Identification of ribosomal protein family in triple-negative breast cancer by bioinformatics analysis.

{"sci_version": "1.2", "schema": "https://corpus.bntrg.co.uk/sci/1.0/sci.schema.json", "id": "pmid:33305312", "kind": "science-record", "revision": 8, "content_hash": "sha256:e4ee4f5f372b03a6d7db4d855ce662f7418d17f97a3fc32d5ebd1c0ef2f5260b", "created_at": "2026-11-01T15:41:19Z", "updated_at": "2026-11-01T22:02:43Z", "generator": {"name": "corpus-assay-engine", "run_id": "reading-sci-2026-11-01"}, "paper": {"state": "complete", "title": "Identification of ribosomal protein family in triple-negative breast cancer by bioinformatics analysis.", "doi": "10.1042/BSR20200869", "pmid": "33305312", "authors": ["Ziyue Lin", "Rui Peng", "Yan Sun", "Luyu Zhang", "Zheng Zhang"], "journal": "Bioscience reports", "year": 2021, "abstract": "Triple-negative breast cancer (TNBC) accounts for ∼20% of all breast cancer (BC) cases. The management of TNBC represents a challenge due to its worse prognosis, heterogeneity and lack of targeted therapy. Moreover, its mechanisms are not fully clear. The aim of the study is to identify crucial genes between TNBC and non-TNBC for underlying targets for diagnostic and therapeutic methods of TNBC. The differentially expressed genes (DEGs) between TNBC and non-TNBC were selected from the Gene Expression Omnibus (GEO) database after the integrated analysis of two datasets (GSE65194 and GSE76124). Then Gene ontology (GO) and KEGG analysis were performed by DAVID database, protein-protein interaction (PPI) of DEGs was constructed by Search Tool for the Retrieval of Reciprocity Genes (STRING) database. Furthermore, centrality analysis and module analysis were carried out by Cytoscape to analyze the TNBC-related PPI. Subsequently, overall survival (OS) analysis was performed by GEPIA. Finally, the expressions of these key genes in TNBC and non-TNBC tissues were tested by qRT-PCR. The results showed that 955 DEGs were obtained, which were mainly enriched in ribosome, ribosomal subunit, and so on. Moreover, 19 candidate genes were focused on by centrality analysis and module analysis. Furthermore, we found the low expressions of ribosomal protein S9 (RPS9), ribosomal protein S14 (RPS14), ribosomal protein S27 (RPS27), ribosomal protein L11 (RPL11) and ribosomal protein L14 (RPL14) were related to a poor OS in BC patients. Additionally, qRT-PCR results suggested that these five genes were notably down-regulated in TNBC tissues. In summary, the present study suggests that ribosomal proteins are related to TNBC, and they may play an important role in the diagnosis, treatment and prognosis of TNBC.", "claims": [{"id": "claim-data-access", "statement": "Two expression profiling datasets (GSE65194 and GSE76124) were downloaded from the Gene Expression Omnibus (GEO) database (https://www.ncbi.nlm.nih.gov/geo/), an open platform for storing genetic data. The GSE65194 dataset contained 178 arrays. A total of 153 arrays were used to analyze 130 unique BC samples (41 cases of TNBC; 89 cases of non-TNBC) and 23 technical duplicates. In addition 11 normal breast tissue samples and 14 TNBC cell lines were included.", "kind": "methodological", "target": null, "evidence": [{"asset": "source:pmid:33305312", "locator": "sections[3] \"Access to public data\" paragraph 2", "quote": "Two expression profiling datasets (GSE65194 and GSE76124) were downloaded from the Gene Expression Omnibus (GEO) database (https://www.ncbi.nlm.nih.gov/geo/), an open platform for storing genetic data."}, {"asset": "source:pmid:33305312", "locator": "sections[3] \"Access to public data\" paragraph 2", "quote": "The GSE65194 dataset contained 178 arrays."