Identification of Key Genes and Potential New Biomarkers for Ovarian Aging: A Study Based on RNA-Sequencing Data.

{"sci_version": "1.2", "schema": "https://corpus.bntrg.co.uk/sci/1.0/sci.schema.json", "id": "pmid:33304387", "kind": "science-record", "revision": 7, "content_hash": "sha256:bf6f1d1af90222cea361f4d431e4024b19af141ad4c081f31308ef144befbf00", "created_at": "2026-11-01T15:41:19Z", "updated_at": "2026-11-01T22:02:42Z", "generator": {"name": "corpus-assay-engine", "run_id": "reading-sci-2026-11-01"}, "paper": {"state": "complete", "title": "Identification of Key Genes and Potential New Biomarkers for Ovarian Aging: A Study Based on RNA-Sequencing Data.", "doi": "10.3389/fgene.2020.590660", "pmid": "33304387", "authors": ["Lingwei Ma", "Huan Lu", "Runhua Chen", "Meng Wu", "Yan Jin", "Jinjin Zhang", "Shixuan Wang"], "journal": "Frontiers in genetics", "year": 2020, "abstract": "Ovarian aging leads to reproductive and endocrine dysfunction, causing the disorder of multiple organs in the body and even declined quality of offspring's health. However, few studies have investigated the changes in gene expression profile in the ovarian aging process. Here, we applied integrated bioinformatics to screen, identify, and validate the critical pathogenic genes involved in ovarian aging and uncover potential molecular mechanisms. The expression profiles of GSE84078 were downloaded from the Gene Expression Omnibus (GEO) database, which included the data from ovarian samples of 10 normal C57BL/6 mice, including old (21-22 months old, ovarian failure period) and young (5-6 months old, reproductive bloom period) ovaries. First, we filtered 931 differentially expressed genes (DEGs), including 876 upregulated and 55 downregulated genes through comparison between ovarian expression data from old and young mice. Functional enrichment analysis showed that biological functions of DEGs were primarily immune response regulation, cell-cell adhesion, and phagosome pathway. The most closely related genes among DEGs (Tyrobp, Rac2, Cd14, Zap70, Lcp2, Itgb2, H2-Ab1, and Fcer1g) were identified by constructing a protein-protein interaction (PPI) network and consequently verified using mRNA and protein quantitative detection. Finally, the immune cell infiltration in the ovarian aging process was also evaluated by applying CIBERSORT, and a correlation analysis between hub genes and immune cell type was also performed. The results suggested that plasma cells and naïve CD4+ T cells may participate in ovarian aging. The hub genes were positively correlated with memory B cells, plasma cells, M1 macrophages, Th17 cells, and immature dendritic cells. In conclusion, this study indicates that screening for DEGs and pathways in ovarian aging using bioinformatic analysis could provide potential clues for researchers to unveil the molecular mechanism underlying ovarian aging. These results could be of clinical significance and provide effective molecular targets for the treatment of ovarian aging.", "claims": [{"id": "claim-method", "statement": "Unpaired Student’s t test was performed.", "kind": "methodological", "target": null, "evidence": [{"asset": "source:pmid:33304387", "locator": "sections[13] \"Statistical Analysis\" paragraph 2", "quote": "Unpaired Student’s t test was performed."