Overexpression of chemokine receptor lymphotactin receptor 1 has prognostic value in clear cell renal cell carcinoma.

{"sci_version": "1.2", "schema": "https://corpus.bntrg.co.uk/sci/1.0/sci.schema.json", "id": "pmid:33377624", "kind": "science-record", "revision": 6, "content_hash": "sha256:ff17cc4d988bce875c41909cc5f7c5d11166f50c698e491c344cd326e2102186", "created_at": "2026-11-01T15:41:20Z", "updated_at": "2026-11-01T21:24:24Z", "generator": {"name": "corpus-assay-engine", "run_id": "reading-sci-2026-11-01"}, "paper": {"state": "complete", "title": "Overexpression of chemokine receptor lymphotactin receptor 1 has prognostic value in clear cell renal cell carcinoma.", "doi": "10.1002/mgg3.1551", "pmid": "33377624", "authors": ["Xian Chang", "Ya Cao", "Wan-Lei Fu", "Xue-Feng Tang", "Ya-Li Wang", "Yang-Fan Lv", "Qiao-Nan Guo"], "journal": "Molecular genetics & genomic medicine", "year": 2021, "abstract": "BACKGROUND: Clear cell renal cell carcinoma (ccRCC) is an aggressive subtype of renal cell carcinoma. X-C motif chemokine receptor 1 (XCR1) exerts important roles in tumor progression; however, its role in ccRCC is unclear.\nMETHODS: We utilized publicly available data from The Cancer Genome Atlas (TCGA) to assess the role of XCR1 in ccRCC and validated the results in 36 samples from patients with ccRCC who underwent curative resection in Xinqiao Hospital Chongqing. XCR1 overexpression was identified in ccRCC, which was confirmed by qRT-PCR assay and immunohistochemical staining of ccRCC samples.\nRESULTS: For the TCGA and clinical data, Kaplan-Meier survival analysis revealed that higher XCR1 expression in ccRCC was related to longer overall survival. Cox regression analysis suggested that XCR1 is an independent risk factor for ccRCC. GSEA analysis suggested that XCR1 is associated with the JAK/STAT signaling pathway. XCR1 knockdown by small interfering RNA (siRNA) significantly increased ccRCC cell proliferation and migration, and decreased cell apoptosis.\nCONCLUSION: We found higher XCR1 expression in ccRCC compared with that in normal tissues is related to longer overall survival in patients with ccRCC. XCR1 knockdown significantly increased RCC cells proliferation and migration, and decreased apoptosis. XCR1 might be used as a prognostic biomarker in ccRCC in the future.", "claims": [{"id": "claim-method", "statement": "For association analysis between IHC samples and clinical‐pathological parameters analysis, the Pearson χ2 test was used.", "kind": "methodological", "target": null, "evidence": [{"asset": "source:pmid:33377624", "locator": "sections[12] \"Statistical analysis\" paragraph 2", "quote": "For association analysis between IHC samples and clinical‐pathological parameters analysis, the Pearson χ2 test was used."}], "state": "complete"}, {"id": "claim-data-access", "statement": "The data of this study are available from the corresponding author upon reasonable request.", "kind": "methodological", "target": null, "evidence": [{"asset": "source:pmid:33377624", "locator": "sections[24] \"DATA AVAILABILITY STATEMENT\" paragraph 2", "quote": "The data of this study are available from the corresponding author upon reasonable request."