", "id": "assay:6"}]}