}], "state": "complete"}, {"id": "claim-data-access", "statement": "The original contributions presented in the study are included in the article/Supplementary Material, further inquiries can be directed to the corresponding author/s.", "kind": "methodological", "target": null, "evidence": [{"asset": "source:pmid:33304387", "locator": "sections[23] \"Data Availability Statement\" paragraph 2", "quote": "The original contributions presented in the study are included in the article/Supplementary Material, further inquiries can be directed to the corresponding author/s."}], "state": "complete"}], "gaps": []}, "experiment": {"state": "complete", "objective": null, "steps": [{"id": "read_published_estimate", "order": 1, "name": "Read the published estimate from the source", "kind": "other", "state": "complete", "blocked_on": null, "description": "The claim, method and evidence span published with the source article.", "duration_hours": null, "parameters": {}, "inputs": ["source:pmid:33304387"], "outputs": ["the published estimate and its evidence"], "instruments": [], "reagents": []}, {"id": "obtain_source_data", "order": 2, "name": "Obtain the source data from the named repository", "kind": "data-preparation", "state": "complete", "blocked_on": null, "description": "The GEO series accession resolves and its sample accessions are listed. This lane did not download the dataset or read its licence.", "duration_hours": null, "parameters": {}, "inputs": ["data:geo:GSE84078"], "outputs": ["the source data with its repository provenance"], "instruments": [], "reagents": []}, {"id": "run_analysis", "order": 3, "name": "Run the published analysis", "kind": "analysis", "state": "complete", "blocked_on": null, "description": "Apply the paper's statistical method to the resolved series and compare the result with the published target.", "duration_hours": null, "parameters": {}, "inputs": ["data:geo:GSE84078"], "outputs": ["the replicated result and its comparison"], "instruments": [], "reagents": []}], "materials": [], "instruments": [], "reagents": [], "conditions": {}, "gaps": []}, "data": {"state": "partial", "assets": [{"id": "source:pmid:33304387", "role": "manuscript", "format": "xml", "media_type": "application/xml", "uri": "https://doi.org/10.3389/fgene.2020.590660", "sha256": "sha256:453991a8fbe00313768a8a9c93b57513cb6c41a11d02f3041a0fafcff57ac391", "bytes": 45113, "access": "open", "state": "resolved", "reader": null, "reader_status": "reader_required", "identifier": "10.3389/fgene.2020.590660", "version": null, "note": "Full article fetched from PMC; the checksum covers the rendered section body, not the original XML bytes.", "structure": {"pmcid": "PMC7701310", "source": "europe_pmc_fulltext", "coverage": "whole_body_without_references", "text_hash_scope": "rendered_section_body"}}, {"id": "data:geo:GSE84078", "role": "raw", "format": "geo-series", "media_type": "application/vnd.ncbi.geo-series+json", "uri": "https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE84078", "sha256": null, "bytes": null, "access": "open", "state": "resolved", "reader": null, "reader_status": "reader_required", "identifier": "GSE84078", "version": null, "note": "The original contributions presented in the study are included in the article/Supplementary Material, further inquiries can be directed to the corresponding author/s.", "structure": {"repository": "GEO", "access_route": "GEO accession URL", "access_statement_verbatim": "The original contributions presented in the study are included in the article/Supplementary Material, further inquiries can be directed to the corresponding