}], "state": "complete"}], "gaps": []}, "experiment": {"state": "partial", "objective": null, "steps": [{"id": "read_published_estimate", "order": 1, "name": "Read the published estimate from the source", "kind": "other", "state": "complete", "blocked_on": null, "description": "The claim, method and evidence span published with the source article.", "duration_hours": null, "parameters": {}, "inputs": ["source:pmid:33377624"], "outputs": ["the published estimate and its evidence"], "instruments": [], "reagents": []}, {"id": "obtain_source_data", "order": 2, "name": "Obtain the source data from the named repository", "kind": "data-preparation", "state": "blocked", "blocked_on": "data:accession_absent", "description": "The GEO series accession resolves and its sample accessions are listed. This lane did not download the dataset or read its licence.", "duration_hours": null, "parameters": {}, "inputs": [], "outputs": ["the source data with its repository provenance"], "instruments": [], "reagents": []}, {"id": "run_analysis", "order": 3, "name": "Run the published analysis", "kind": "analysis", "state": "complete", "blocked_on": null, "description": "Apply the paper's statistical method to the resolved series and compare the result with the published target.", "duration_hours": null, "parameters": {}, "inputs": [], "outputs": ["the replicated result and its comparison"], "instruments": [], "reagents": []}], "materials": [], "instruments": [], "reagents": [], "conditions": {}, "gaps": ["step:obtain_source_data blocked on data:accession_absent"]}, "data": {"state": "partial", "assets": [{"id": "source:pmid:33377624", "role": "manuscript", "format": "xml", "media_type": "application/xml", "uri": "https://doi.org/10.1002/mgg3.1551", "sha256": "sha256:83314057bc52dff9b921e4474f1f1a12a70f87bcfce09158716a3995230b4369", "bytes": 27594, "access": "open", "state": "resolved", "reader": null, "reader_status": "reader_required", "identifier": "10.1002/mgg3.1551", "version": null, "note": "Full article fetched from PMC; the checksum covers the rendered section body, not the original XML bytes.", "structure": {"pmcid": "PMC7963425", "source": "europe_pmc_fulltext", "coverage": "whole_body_without_references", "text_hash_scope": "rendered_section_body"}}, {"id": "asset:table:pmid:33377624:1", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:ee82daf49171e43162a2ffb549ed06807aa557a9194c79b674f472b5fba1d5be", "bytes": 406, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[7]/table-wrap[1]#mgg31551-tbl-0001", "version": null, "note": "Primer pairs used for real‐time PCR.", "structure": {"pmcid": "PMC7963425", "section_index": 7, "section_title": "RNA extraction, reverse transcription, and quantitative real‐time PCR", "row_count": 3, "column_count": 3}, "table": {"label": "Table 1", "caption": "Primer pairs used for real‐time PCR.", "rows": [["Gene", "Forward primer sequence (5′ to 3′)", "Reverse primer sequence (5′ to 3′)"], ["GAPDH", "CGCTGAGTACGTCGTGGAGTC", "GCTGATGATCTTGAGGCTGTTGTC"], ["XCR1", "TACCTCACCTCCGTCTACCA", "GATGAGCAGGGCGTATTCTA"]], "row_count": 3, "column_count": 3, "numeric_cells": 2, "header_rows": 1, "locator": "section[7]/table-wrap[1]#mgg31551-tbl-0001"}}, {"id": "asset:table:pmid:33377624:2", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:0f75e6632bfc58dc5d8b633589bf3e44d4abfc376896e129522df3993fe64080", "bytes": 684, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[14]/table-wrap[1]#mgg31551-tbl-0002", "version": null, "note": "Clinicopathological features of patients included in this study.", "structure": {"pmcid": "PMC7963425", "section_index": 14, "section_title": "Patient characteristics", "row_count": 22, "column_count": 3}, "table": {"label": "Table 2", "caption": "Clinicopathological features of patients included in this study.", "rows": [["", "TCGA database", "Clinical Samples"], ["Total", "539", "36"], ["Age", "26–90 (61)", "24–78 (56)"], ["Gender"], ["Male", "348", "23"], ["Female", "191", "13"], ["Grade"], ["G1", "14", "3"], ["G2", "230", "13"], ["G3", "207", "15"], ["G4", "78", "5"], ["NA", "10", "0"], ["TNM staging"], ["Ⅰ", "269", "11"], ["Ⅱ", "57", "15"], ["Ⅲ", "125", "8"], ["Ⅳ", "83", "2"], ["NA", "5", "0"], ["Follow‐up, months", "0–121", "20–83"], ["Survival