}, {"asset": "source:pmid:33305312", "locator": "sections[3] \"Access to public data\" paragraph 2", "quote": "A total of 153 arrays were used to analyze 130 unique BC samples (41 cases of TNBC; 89 cases of non-TNBC) and 23 technical duplicates."}, {"asset": "source:pmid:33305312", "locator": "sections[3] \"Access to public data\" paragraph 2", "quote": "In addition 11 normal breast tissue samples and 14 TNBC cell lines were included."}], "state": "complete"}], "gaps": []}, "experiment": {"state": "complete", "objective": null, "steps": [{"id": "read_published_estimate", "order": 1, "name": "Read the published estimate from the source", "kind": "other", "state": "complete", "blocked_on": null, "description": "The claim, method and evidence span published with the source article.", "duration_hours": null, "parameters": {}, "inputs": ["source:pmid:33305312"], "outputs": ["the published estimate and its evidence"], "instruments": [], "reagents": []}, {"id": "obtain_source_data", "order": 2, "name": "Obtain the source data from the named repository", "kind": "data-preparation", "state": "complete", "blocked_on": null, "description": "The GEO series accession resolves and its sample accessions are listed. This lane did not download the dataset or read its licence.", "duration_hours": null, "parameters": {}, "inputs": ["data:geo:GSE65194"], "outputs": ["the source data with its repository provenance"], "instruments": [], "reagents": []}, {"id": "run_analysis", "order": 3, "name": "Run the published analysis", "kind": "analysis", "state": "complete", "blocked_on": null, "description": "Apply the paper's statistical method to the resolved series and compare the result with the published target.", "duration_hours": null, "parameters": {}, "inputs": ["data:geo:GSE65194"], "outputs": ["the replicated result and its comparison"], "instruments": [], "reagents": []}], "materials": [], "instruments": [], "reagents": [], "conditions": {}, "gaps": []}, "data": {"state": "partial", "assets": [{"id": "source:pmid:33305312", "role": "manuscript", "format": "xml", "media_type": "application/xml", "uri": "https://doi.org/10.1042/BSR20200869", "sha256": "sha256:3fcff67778f943bee949c0091dfb15357105a3bd10388e0e52c87ae528b8503d", "bytes": 39350, "access": "open", "state": "resolved", "reader": null, "reader_status": "reader_required", "identifier": "10.1042/BSR20200869", "version": null, "note": "Full article fetched from PMC; the checksum covers the rendered section body, not the original XML bytes.", "structure": {"pmcid": "PMC7789804", "source": "europe_pmc_fulltext", "coverage": "whole_body", "text_hash_scope": "rendered_section_body"}}, {"id": "data:geo:GSE65194", "role": "raw", "format": "geo-series", "media_type": "application/vnd.ncbi.geo-series+json", "uri": "https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE65194", "sha256": null, "bytes": null, "access": "open", "state": "resolved", "reader": null, "reader_status": "reader_required", "identifier": "GSE65194", "version": null, "note": "Two expression profiling datasets (GSE65194 and GSE76124) were downloaded from the Gene Expression Omnibus (GEO) database (https://www.ncbi.nlm.nih.gov/geo/), an open platform for storing genetic data. The GSE65194 dataset contained 178 arrays. A total of 153 arrays were used to analyze 130 unique BC samples (41 cases of TNBC; 89 cases of non-TNBC) and 23 technical duplicates. In addition 11 normal breast tissue samples and 14 TNBC cell lines were included.", "structure": {"repository": "GEO", "access_route": "GEO accession URL", "access_statement_verbatim": "Two expression profiling datasets (GSE65194 and GSE76124) were downloaded from the Gene Expression Omnibus (GEO) database (https://www.ncbi.nlm.nih.gov/geo/), an open platform for storing genetic data. The GSE65194 dataset contained 178 arrays. A total of 153 arrays were used to analyze 130 unique BC samples (41 cases of TNBC; 89 cases of non-TNBC) and 23 technical duplicates. In addition 11 normal breast tissue samples and 14 TNBC cell lines were included.", "access_statement_kind": "repository_route_statement", "sample_accessions": ["GSM1588970", "GSM1588971", "GSM1588972", "GSM1588973", "GSM1588974", "GSM1588975", "GSM1588976", "GSM1588977", "GSM1588978", "GSM1588979", "GSM1588980", "GSM1588981", "GSM1588982", "GSM1588983", "GSM1588984", "GSM1588985", "GSM1588986", "GSM1588987", "GSM1588988", "GSM1588989", "GSM1588990", "GSM1588991", "GSM1588992", "GSM1588993", "GSM1588994", "GSM1588995", "GSM1588996", "GSM1588997", "GSM1588998", "GSM1588999", "GSM1589000", "GSM1589001", "GSM1589002", "GSM1589003", "GSM1589004", "GSM1589005", "GSM1589006", "GSM1589007", "GSM1589008", "GSM1589009", "GSM1589010", "GSM1589011", "GSM1589012", "GSM1589013", "GSM1589014", "GSM1589015", "GSM1589016", "GSM1589017", "GSM1589018", "GSM1589019", "GSM1589020", "GSM1589021", "GSM1589022", "GSM1589023", "GSM1589024", "GSM1589025", "GSM1589026", "GSM1589027", "GSM1589028", "GSM1589029", "GSM1589030", "GSM1589031", "GSM1589032", "GSM1589033", "GSM1589034", "GSM1589035", "GSM1589036", "GSM1589037", "GSM1589038", "GSM1589039", "GSM1589040", "GSM1589041", "GSM1589042", "GSM1589043", "GSM1589044", "GSM1589045", "GSM1589046", "GSM1589047", "GSM1589048", "GSM1589049", "GSM1589050", "GSM1589051", "GSM1589052", "GSM1589053", "GSM1589054", "GSM1589055", "GSM1589056", "GSM1589057", "GSM1589058", "GSM1589059", "GSM1589060", "GSM1589061", "GSM1589062", "GSM1589063", "GSM1589064", "GSM1589065", "GSM1589066", "GSM1589067", "GSM1589068", "GSM1589069", "GSM1589070", "GSM1589071", "GSM1589072", "GSM1589073", "GSM1589074", "GSM1589075", "GSM1589076", "GSM1589077", "GSM1589078", "GSM1589079", "GSM1589080", "GSM1589081", "GSM1589082", "GSM1589083", "GSM1589084", "GSM1589085", "GSM1589086", "GSM1589087", "GSM1589088", "GSM1589089", "GSM1589090", "GSM1589091", "GSM1589092", "GSM1589093", "GSM1589094", "GSM1589095", "GSM1589097", "GSM1589098", "GSM1589099", "GSM1589101", "GSM1589103", "GSM1589105", "GSM1589107", "GSM1589109", "GSM1589110", "GSM1589111", "GSM1589112", "GSM1589113", "GSM1589114", "GSM1589115", "GSM1589116", "GSM1589117", "GSM1589118", "GSM1589119", "GSM1589120", "GSM1589121", "GSM1589122", "GSM1589123", "GSM1589124", "GSM1589125", "GSM1589126", "GSM1589127", "GSM1589128", "GSM1589129", "GSM1589130", "GSM1589131", "GSM1589132", "GSM1589133", "GSM1589134", "GSM1589135", "GSM1589136", "GSM1589137", "GSM1589138", "GSM1589139", "GSM1589140", "GSM1589141", "GSM1589142", "GSM1589143", "GSM1589144", "GSM1589145", "GSM1589146", "GSM1589147", "GSM1589148", "GSM1589149", "GSM1589150", "GSM1589151", "GSM1589152", "GSM1589153"], "sample_count": 178, "group_sizes": null, "group_sizes_basis": null, "platform": "570", "taxon": "Homo sapiens", "title": "Expression profiling of breast cancer samples from Institut Curie (Maire cohort) --Affy CDF", "resolution_checked_at": "2026-11-01T11:38:18Z", "resolution_check": "identifier_resolution_only_no_download_no_licence_read", "downloaded": false, "licence_read": false}}, {"id": "data:geo:GSE76124", "role": "raw", "format": "geo-series", "media_type": "application/vnd.ncbi.geo-series+json", "uri": "https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE76124", "sha256": null, "bytes": null, "access": "open", "state": "resolved", "reader": null, "reader_status": "reader_required", "identifier": "GSE76124", "version": null, "note": "Two expression profiling datasets (GSE65194 and GSE76124) were