author/s.", "access_statement_kind": "data_availability_statement", "sample_accessions": ["GSM2226856", "GSM2226857", "GSM2226858", "GSM2226859", "GSM2226860", "GSM2226861", "GSM2226862", "GSM2226863", "GSM2226864", "GSM2226865", "GSM2226866", "GSM2226867", "GSM2226868", "GSM2226869", "GSM2226870", "GSM2226871", "GSM2226872", "GSM2226873", "GSM2226874", "GSM2226875"], "sample_count": 20, "group_sizes": null, "group_sizes_basis": null, "platform": "13112", "taxon": "Mus musculus", "title": "Ovarian transcriptome associated with reproductive senescence in the long-living Ames dwarf mice", "resolution_checked_at": "2026-11-01T15:39:55Z", "resolution_check": "identifier_resolution_only_no_download_no_licence_read", "downloaded": false, "licence_read": false}}, {"id": "asset:table:pmid:33304387:1", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:7f9a0948500d6c735bc3c051a2d96822c86ccb88f8c36ce8e30abb7f0ef04217", "bytes": 1010, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[4]/table-wrap[1]#T1", "version": null, "note": "The sequences of primers used in quantitative real-time PCR.", "structure": {"pmcid": "PMC7701310", "section_index": 4, "section_title": "RNA Extraction and Quantitative Real-Time PCR", "row_count": 23, "column_count": 2}, "table": {"label": "TABLE 1", "caption": "The sequences of primers used in quantitative real-time PCR.", "rows": [["Primer", "Primer sequence (5′-3′)"], ["Lcp2", "F: AGAATGTCCCGTTTCGCTCAG"], ["", "R: TGCTCCTTCTCTCTTCGTTCTT"], ["H2-Ab1", "F: AAGGCATTTCGTGTACCAGTTC"], ["", "R: CCTCCCGGTTGTAGATGTATCTG"], ["Itgb2", "F: CAGGAATGCACCAAGTACAAAGT"], ["", "R: GTCACAGCGCAAGGAGTCA"], ["Tyrobp", "F: CCCAAGATGCGACTGTTCTTC"], ["", "R: GTCCCTTGACCTCGGGAGA"], ["Cd74", "F: CGCGACCTCATCTCTAACCAT"], ["", "R: ACAGGTTTGGCAGATTTCGGA"], ["Zap70", "F: CGTGCGCTTCCACCATTTC"], ["", "R: GTTACACGGCTTACGCAGGT"], ["Rac2", "F: GACAGTAAGCCGGTGAACCTG"], ["", "R: CTGACTAGCGAGAAGCAGATG"], ["Cd14", "F: CTCTGTCCTTAAAGCGGCTTAC"], ["", "R: GTTGCGGAGGTTCAAGATGTT"], ["Ptpn6", "F: GGACTTCTATGACCTGTACGGA"], ["", "R: CGAGCAGTTCAGTGGGTACTT"], ["Fcer1g", "F: ATCTCAGCCGTGATCTTGTTCT"], ["", "R: ACCATACAAAAACAGGACAGCAT"], ["Gapdh", "F: GTCCCGTAGACAAAATGGTGA"], ["", "R: TGCATTGCTGACAATCTTGAG"]], "row_count": 23, "column_count": 2, "numeric_cells": 4, "header_rows": 1, "locator": "section[4]/table-wrap[1]#T1"}}, {"id": "asset:table:pmid:33304387:2", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:96cbbac0758bbae7f25e2ea6d52b7f3abbc29cd982a62cc4fd9021807a83b4f9", "bytes": 1735, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[16]/table-wrap[1]#T2", "version": null, "note": "Functional enrichment analysis of upregulated genes in the old mouse ovary compared to young mouse.", "structure": {"pmcid": "PMC7701310", "section_index": 16, "section_title": "Functional Annotation and Pathway Enrichment Analysis of DEGs", "row_count": 21, "column_count": 6}, "table": {"label": "TABLE 2", "caption": "Functional enrichment analysis of upregulated genes in the old mouse ovary compared to young mouse.", "rows": [["Category", "Term", "Description", "Count", "%", "p value"], ["BP", "GO:0007159", "Leukocyte cell–cell adhesion", "53", "6.4%", "5.35E–21"], ["BP", "GO:0022407", "Regulation of cell–cell adhesion", "58", "7.0%", "3.23E–20"], ["BP", "GO:0042110", "T cell activation", "64", "7.7%", "2.21E–19"], ["BP", "GO:1903037", "Regulation of leukocyte cell–cell adhesion", "47", "5.7%", "1.71E–18"], ["BP", "GO:0046651", "Lymphocyte proliferation", "48", "5.8%", "5.15E–18"], ["CC", "GO:0005930", "Axoneme", "31", "3.7%", "7.76E–18"], ["CC", "GO:0097014", "Ciliary