condition"], ["Dead", "172", "8"], ["Alive", "367", "28"]], "row_count": 22, "column_count": 3, "numeric_cells": 34, "header_rows": 1, "locator": "section[14]/table-wrap[1]#mgg31551-tbl-0002"}}, {"id": "asset:table:pmid:33377624:3", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:56dca27834fc6e06d8a86501ce576dae25a22aaa79b849ef7d1b22d994d20394", "bytes": 690, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[16]/table-wrap[1]#mgg31551-tbl-0003", "version": null, "note": "Association between XCR1 expression and the clinic‐pathological characteristics of clinical samples from ccRCC patients.", "structure": {"pmcid": "PMC7963425", "section_index": 16, "section_title": "Correlation between XCR1 expression and ccRCC malignancy", "row_count": 18, "column_count": 4}, "table": {"label": "Table 3", "caption": "Association between XCR1 expression and the clinic‐pathological characteristics of clinical samples from ccRCC patients.", "rows": [["Characteristics", "Positive", "Negative", "P‐value"], ["Age", "", "", ""], ["<45", "7", "4", "0.984"], ["≥45", "16", "9", ""], ["", "", "", ""], ["Gender", "14", "9", ""], ["Male", "9", "4", "0.621"], ["female", "", ""], ["Grade", "2", "1", ""], ["Ⅰ", "5", "8", "0.125"], ["Ⅱ", "12", "3", ""], ["Ⅲ", "4", "1", ""], ["Ⅳ", "", "", ""], ["TNM staging", "8", "3", ""], ["Ⅰ", "3", "12", "0.019"], ["Ⅱ", "1", "7", ""], ["Ⅲ", "1", "1", ""], ["Ⅳ", "", "", ""]], "row_count": 18, "column_count": 4, "numeric_cells": 30, "header_rows": 1, "locator": "section[16]/table-wrap[1]#mgg31551-tbl-0003"}}, {"id": "asset:table:pmid:33377624:4", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:a69b139059ae2ea2876df46d01d56c219858b7b11576cdc4cde3a017edc05ec9", "bytes": 1055, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[16]/table-wrap[2]#mgg31551-tbl-0004", "version": null, "note": "Cox regression analysis of XCR1 mRNA levels and patient overall survival with ccRCC.", "structure": {"pmcid": "PMC7963425", "section_index": 16, "section_title": "Correlation between XCR1 expression and ccRCC malignancy", "row_count": 9, "column_count": 9}, "table": {"label": "Table 4", "caption": "Cox regression analysis of XCR1 mRNA levels and patient overall survival with ccRCC.", "rows": [["Variable", "Univariate analysis", "Multivariate analysis"], ["HR", "HR.95L", "HR.95H", "P value", "HR", "HR.95L", "HR.95H", "P value"], ["age", "1.032826", "1.019083", "1.046754", "2.29E−06", "1.034216", "1.018615", "1.050057", "1.44E−05"], ["Sex", "0.931081", "0.675354", "1.283641", "0.662937", "0.962538", "0.692753", "1.337389", "0.820013"], ["Grade", "2.293061", "1.854092", "2.835959", "1.94E−14", "1.652044", "1.294088", "2.109014", "5.60E−05"], ["Stage", "1.888786", "1.648774", "2.163737", "4.67E−20", "1.707664", "1.076801", "2.708128", "0.022938"], ["T", "1.94139", "1.639292", "2.29916", "1.50E−14", "0.86604", "0.566668", "1.32357", "0.506312"], ["M", "4.283544", "3.105734", "5.908024", "7.45E−19", "1.242764", "0.625942", "2.467424", "0.534532"], ["XCR1", "0.815312", "0.638049", "1.041823", "0.102594", "0.720596", "0.56334", "0.921749", "0.00909"]], "row_count": 9, "column_count": 9, "numeric_cells": 60, "header_rows": 2, "locator": "section[16]/table-wrap[2]#mgg31551-tbl-0004"}}, {"id": "asset:table:pmid:33377624:5", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:8e55112a74393e925d0e2de7dbf6e495835853d3f8e3f7f446cff14800131f43", "bytes": 648, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[17]/table-wrap[1]#mgg31551-tbl-0005", "version": null, "note": "Top five signaling pathways enriched in the XCR1 upregulation group.", "structure": {"pmcid": "PMC7963425", "section_index": 