downloaded from the Gene Expression Omnibus (GEO) database (https://www.ncbi.nlm.nih.gov/geo/), an open platform for storing genetic data. The GSE65194 dataset contained 178 arrays. A total of 153 arrays were used to analyze 130 unique BC samples (41 cases of TNBC; 89 cases of non-TNBC) and 23 technical duplicates. In addition 11 normal breast tissue samples and 14 TNBC cell lines were included.", "structure": {"repository": "GEO", "access_route": "GEO accession URL", "access_statement_verbatim": "Two expression profiling datasets (GSE65194 and GSE76124) were downloaded from the Gene Expression Omnibus (GEO) database (https://www.ncbi.nlm.nih.gov/geo/), an open platform for storing genetic data. The GSE65194 dataset contained 178 arrays. A total of 153 arrays were used to analyze 130 unique BC samples (41 cases of TNBC; 89 cases of non-TNBC) and 23 technical duplicates. In addition 11 normal breast tissue samples and 14 TNBC cell lines were included.", "access_statement_kind": "repository_route_statement", "sample_accessions": ["GSM1974566", "GSM1974567", "GSM1974568", "GSM1974569", "GSM1974570", "GSM1974571", "GSM1974572", "GSM1974573", "GSM1974574", "GSM1974575", "GSM1974576", "GSM1974577", "GSM1974578", "GSM1974579", "GSM1974580", "GSM1974581", "GSM1974582", "GSM1974583", "GSM1974584", "GSM1974585", "GSM1974586", "GSM1974587", "GSM1974588", "GSM1974589", "GSM1974590", "GSM1974591", "GSM1974592", "GSM1974593", "GSM1974594", "GSM1974595", "GSM1974596", "GSM1974597", "GSM1974598", "GSM1974599", "GSM1974600", "GSM1974601", "GSM1974602", "GSM1974603", "GSM1974604", "GSM1974605", "GSM1974606", "GSM1974607", "GSM1974608", "GSM1974609", "GSM1974610", "GSM1974611", "GSM1974612", "GSM1974613", "GSM1974614", "GSM1974615", "GSM1974616", "GSM1974617", "GSM1974618", "GSM1974619", "GSM1974620", "GSM1974621", "GSM1974622", "GSM1974623", "GSM1974624", "GSM1974625", "GSM1974626", "GSM1974627", "GSM1974628", "GSM1974629", "GSM1974630", "GSM1974631", "GSM1974632", "GSM1974633", "GSM1974634", "GSM1974635", "GSM1974636", "GSM1974637", "GSM1974638", "GSM1974639", "GSM1974640", "GSM1974641", "GSM1974642", "GSM1974643", "GSM1974644", "GSM1974645", "GSM1974646", "GSM1974647", "GSM1974648", "GSM1974649", "GSM1974650", "GSM1974651", "GSM1974652", "GSM1974653", "GSM1974654", "GSM1974655", "GSM1974656", "GSM1974657", "GSM1974658", "GSM1974659", "GSM1974660", "GSM1974661", "GSM1974662", "GSM1974663", "GSM1974664", "GSM1974665", "GSM1974666", "GSM1974667", "GSM1974668", "GSM1974669", "GSM1974670", "GSM1974671", "GSM1974672", "GSM1974673", "GSM1974674", "GSM1974675", "GSM1974676", "GSM1974677", "GSM1974678", "GSM1974679", "GSM1974680", "GSM1974681", "GSM1974682", "GSM1974683", "GSM1974684", "GSM1974685", "GSM1974686", "GSM1974687", "GSM1974688", "GSM1974689", "GSM1974690", "GSM1974691", "GSM1974692", "GSM1974693", "GSM1974694", "GSM1974695", "GSM1974696", "GSM1974697", "GSM1974698", "GSM1974699", "GSM1974700", "GSM1974701", "GSM1974702", "GSM1974703", "GSM1974704", "GSM1974705", "GSM1974706", "GSM1974707", "GSM1974708", "GSM1974709", "GSM1974710", "GSM1974711", "GSM1974712", "GSM1974713", "GSM1974714", "GSM1974715", "GSM1974716", "GSM1974717", "GSM1974718", "GSM1974719", "GSM1974720", "GSM1974721", "GSM1974722", "GSM1974723", "GSM1974724", "GSM1974725", "GSM1974726", "GSM1974727", "GSM1974728", "GSM1974729", "GSM1974730", "GSM1974731", "GSM1974732", "GSM1974733", "GSM1974734", "GSM1974735", "GSM1974736", "GSM1974737", "GSM1974738", "GSM1974739", "GSM1974740", "GSM1974741", "GSM1974742", "GSM1974743", "GSM1974744", "GSM1974745", "GSM1974746", "GSM1974747", "GSM1974748", "GSM1974749", "GSM1974750", "GSM1974751", "GSM1974752", "GSM1974753", "GSM1974754", "GSM1974755", "GSM1974756", "GSM1974757", "GSM1974758", "GSM1974759", "GSM1974760", "GSM1974761", "GSM1974762", "GSM1974763"], "sample_count": 