plasm", "31", "3.7%", "9.92E–18"], ["CC", "GO:0032838", "Plasma membrane bounded cell projection cytoplasm", "31", "3.7%", "3.48E–14"], ["CC", "GO:0044441", "Ciliary part", "50", "6.0%", "1.27E–12"], ["CC", "GO:0044447", "Axoneme part", "15", "1.8%", "1.83E–12"], ["MF", "GO:0003774", "Motor activity", "21", "2.6%", "8.49E–09"], ["MF", "GO:0004896", "Cytokine receptor activity", "16", "2.0%", "3.34E–07"], ["MF", "GO:0045503", "Dynein light-chain binding", "9", "1.1%", "4.88E–07"], ["MF", "GO:1990939", "ATP-dependent microtubule motor activity", "11", "1.4%", "6.23E–07"], ["MF", "GO:0042608", "T cell receptor binding", "7", "0.9%", "6.35E–07"], ["KEGG", "mmu04514", "Cell adhesion molecules (CAMs)", "41", "11.5%", "7.49E–21"], ["KEGG", "mmu04145", "Phagosome", "30", "8.4%", "3.83E–11"], ["KEGG", "mmu04640", "Hematopoietic cell lineage", "21", "5.9%", "1.65E–10"], ["KEGG", "mmu05416", "Viral myocarditis", "20", "5.6%", "2.68E–10"], ["KEGG", "mmu05330", "Allograft rejection", "17", "4.8%", "3.39E–10"]], "row_count": 21, "column_count": 6, "numeric_cells": 80, "header_rows": 1, "locator": "section[16]/table-wrap[1]#T2"}}, {"id": "asset:table:pmid:33304387:3", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:4b38ee19847dd1ab73d480f330782ef38b2cc965a5c2497d8df3119091e4c84d", "bytes": 1467, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[16]/table-wrap[2]#T3", "version": null, "note": "Functional enrichment analysis of downregulated genes in the old mouse ovary compared to young mouse.", "structure": {"pmcid": "PMC7701310", "section_index": 16, "section_title": "Functional Annotation and Pathway Enrichment Analysis of DEGs", "row_count": 16, "column_count": 6}, "table": {"label": "TABLE 3", "caption": "Functional enrichment analysis of downregulated genes in the old mouse ovary compared to young mouse.", "rows": [["Category", "Term", "Description", "Count", "%", "p value"], ["BP", "GO:0008585", "Female gonad development", "7", "14.0%", "4.56E–09"], ["BP", "GO:0009566", "Fertilization", "8", "16.0%", "5.48E–09"], ["BP", "GO:0046545", "Development of primary female sexual characteristics", "7", "14.0%", "5.48E–09"], ["BP", "GO:0001541", "Ovarian follicle development", "6", "12.0%", "8.00E–09"], ["BP", "GO:2000194", "Regulation of female gonad development", "4", "8.0%", "2.57E–08"], ["CC", "GO:0042627", "Chylomicron", "2", "4.0%", "0.00028"], ["CC", "GO:0034361", "Very-low-density lipoprotein particle", "2", "4.0%", "0.000643"], ["CC", "GO:0034385", "Triglyceride-rich plasma lipoprotein particle", "2", "4.0%", "0.000643"], ["CC", "GO:0034364", "High-density lipoprotein particle", "2", "4.0%", "0.001151"], ["CC", "GO:0034358", "Plasma lipoprotein particle", "2", "4.0%", "0.002444"], ["MF", "GO:0005160", "Transforming growth factor beta receptor binding", "2", "4.0%", "0.000205"], ["MF", "GO:0017127", "Cholesterol transporter activity", "2", "4.0%", "0.000844"], ["KEGG", "mmu04977", "Vitamin digestion and absorption", "2", "14.3%", "0.000657"], ["KEGG", "mmu04975", "Fat digestion and absorption", "2", "14.3%", "0.001829"], ["KEGG", "mmu04979", "Cholesterol metabolism", "2", "14.3%", "0.002735"]], "row_count": 16, "column_count": 6, "numeric_cells": 60, "header_rows": 1, "locator": "section[16]/table-wrap[2]#T3"}}], "gaps": ["asset:data:geo:GSE84078 not downloaded", "asset:data:geo:GSE84078 licence not read"]}, "analysis": {"state": "partial", "methods": [{"id": "method-1", "family": "network_analysis", "specific": "ppi_network", "label": "Network / pathway analysis", "dsl_operations": ["build_graph", "centrality_scores", "pathway_enrich"], "missing_operations": [], "expressible": true, "parameters": {}, "data_shapes": ["edge_list"], "evidence": {"score": 0.7, "band": "medium", "quote": "protein-protein interaction"}}, {"id": "method-2", "family": "network_analysis", "specific": "pathway_enrichment", "label": "Network / pathway analysis", "dsl_operations": ["pathway_enrich"], "missing_operations": [], "expressible": true, "parameters": {}, "data_shapes": ["edge_list"], "evidence": {"score": 0.8, "band": "high", "quote": "Pathway Enrichment"}}, {"id": "method-3", "family": null, "specific": null, "label": "Unpaired Student’s t test", "dsl_operations": [], "missing_operations": [], "expressible": null, "parameters": {}, "data_shapes": [], "evidence": {"score": 1.0, "band": "verbatim", "quote": "Unpaired Student’s t test was performed."}}], "targets": [], "gaps": ["method.reader_named_unmapped"]}, "capability": {"state": "complete", "requirements": [{"capability_id": "capability:computational_analysis", "label": "Computational analysis platform", "assay_families": ["meta_analysis", "machine_learning", "survival_analysis", "statistical_regression", "pca", "molecular_docking", "network_analysis", "differential_expression", "gwas"], "availability_state": "owned", "tier_unlocked": "R1", "candidate": "Automated Assays Laravel application and simulated adapters"}], "gaps": []}, "readiness": {"state": "complete", "tier": "R1", "blocking_axis": "none", "blocked_on": "nothing:replicable_now", "axes": {"method": {"tier": "R1", "expressible": true, "required_operations": ["build_graph", "centrality_scores", "pathway_enrich"], "missing_operations": [], "basis": "The paper names the method it used and the corpus's method extractor maps it onto the DSL catalogue: ppi_network."}, "capability": {"tier": "R1", "capability_id": "capability:computational_analysis", "availability_state": "owned", "basis": "The computational analysis is owned. The physical bench the paper used is not, so a physical validation cannot be run here."}, "data": {"tier": "R1", "reachable": true, "accessions": ["GSE84078"], "resolved_accessions": ["GSE84078"], "statements": ["The original contributions presented in the study are included in the article/Supplementary Material, further inquiries can be directed to the corresponding author/s."], "basis": "The paper names GSE84078 in Gene Expression Omnibus (GEO) database and the accession resolves in the repository. No dataset was downloaded and no licence was read."}}, "can_run": {"dsl_operations": ["build_graph", "centrality_scores", "pathway_enrich"], "assets": ["source:pmid:33304387", "data:geo:GSE84078", "asset:table:pmid:33304387:1", "asset:table:pmid:33304387:2", "asset:table:pmid:33304387:3"], "steps": ["run_analysis"]}, "must_build": {"dsl_operations": [], "converters": [], "readers": [], "capabilities": [], "data_gaps": ["data:geo:GSE84078"]}, "gaps": []}, "review": {"state": "partial", "machine_critique": {"kind": "extraction_review", "reader": {"model": "MiniMax-M3.1-Flash", "provider": "minimax", "provider_family": "minimax", "read_at": "2026-10-31T18:25:02Z", "independence": "single_reader"}, "evidence_check": {"method": "verbatim", "availability": "verbatim"}, "calls": 3, "usage": {"prompt_tokens": 32242, "completion_tokens": 1063, "cached_tokens": 