17, "section_title": "GSEA identified XCR1‐related signaling pathways", "row_count": 6, "column_count": 6}, "table": {"label": "Table 5", "caption": "Top five signaling pathways enriched in the XCR1 upregulation group.", "rows": [["Rank", "Name of pathway", "ES", "NES", "NOM p‐val", "FDR q‐val"], ["1", "HUNTINGTONS_DISEASE", "0.616067", "2.251294", "0", "0.01076"], ["2", "CARDIAC_MUSCLE_CONTRACTION", "0.614087", "2.145381", "0", "0.022747"], ["3", "OXIDATIVE_PHOSPHORYLATION", "0.806736", "2.122762", "0", "0.020029"], ["4", "BUTANOATE_METABOLISM", "0.714311", "2.092098", "0.004141", "0.019135"], ["5", "PARKINSONS_DISEASE", "0.716557", "2.081168", "0.001957", "0.017659"]], "row_count": 6, "column_count": 6, "numeric_cells": 25, "header_rows": 1, "locator": "section[17]/table-wrap[1]#mgg31551-tbl-0005"}}, {"id": "asset:table:pmid:33377624:6", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:23f65f535d45b04dd223a4a3005e3de7c0bfd1cf4a5cd453684203cca532eacf", "bytes": 1083, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[17]/table-wrap[2]#mgg31551-tbl-0006", "version": null, "note": "Top 10 signaling pathways enriched in the XCR1 downregulation group.", "structure": {"pmcid": "PMC7963425", "section_index": 17, "section_title": "GSEA identified XCR1‐related signaling pathways", "row_count": 11, "column_count": 6}, "table": {"label": "Table 6", "caption": "Top 10 signaling pathways enriched in the XCR1 downregulation group.", "rows": [["Rank", "Name of pathway", "Es", "NES", "NOM p‐val", "FDR q‐val"], ["1", "JAK STAT SIGNALING PATHWAY", "−0.6941993", "−2.92982", "0", "0"], ["2", "NON SMALL CELL LUNG CANCER", "−0.55117565", "−1.92028", "0.010204", "0.022405"], ["3", "ACUTE MYELOID LEUKEMIA", "−0.5652863", "−1.91111", "0.013834", "0.023524"], ["4", "VEGF SIGNALING PATHWAY", "−0.45163378", "−1.90325", "0", "0.02442"], ["5", "CHRONIC MYELOID LEUKEMIA", "−0.5741395", "−1.9007", "0.014553", "0.024273"], ["6", "PANCREATIC CANCER", "−0.56183416", "−1.88966", "0.02439", "0.025081"], ["7", "PATHWAYS IN CANCER", "−0.4609015", "−1.88757", "0.014315", "0.024817"], ["8", "SMALL CELL LUNG CANCER", "−0.5270194", "−1.83966", "0.022222", "0.030835"], ["9", "COLORECTAL CANCER", "−0.5336979", "−1.78094", "0.027083", "0.043837"], ["10", "RENAL CELL CARCINOMA", "−0.53083134", "−1.76747", "0.034836", "0.045633"]], "row_count": 11, "column_count": 6, "numeric_cells": 50, "header_rows": 1, "locator": "section[17]/table-wrap[2]#mgg31551-tbl-0006"}}], "gaps": []}, "analysis": {"state": "partial", "methods": [{"id": "method-1", "family": "survival_analysis", "specific": "kaplan_meier", "label": "Survival analysis", "dsl_operations": ["survival_km"], "missing_operations": [], "expressible": true, "parameters": {}, "data_shapes": ["time_to_event_with_censoring"], "evidence": {"score": 0.7, "band": "medium", "quote": "Kaplan-Meier"}}, {"id": "method-2", "family": "survival_analysis", "specific": "cox_proportional_hazards", "label": "Survival analysis", "dsl_operations": ["cox_ph"], "missing_operations": [], "expressible": true, "parameters": {}, "data_shapes": ["time_to_event_with_censoring"], "evidence": {"score": 0.7, "band": "medium", "quote": "Cox regression"}}, {"id": "method-3", "family": "contingency_analysis", "specific": "chi_square", "label": "Categorical (contingency table) analysis", "dsl_operations": ["chi_square_test"], "missing_operations": [], "expressible": true, "parameters": {}, "data_shapes": ["categorical_cross_tabulation"], "evidence": {"score": 0.8, "band": "high", "quote": "χ2"}}, {"id": "method-4", "family": null, "specific": null, "label": "Pearson χ² test", "dsl_operations": [], "missing_operations": [], "expressible": null, "parameters": {}, "data_shapes": [], "evidence": {"score": 1.0, "band": "verbatim", "quote": "For association analysis between IHC samples and clinical‐pathological parameters analysis, the Pearson χ2 test was used."