198, "group_sizes": null, "group_sizes_basis": null, "platform": "570", "taxon": "Homo sapiens", "title": "Comprehensive genomic analysis identify novel subtypes and targets of triple-negative breast cancer (198 TNBC tumors)", "resolution_checked_at": "2026-11-01T15:39:55Z", "resolution_check": "identifier_resolution_only_no_download_no_licence_read", "downloaded": false, "licence_read": false}}, {"id": "asset:table:pmid:33305312:1", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:75208ded423974deecc0edf04304e5de6cf8ca3c0108592728cff7abe854e32e", "bytes": 824, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[11]/table-wrap[1]#T1", "version": null, "note": "The primer sequence of the five key genes", "structure": {"pmcid": "PMC7789804", "section_index": 11, "section_title": "RNA isolation and determination of target gene expression using qRT-PCR", "row_count": 13, "column_count": 3}, "table": {"label": "Table 1", "caption": "The primer sequence of the five key genes", "rows": [["Gene symbol", "Primer category", "Primer sequence"], ["RPS9", "Forward primer", "GAAATCTCGTCTCGACCAAGAG"], ["", "Reverse primer", "GGTCCTTCTCATCAAGCGTCA"], ["RPS14", "Forward primer", "CCATGTCACTGATCTTTCTGGC"], ["", "Reverse primer", "TCATCTCGGTCTGCCTTTACC"], ["RPS27", "Forward primer", "ATGCCTCTCGCAAAGGATCTC"], ["", "Reverse primer", "TGAAGTAGGAATTGGGGCTCT"], ["RPL11", "Forward primer", "AAAGGTGCGGGAGTATGAGTT"], ["", "Reverse primer", "TCCAGGCCGTAGATACCAATG"], ["RPL14", "Forward primer", "GACCTTGCACTCAAGTGAGGA"], ["", "Reverse primer", "CTTGTCGGACATACTTCTGGTG"], ["GAPDH", "Forward primer", "ACAACTTTGGTATCGTGGAAGG"], ["", "Reverse primer", "GCCATCACGCCACAGTTTC"]], "row_count": 13, "column_count": 3, "numeric_cells": 4, "header_rows": 1, "locator": "section[11]/table-wrap[1]#T1"}}, {"id": "asset:table:pmid:33305312:2", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:6600f3f41ad07f91b7373e85319dfe6088bc8f0e8f23b13d02175f30281038a8", "bytes": 1619, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[14]/table-wrap[1]#T2", "version": null, "note": "Clinical characteristics of the TNBC and non-TNBC patients", "structure": {"pmcid": "PMC7789804", "section_index": 14, "section_title": "Identification of DEGs", "row_count": 25, "column_count": 9}, "table": {"label": "Table 2", "caption": "Clinical characteristics of the TNBC and non-TNBC patients", "rows": [["Characteristic", "All tumors", "TNBC", "Non-TNBC", "Chi-square", "P-value"], ["", "n", "%", "n", "%", "n", "%", "", ""], ["Age (years)", "322", "", "233", "", "89", "", "", ""], ["<50", "126", "39.13", "93", "39.91", "33", "37.08", "0.217", "0.641"], ["≥50", "196", "60.87", "140", "60.09", "56", "62.92", "", ""], ["Missing", "6", "", "6", "", "0", "", "", ""], ["Menopausal status", "297", "", "208", "", "89", "", "", ""], ["Premenopausal", "129", "43.43", "88", "42.31", "41", "46.07", "0.359", "0.549"], ["Postmenopausal", "168", "56.57", "120", "57.69", "48", "53.93", "", ""], ["Missing", "31", "", "31", "", "0", "", "", ""], ["Body mass index", "294", "", "206", "", "88", "", "", ""], ["Underweight (<18.5)", "7", "2.38", "3", "1.46", "4", "4.55", "22.313", "0.000"], ["Normal (18.5–24.9)", "115", "39.12", "65", "31.55", "50", "56.82", "", ""], ["Overweight (25–29.9)", "94", "31.97", "72", "34.95", "22", "25.00", "", ""], ["Obese (≥30)", "78", "26.53", "66", "32.04", "12", "13.64", "", ""], ["Missing", "34", "", "33", "", "1", "", "", ""], ["Tumor size (cm)", "312", "", "232", "", "80", "", "", ""], ["<2", "81", "25.96", "44", "18.97", "37", "46.25", "23.052", "0.000"], ["2–5", "203", "65.06", "165", "71.12", "38", "47.50", "", ""], [">5", "28", "8.97", "23", "9.91", "5", "6.25", "", ""], ["Missing", "16", "", "7", "", "9", "", "", ""], ["Metastases", "276", "", "187", "", "89", "", "", ""], ["No metastases", "246", "89.13", "173", "92.51", "73", "82.02", "6.85", "0.009"], ["Metastases found", "30", "10.87", "14", "7.49", "16", "17.98", "", ""], ["Unknown", "52", "", "52", "", "0", "", "", ""]], "row_count": 25, "column_count": 9, "numeric_cells": 127, "header_rows": 2, "locator": "section[14]/table-wrap[1]#T2"}}], "gaps": ["asset:data:geo:GSE65194 not downloaded", "asset:data:geo:GSE65194 licence not read", "asset:data:geo:GSE76124 not downloaded", "asset:data:geo:GSE76124 licence not read"]}, "analysis": {"state": "complete", "methods": [{"id": "method-1", "family": "network_analysis", "specific": "ppi_network", "label": "Network / pathway analysis", "dsl_operations": ["build_graph", "centrality_scores", "pathway_enrich"], "missing_operations": [], "expressible": true, "parameters": {}, "data_shapes": ["edge_list"], "evidence": {"score": 0.7, "band": "medium", "quote": "protein-protein interaction"}}, {"id": "method-2", "family": "network_analysis", "specific": "pathway_enrichment", "label": "Network / pathway analysis", "dsl_operations": ["pathway_enrich"], "missing_operations": [], "expressible": true, "parameters": {}, "data_shapes": ["edge_list"], "evidence": {"score": 0.8, "band": "high", "quote": "pathway enrichment"}}, {"id": "method-3", "family": "network_analysis", "specific": "centrality", "label": "Network / pathway analysis", "dsl_operations": ["build_graph", "centrality_scores", "pathway_enrich"], "missing_operations": [], "expressible": true, "parameters": {}, "data_shapes": ["edge_list"], "evidence": {"score": 0.7, "band": "medium", "quote": "centrality"}}], "targets": [], "gaps": []}, "capability": {"state": "complete", "requirements": [{"capability_id": "capability:computational_analysis", "label": "Computational analysis platform", "assay_families": ["meta_analysis", "machine_learning", "survival_analysis", "statistical_regression", "pca", "molecular_docking", "network_analysis", "differential_expression", "gwas"], "availability_state": "owned", "tier_unlocked": "R1", "candidate": "Automated Assays Laravel application and simulated adapters"}], "gaps": []}, "readiness": {"state": "complete", "tier": "R1", "blocking_axis": "none", "blocked_on": "nothing:replicable_now", "axes": {"method": {"tier": "R1", "expressible": true, "required_operations": ["build_graph", "centrality_scores", "pathway_enrich"], "missing_operations": [], "basis": "The paper names the method it used and the corpus's method extractor maps it onto the DSL catalogue: ppi_network."}, "capability": {"tier": "R1", "capability_id": "capability:computational_analysis", "availability_state": "owned", "basis": "The computational analysis is owned. The physical bench the paper used is not, so a physical validation cannot be run here."}, "data": {"tier": "R1", "reachable": true, "accessions": ["GSE65194", "GSE76124"], "resolved_accessions": ["GSE65194", "GSE76124"], "statements": ["Two expression profiling datasets (GSE65194 and GSE76124) were downloaded from the Gene Expression Omnibus (GEO) database (https://www.ncbi.nlm.nih.gov/geo/), an open platform for storing genetic data. The GSE65194 dataset contained 178 arrays. A total of 153 arrays were used to analyze 130 unique BC samples (41 cases of TNBC; 89 cases of non-TNBC) and 23 technical duplicates. In addition 11 normal breast tissue samples and 14 TNBC cell lines were included."], "basis": "The paper names GSE65194, GSE76124 in Gene Expression Omnibus (GEO) and the accession resolves in the repository. No dataset was downloaded and no licence was read."