Exosomal miR-3180-3p inhibits proliferation and metastasis of non-small cell lung cancer by downregulating FOXP4.

{"sci_version": "1.2", "schema": "https://corpus.bntrg.co.uk/sci/1.0/sci.schema.json", "id": "pmid:33350095", "kind": "science-record", "revision": 7, "content_hash": "sha256:587ed541a9e30ec22c68ad20fb6967ac4d8b10b07f05f90c41c8fc1480b89d6a", "created_at": "2026-11-01T15:41:20Z", "updated_at": "2026-11-01T22:02:47Z", "generator": {"name": "corpus-assay-engine", "run_id": "reading-sci-2026-11-01"}, "paper": {"state": "complete", "title": "Exosomal miR-3180-3p inhibits proliferation and metastasis of non-small cell lung cancer by downregulating FOXP4.", "doi": "10.1111/1759-7714.13759", "pmid": "33350095", "authors": ["Tengfei Chen", "Yali Liu", "Jun Chen", "Huifei Zheng", "Qiuyun Chen", "Jun Zhao"], "journal": "Thoracic cancer", "year": 2021, "abstract": "BACKGROUND: Non-small cell lung cancer (NSCLC) is one of the most malignant cancers worldwide and its pathogenesis is not completely clear. In this study, we explored the functions and mechanisms of exosomes transferring miR-3180-3p in NSCLC progression.\nMETHODS: The expression levels of miR-3180-3p in NSCLC tissues and paracarcinoma tissues was obtained from the GEO database (GEO: GSE53882). Exosomes derived from A549 cells were identified. Proliferation, migration and invasion were measured after treatment with exosomal miR-3180-3p or transfection using miR-3180-3p mimics. The relationship between miR-3180-3p and forkhead box P4 (FOXP4) was predicted using a bioinformatic tool and measured using a dual-luciferase reporter gene assay and western blotting. Finally, a mouse xenograft model of NSCLC cells was established to verify the function of exosomal miR-3180-3p in vivo.\nRESULTS: We found that miR-3180-3p decreased in both NSCLC cell lines and patient tissues. Overexpression of miR-3180-3p or treatment with exosomal miR-3180-3p significantly suppressed cell proliferation and metastasis in NSCLC cell lines. Subsequently, we found miR-3180-3p downregulated FOXP4 protein expression levels. Furthermore, the volumes and weights of nude mouse tumors expressing exosomal miR-3180-3p were significantly reduced.\nCONCLUSIONS: Exosomal miR-3180-3p suppresses NSCLC progression by downregulating FOXP4 expression.\nKEY POINTS: SIGNIFICANT FINDINGS OF THE STUDY: We found that exosomal miR-3180-3p suppressed NSCLC progression and also identified a miR-3180-3p target gene. These findings provide a foundation to determine innovative therapeutic strategies.\nWHAT THIS STUDY ADDS: This study contributes to research investigating exosomal containing miRNAs.", "claims": [{"id": "claim-method", "statement": "The Student's t‐test was used in statistical analysis.", "kind": "methodological", "target": null, "evidence": [{"asset": "source:pmid:33350095", "locator": "sections[10] \"Statistical analysis\" paragraph 2", "quote": "The Student's t‐test was used in statistical analysis."}], "state": "complete"}, {"id": "claim-data-access", "statement": "NSCLC expression profile data was extracted from the GEO database (GEO: GSE53882).", "kind": "methodological", "target": null, "evidence": [{"asset": "source:pmid:33350095", "locator": "sections[12] \"miR‐3180‐3p was expressed at low levels in NSCLC patients\" paragraph 2", "quote": "NSCLC expression profile data was extracted from the GEO database (GEO: GSE53882)."}], "state": "complete"}], "gaps": []}, "experiment": {"state": "partial", "objective": null, "steps": [{"id": "read_published_estimate", "order": 1, "name": "Read the published estimate from the source", "kind": "other", "state": "complete", "blocked_on": null, "description": "The claim, method and evidence span published with the source article.", "duration_hours": null, "parameters": {}, "inputs": ["source:pmid:33350095"], "outputs": ["the published estimate and its evidence"], "instruments": [], "reagents": []}, {"id": "obtain_source_data", "order": 2, "name": "Obtain the source data from the named repository", "kind": "data-preparation", "state": "blocked", "blocked_on": "data:accession_absent", "description": "The GEO series accession resolves and its sample accessions are listed. This lane did not download the dataset or read its licence.", "duration_hours": null, "parameters": {}, "inputs": [], "outputs": ["the source data with its repository provenance"], "instruments": [], "reagents": []}, {"id": "run_analysis", "order": 3, "name": "Run the published analysis", "kind": "analysis", "state": "blocked", "blocked_on": "method:student_t", "description": "Apply the paper's statistical method to the resolved series and compare the result with the published target.", "duration_hours": null, "parameters": {}, "inputs": [], "outputs": ["the