}}], "targets": [], "gaps": ["method.reader_named_unmapped"]}, "capability": {"state": "complete", "requirements": [{"capability_id": "capability:computational_analysis", "label": "Computational analysis platform", "assay_families": ["meta_analysis", "machine_learning", "survival_analysis", "statistical_regression", "pca", "molecular_docking", "network_analysis", "differential_expression", "gwas"], "availability_state": "owned", "tier_unlocked": "R1", "candidate": "Automated Assays Laravel application and simulated adapters"}], "gaps": []}, "readiness": {"state": "blocked", "tier": "R4", "blocking_axis": "data", "blocked_on": "data:accession_absent", "axes": {"method": {"tier": "R1", "expressible": true, "required_operations": ["survival_km"], "missing_operations": [], "basis": "The paper names the method it used and the corpus's method extractor maps it onto the DSL catalogue: kaplan_meier."}, "capability": {"tier": "R1", "capability_id": "capability:computational_analysis", "availability_state": "owned", "basis": "The computational analysis is owned. The physical bench the paper used is not, so a physical validation cannot be run here."}, "data": {"tier": "R4", "reachable": false, "accessions": [], "resolved_accessions": [], "statements": ["The data of this study are available from the corresponding author upon reasonable request."], "basis": "The paper names no accession to its source data, so the data has to come from the authors."}}, "can_run": {"dsl_operations": ["survival_km"], "assets": ["source:pmid:33377624", "asset:table:pmid:33377624:1", "asset:table:pmid:33377624:2", "asset:table:pmid:33377624:3", "asset:table:pmid:33377624:4", "asset:table:pmid:33377624:5", "asset:table:pmid:33377624:6"], "steps": ["run_analysis"]}, "must_build": {"dsl_operations": [], "converters": [], "readers": [], "capabilities": [], "data_gaps": ["data:geo:None"]}, "gaps": ["data:accession_absent"]}, "review": {"state": "partial", "machine_critique": {"kind": "extraction_review", "reader": {"model": "MiniMax-M3.1-Flash", "provider": "minimax", "provider_family": "minimax", "read_at": "2026-10-31T18:25:34Z", "independence": "single_reader"}, "evidence_check": {"method": "verbatim", "availability": "verbatim"}, "calls": 3, "usage": {"prompt_tokens": 22004, "completion_tokens": 1258, "cached_tokens": 7432}}, "human_critique": null, "stages": [{"id": "extraction", "state": "complete", "reader": "MiniMax-M3.1-Flash", "provider": "minimax"}], "gaps": ["review.independent_reader", "review.machine_critique", "review.human_critique"]}, "execution": {"state": "absent", "status": "not_run", "mode": null, "runs": [], "gaps": ["execution.not_run"]}, "provenance": {"entities": [{"id": "pmid:33377624", "type": "paper", "label": "pmid:33377624"}, {"id": "source:pmid:33377624", "type": "manuscript", "label": "PMID 33377624 full text"}, {"id": "data:geo:None", "type": "dataset", "label": "GEO None"}], "activities": [{"id": "activity-reading-sci-2026-11-01", "type": "classification", "used": [{"id": "pmid:33377624", "type": "paper", "label": "pmid:33377624"}, {"id": "source:pmid:33377624", "type": "manuscript", "label": "PMID 33377624 full text"}, {"id": "data:geo:None", "type": "dataset", "label": "GEO None"}], "agent": "agent:corpus-assay-engine"}, {"id": "activity-read-33377624", "type": "extraction", "used": ["source:pmid:33377624"], "agent": "agent:minimax-reader"}, {"id": "activity-resolve-None", "type": "accession_resolution", "used": ["data:geo:None"], "agent": "agent:corpus-assay-engine"}], "agents": [{"id": "agent:corpus-assay-engine", "type": "software", "label": "Corpus