}}, "can_run": {"dsl_operations": ["build_graph", "centrality_scores", "pathway_enrich"], "assets": ["source:pmid:33305312", "data:geo:GSE65194", "asset:table:pmid:33305312:1", "asset:table:pmid:33305312:2"], "steps": ["run_analysis"]}, "must_build": {"dsl_operations": [], "converters": [], "readers": [], "capabilities": [], "data_gaps": ["data:geo:GSE65194"]}, "gaps": []}, "review": {"state": "partial", "machine_critique": {"kind": "extraction_review", "reader": {"model": "MiniMax-M3.1-Flash", "provider": "minimax", "provider_family": "minimax", "read_at": "2026-10-31T19:18:32Z", "independence": "single_reader"}, "evidence_check": {"method": null, "availability": null}, "calls": 3, "usage": {"prompt_tokens": 31361, "completion_tokens": 2064, "cached_tokens": 9984}}, "human_critique": null, "stages": [{"id": "extraction", "state": "complete", "reader": "MiniMax-M3.1-Flash", "provider": "minimax"}], "gaps": ["review.independent_reader", "review.machine_critique", "review.human_critique"]}, "execution": {"state": "absent", "status": "not_run", "mode": null, "runs": [], "gaps": ["execution.not_run"]}, "provenance": {"entities": [{"id": "pmid:33305312", "type": "paper", "label": "pmid:33305312"}, {"id": "source:pmid:33305312", "type": "manuscript", "label": "PMID 33305312 full text"}, {"id": "data:geo:GSE65194", "type": "dataset", "label": "GEO GSE65194"}], "activities": [{"id": "activity-reading-sci-2026-11-01", "type": "classification", "used": [{"id": "pmid:33305312", "type": "paper", "label": "pmid:33305312"}, {"id": "source:pmid:33305312", "type": "manuscript", "label": "PMID 33305312 full text"}, {"id": "data:geo:GSE65194", "type": "dataset", "label": "GEO GSE65194"}], "agent": "agent:corpus-assay-engine"}, {"id": "activity-read-33305312", "type": "extraction", "used": ["source:pmid:33305312"], "agent": "agent:minimax-reader"}, {"id": "activity-resolve-GSE65194", "type": "accession_resolution", "used": ["data:geo:GSE65194"], "agent": "agent:corpus-assay-engine"}], "agents": [{"id": "agent:corpus-assay-engine", "type": "software", "label": "Corpus assay engine"}, {"id": "agent:minimax-reader", "type": "software", "label": "MiniMax literature reader"}], "source_run_id": "reading-sci-2026-11-01", "dsl_catalogue_fingerprint": "343fb30756ba6ec3", "capability_table_fingerprint": "2cb3e42f047d2ecf", "snapshot_id": "ba34b49490d9bfaf"}, "lineage": {"parent_id": "pmid:33305312", "parent_hash": "sha256:e69c5d15000dd1dec4037524058eae0260a054bfc31ea8df0c2810dc29f0684c", "fork_of": null, "generation": 7}, "gaps": ["asset:data:geo:GSE65194 licence not read", "asset:data:geo:GSE65194 not downloaded", "asset:data:geo:GSE76124 licence not read", "asset:data:geo:GSE76124 not downloaded", "execution.not_run", "review.human_critique", "review.independent_reader", "review.machine_critique"], "assays": [{"role": "data_generation", "definition_id": "ihc", "definition_version": "99e1195c7d6f", "definition_digest": null, "required_operations": [], "support_state": "partial", "source_hashes": {"assay_lexicon": "99e1195c7d6f"}, "confidence": 0.93, "evidence": ["sed with TNBC or non-TNBC by biopsy specimen immunohistochemistry staining. The study has been approved by the"], "order_basis": "paper_text_order:4063", "id": "assay:1"}, {"role": "analysis", "definition_id": "network_analysis", "definition_version": "f2132e96ae6c7a4e", "definition_digest": null, "required_operations": ["build_graph", "centrality_scores", "pathway_enrich"], "support_state": "supported", "source_hashes": {"dsl_catalogue": "f2132e96ae6c7a4e"}, "confidence": 0.7, "evidence": ["protein-protein interaction"], "order_basis": "consumes_earlier_output", "id": "assay:2"}]}