776}}, "human_critique": null, "stages": [{"id": "extraction", "state": "complete", "reader": "MiniMax-M3.1-Flash", "provider": "minimax"}], "gaps": ["review.independent_reader", "review.machine_critique", "review.human_critique"]}, "execution": {"state": "absent", "status": "not_run", "mode": null, "runs": [], "gaps": ["execution.not_run"]}, "provenance": {"entities": [{"id": "pmid:33304387", "type": "paper", "label": "pmid:33304387"}, {"id": "source:pmid:33304387", "type": "manuscript", "label": "PMID 33304387 full text"}, {"id": "data:geo:GSE84078", "type": "dataset", "label": "GEO GSE84078"}], "activities": [{"id": "activity-reading-sci-2026-11-01", "type": "classification", "used": [{"id": "pmid:33304387", "type": "paper", "label": "pmid:33304387"}, {"id": "source:pmid:33304387", "type": "manuscript", "label": "PMID 33304387 full text"}, {"id": "data:geo:GSE84078", "type": "dataset", "label": "GEO GSE84078"}], "agent": "agent:corpus-assay-engine"}, {"id": "activity-read-33304387", "type": "extraction", "used": ["source:pmid:33304387"], "agent": "agent:minimax-reader"}, {"id": "activity-resolve-GSE84078", "type": "accession_resolution", "used": ["data:geo:GSE84078"], "agent": "agent:corpus-assay-engine"}], "agents": [{"id": "agent:corpus-assay-engine", "type": "software", "label": "Corpus assay engine"}, {"id": "agent:minimax-reader", "type": "software", "label": "MiniMax literature reader"}], "source_run_id": "reading-sci-2026-11-01", "dsl_catalogue_fingerprint": "343fb30756ba6ec3", "capability_table_fingerprint": "2cb3e42f047d2ecf", "snapshot_id": "ba34b49490d9bfaf"}, "lineage": {"parent_id": "pmid:33304387", "parent_hash": "sha256:b9eefab70f2202509df273d17fee8590c244876afd6066f745df144df4199a5d", "fork_of": null, "generation": 6}, "gaps": ["asset:data:geo:GSE84078 licence not read", "asset:data:geo:GSE84078 not downloaded", "execution.not_run", "method.reader_named_unmapped", "review.human_critique", "review.independent_reader", "review.machine_critique"], "assays": [{"role": "data_generation", "definition_id": "rna_seq", "definition_version": "99e1195c7d6f", "definition_digest": null, "required_operations": [], "support_state": "partial", "source_hashes": {"assay_lexicon": "99e1195c7d6f"}, "confidence": 0.93, "evidence": ["omarkers for Ovarian Aging: A Study Based on RNA-Sequencing Data."], "order_basis": "paper_text_order:48", "id": "assay:1"}, {"role": "data_generation", "definition_id": "animal_model", "definition_version": "99e1195c7d6f", "definition_digest": null, "required_operations": [], "support_state": "partial", "source_hashes": {"assay_lexicon": "99e1195c7d6f"}, "confidence": 0.99, "evidence": ["ention of Hubei Province (Wuhan, China). The mice were bred with free access to food and water at a", "ntified DEGs in the ovaries of old and young mice were further analyzed via GO and KEGG pathway ana", "ent analysis of upregulated genes in the old mouse ovary compared to young mouse. Functional en", "nes in the old mouse ovary compared to young mouse. Functional enrichment analysis of downregul"], "order_basis": "paper_text_order:2480", "id": "assay:2"}, {"role": "analysis", "definition_id": "network_analysis", "definition_version": "f2132e96ae6c7a4e", "definition_digest": null, "required_operations": ["build_graph", "centrality_scores", "pathway_enrich"], "support_state": "supported", "source_hashes": {"dsl_catalogue": "f2132e96ae6c7a4e"}, "confidence": 0.7, "evidence": ["protein-protein interaction"], "order_basis": "consumes_earlier_output", "id": "assay:3"}]}