assay engine"}, {"id": "agent:minimax-reader", "type": "software", "label": "MiniMax literature reader"}], "source_run_id": "reading-sci-2026-11-01", "dsl_catalogue_fingerprint": "343fb30756ba6ec3", "capability_table_fingerprint": "2cb3e42f047d2ecf", "snapshot_id": "ba34b49490d9bfaf"}, "lineage": {"parent_id": "pmid:33377624", "parent_hash": "sha256:018573f89779b532508840d668c4713df5bb02d7abc42f2d92574dbb942f9c87", "fork_of": null, "generation": 5}, "gaps": ["execution.not_run", "method.reader_named_unmapped", "review.human_critique", "review.independent_reader", "review.machine_critique", "step:obtain_source_data blocked on data:accession_absent"], "assays": [{"role": "data_generation", "definition_id": "ihc", "definition_version": "99e1195c7d6f", "definition_digest": null, "required_operations": [], "support_state": "partial", "source_hashes": {"assay_lexicon": "99e1195c7d6f"}, "confidence": 0.99, "evidence": ["CC, which was confirmed by qRT-PCR assay and immunohistochemical staining of ccRCC samples. RESULTS: For the", "ignificant. For association analysis between IHC samples and clinical‐pathological parameters"], "order_basis": "paper_text_order:629", "id": "assay:1"}, {"role": "data_generation", "definition_id": "transfection", "definition_version": "99e1195c7d6f", "definition_digest": null, "required_operations": [], "support_state": "partial", "source_hashes": {"assay_lexicon": "99e1195c7d6f"}, "confidence": 0.99, "evidence": ["ed with the JAK/STAT signaling pathway. XCR1 knockdown by small interfering RNA (siRNA) significant", "verall survival in patients with ccRCC. XCR1 knockdown significantly increased RCC cells proliferat", "ay. XCR1 knockdown by small interfering RNA (siRNA) significantly increased ccRCC cell prolifer"], "order_basis": "paper_text_order:1009", "id": "assay:2"}, {"role": "data_generation", "definition_id": "apoptosis_assay", "definition_version": "99e1195c7d6f", "definition_digest": null, "required_operations": [], "support_state": "partial", "source_hashes": {"assay_lexicon": "99e1195c7d6f"}, "confidence": 0.93, "evidence": ["liferation and migration, and decreased cell apoptosis. CONCLUSION: We found higher XCR1 expression", "s proliferation and migration, and decreased apoptosis. XCR1 might be used as a prognostic biomarke"], "order_basis": "paper_text_order:1135", "id": "assay:3"}, {"role": "data_generation", "definition_id": "rna_seq", "definition_version": "99e1195c7d6f", "definition_digest": null, "required_operations": [], "support_state": "partial", "source_hashes": {"assay_lexicon": "99e1195c7d6f"}, "confidence": 0.93, "evidence": ["ferential mRNA expression. Subsequently, the RNA sequencing (RNA‐Seq) gene expression level 3 HTSeq‐Coun"], "order_basis": "paper_text_order:1966", "id": "assay:4"}, {"role": "data_generation", "definition_id": "cell_culture", "definition_version": "99e1195c7d6f", "definition_digest": null, "required_operations": [], "support_state": "partial", "source_hashes": {"assay_lexicon": "99e1195c7d6f"}, "confidence": 0.77, "evidence": ["ed from the ATCC (Manassas, VA, USA) and was cultured in Roswell Park Memorial Institute (RPMI)‐1640"], "order_basis": "paper_text_order:2524", "id": "assay:5"}, {"role": "analysis", "definition_id": "survival_analysis", "definition_version": "f2132e96ae6c7a4e", "definition_digest": null, "required_operations": ["survival_km"], "support_state": "supported", "source_hashes": {"dsl_catalogue": "f2132e96ae6c7a4e"}, "confidence": 0.7, "evidence": ["Kaplan-Meier"], "order_basis": "consumes_earlier_output", "id": "assay:6"}]}