replicated result and its comparison"], "instruments": [], "reagents": []}], "materials": [], "instruments": [], "reagents": [], "conditions": {}, "gaps": ["step:run_analysis blocked on method:student_t", "step:obtain_source_data blocked on data:accession_absent"]}, "data": {"state": "partial", "assets": [{"id": "source:pmid:33350095", "role": "manuscript", "format": "xml", "media_type": "application/xml", "uri": "https://doi.org/10.1111/1759-7714.13759", "sha256": "sha256:5af7abd0d553c34e555b4f530a6075bca3dec840d21d3aec069df614d0e7ec14", "bytes": 30141, "access": "open", "state": "resolved", "reader": null, "reader_status": "reader_required", "identifier": "10.1111/1759-7714.13759", "version": null, "note": "Full article fetched from PMC; the checksum covers the rendered section body, not the original XML bytes.", "structure": {"pmcid": "PMC7862798", "source": "europe_pmc_fulltext", "coverage": "whole_body", "text_hash_scope": "rendered_section_body"}}, {"id": "asset:table:pmid:33350095:1", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:38bfbc2ffcffe01dcdb45791b773d1409b65f46365d3e40d0e9555f2c4edd123", "bytes": 482, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[7]/table-wrap[1]#tca13759-tbl-0001", "version": null, "note": "Primer sequences used in qRT‐PCR", "structure": {"pmcid": "PMC7862798", "section_index": 7, "section_title": "qRT‐PCR", "row_count": 9, "column_count": 2}, "table": {"label": "Table 1", "caption": "Primer sequences used in qRT‐PCR", "rows": [["Gene", "Primer sequence (5′–3′)"], ["miR‐3180‐3p", "F: GCGTGGGGCGGAGCTT"], ["R: AGTGCAGGGTCCGAGGTATT"], ["U6", "F: AGAGCCTGTGGTGTCCG"], ["R: CATCTTCAAAGCACTTCCCT"], ["GAPDH", "F: CCTTCCGTGTCCCCACT"], ["R: GCCTGCTTCACCACCTTC"], ["FOXP4", "F: AGGACACGGAGGGTTCAG"], ["R: TGTGGGGAGAGCTGGTG"]], "row_count": 9, "column_count": 2, "numeric_cells": 2, "header_rows": 1, "locator": "section[7]/table-wrap[1]#tca13759-tbl-0001"}}], "gaps": []}, "analysis": {"state": "partial", "methods": [{"id": "method-1", "family": "group_comparison", "specific": "student_t_test", "label": "Group comparison", "dsl_operations": [], "missing_operations": ["student_t"], "expressible": false, "parameters": {}, "data_shapes": ["two_or_more_groups_continuous"], "evidence": {"score": 1.0, "band": "verbatim", "quote": "The Student's t‐test was used in statistical analysis."}}], "targets": [], "gaps": ["method.student_t"]}, "capability": {"state": "complete", "requirements": [{"capability_id": "capability:computational_analysis", "label": "Computational analysis platform", "assay_families": ["meta_analysis", "machine_learning", "survival_analysis", "statistical_regression", "pca", "molecular_docking", "network_analysis", "differential_expression", "gwas"], "availability_state": "owned", "tier_unlocked": "R1", "candidate": "Automated Assays Laravel application and simulated adapters"}], "gaps": []}, "readiness": {"state": "blocked", "tier": "R4", "blocking_axis": "data", "blocked_on": "data:accession_absent", "axes": {"method": {"tier": "R1", "expressible": false, "required_operations": [], "missing_operations": ["student_t"], "basis": "The paper names the method it used and the corpus's method extractor maps it onto the DSL catalogue: student_t_test."}, "capability": {"tier": "R1", "capability_id": "capability:computational_analysis", "availability_state": "owned", "basis": "The computational analysis is owned. The physical bench the paper used is not, so a physical validation cannot be run here."}, "data": {"tier": "R4", "reachable": false, "accessions": ["GEO: GSE53882"], "resolved_accessions": [], "statements": ["NSCLC expression profile data was extracted from the GEO database (GEO: GSE53882)."], "basis": "The paper names GEO: GSE53882, but the accession does not resolve in the repository (no reason recorded), so the data cannot be reached from here. No dataset was downloaded and no licence was read."}}, "can_run": {"dsl_operations": [], "assets": ["source:pmid:33350095", "asset:table:pmid:33350095:1"], "steps": []}, "must_build": {"dsl_operations": [{"operation": "student_t", "unlocks_papers": null, "priority": null}], "converters": [], "readers": [], "capabilities": [], "data_gaps": ["data:geo:None"]}, "gaps": ["data:accession_absent"]}, "review": {"state": "partial", "machine_critique": {"kind": "extraction_review", "reader": {"model": "MiniMax-M3.1-Flash", "provider": "minimax", "provider_family": "minimax", "read_at": "2026-10-31T18:25:18Z", "independence": "single_reader"}, "evidence_check": {"method": "verbatim", "availability": null}, "calls": 3, "usage": {"prompt_tokens": 27475, "completion_tokens": 688, "cached_tokens": 784}}, "human_critique": null, "stages": [{"id": "extraction", "state": "complete", "reader": "MiniMax-M3.1-Flash", "provider": "minimax"}], "gaps": ["review.independent_reader", "review.machine_critique", "review.human_critique"]}, "execution": {"state": "absent", "status": "not_run", "mode": null, "runs": [], "gaps": ["execution.not_run"]}, "provenance": {"entities": [{"id": "pmid:33350095", "type": "paper", "label": "pmid:33350095"}, {"id": "source:pmid:33350095", "type": "manuscript", "label": "PMID 33350095 full text"}, {"id": "data:geo:None", "type": "dataset", "label": "GEO None"}], "activities": [{"id": "activity-reading-sci-2026-11-01", "type": "classification", "used": [{"id": "pmid:33350095", "type": "paper", "label": "pmid:33350095"}, {"id": "source:pmid:33350095", "type": "manuscript", "label": "PMID 33350095 full text"}, {"id": "data:geo:None", "type": "dataset", "label": "GEO None"}], "agent": "agent:corpus-assay-engine"}, {"id": "activity-read-33350095", "type": "extraction", "used": ["source:pmid:33350095"], "agent": "agent:minimax-reader"}, {"id": "activity-resolve-None", "type": "accession_resolution", "used": ["data:geo:None"], "agent": "agent:corpus-assay-engine"}], "agents": [{"id": "agent:corpus-assay-engine", "type": "software", "label": "Corpus assay engine"}, {"id": "agent:minimax-reader", "type": "software", "label": "MiniMax literature reader"}], "source_run_id": "reading-sci-2026-11-01", "dsl_catalogue_fingerprint": "343fb30756ba6ec3", "capability_table_fingerprint": "2cb3e42f047d2ecf", "snapshot_id": "ba34b49490d9bfaf"}, "lineage": {"parent_id": "pmid:33350095", "parent_hash": "sha256:72695149333ded425a8e0e1de3c7404be21938e570c0824cbb502d32be19d341", "fork_of": null, "generation": 6}, "gaps": ["execution.not_run", "method.student_t", "review.human_critique", "review.independent_reader", "review.machine_critique", "step:obtain_source_data blocked on data:accession_absent", "step:run_analysis blocked on method:student_t"], "assays": [{"role": "data_generation", "definition_id": "cell_culture", "definition_version": "99e1195c7d6f", "definition_digest": null, "required_operations": [], "support_state": "partial", "source_hashes": {"assay_lexicon": "99e1195c7d6f"}, "confidence": 0.99, "evidence": ["abase (GEO: GSE53882). Exosomes derived from A549 cells were identified. Proliferation, migrat", "inese Academy of Sciences (Shanghai, China). Cell lines were cultured in RPMI‐1640 (Sigma) supplemented with 10% F", "Sciences (Shanghai, China). Cell lines were cultured in RPMI‐1640 (Sigma) supplemented with 10% FBS", "R‐3180‐3p levels were significantly lower in A549 and H460 cell lines compared to the normal c"], "order_basis": "paper_text_order:487", "id": "assay:1"}, {"role": "data_generation", "definition_id": "transfection", "definition_version": "99e1195c7d6f", "definition_digest": null, "required_operations": [], "support_state": "partial", "source_hashes": {"assay_lexicon": "99e1195c7d6f"}, "confidence": 0.99, "evidence": ["after treatment with exosomal miR-3180-3p or transfection using miR-3180-3p mimics. The relationship b", "8 assay was performed in A549 and H460 cells transfected with miR‐3180‐3p or miR‐NC. A549: , miR‐NC;", "nd invasive abilities of A549 and H460 cells transfected with miR‐3180‐3p and miR‐NC was measured usi"], "order_basis": "paper_text_order:612", "id": "assay:2"}, {"role": "data_generation", "definition_id": "western_blot", "definition_version": "99e1195c7d6f", "definition_digest": null, "required_operations": [], "support_state": "partial", "source_hashes": {"assay_lexicon": "99e1195c7d6f"}, "confidence": 0.93, "evidence": ["ng a dual-luciferase reporter gene assay and western blotting. Finally, a mouse xenograft model of NSCLC c"], "order_basis": "paper_text_order:818", "id": "assay:3"}, {"role": "data_generation", "definition_id": "animal_model", "definition_version": "99e1195c7d6f", "definition_digest": null, "required_operations": [], "support_state": "partial", "source_hashes": {"assay_lexicon": "99e1195c7d6f"}, "confidence": 0.99, "evidence": ["verify the function of exosomal miR-3180-3p in vivo. RESULTS: We found that miR-3180-3p decrease", "gene assay and western blotting. Finally, a mouse xenograft model of NSCLC cells was establish", "Furthermore, the volumes and weights of nude mouse tumors expressing exosomal miR-3180-3p were"], "order_basis": "paper_text_order:848", "id": "assay:4"}, {"role": "analysis", "definition_id": "group_comparison", "definition_version": "f2132e96ae6c7a4e", "definition_digest": null, "required_operations": [], "support_state": "partial", "source_hashes": {"dsl_catalogue": "f2132e96ae6c7a4e"}, "confidence": 1.0, "evidence": ["The Student's t‐test was used in statistical analysis."], "order_basis": "consumes_earlier_output", "id": "assay:5"}]}