Comprehensive upstream and downstream regulatory analyses identify miR-675-3p as a potential prognostic biomarker in melanoma.

{"sci_version": "1.2", "schema": "https://corpus.bntrg.co.uk/sci/1.0/sci.schema.json", "id": "pmid:33400243", "kind": "science-record", "revision": 7, "content_hash": "sha256:f217b79a715f382f24b56a83ab44b78fa226892369c1fb28367173a922309ba3", "created_at": "2026-11-01T15:41:21Z", "updated_at": "2026-11-01T21:24:26Z", "generator": {"name": "corpus-assay-engine", "run_id": "reading-sci-2026-11-01"}, "paper": {"state": "complete", "title": "Comprehensive upstream and downstream regulatory analyses identify miR-675-3p as a potential prognostic biomarker in melanoma.", "doi": "10.1007/s13577-020-00473-0", "pmid": "33400243", "authors": ["Cai-Chou Zhao", "Hao Guo", "Ying Wang", "Jiu-Hong Li"], "journal": "Human cell", "year": 2021, "abstract": "This study assessed miR-675-3p-related regulatory mechanisms in melanoma and the clinical relevance of such regulatory activities. We downloaded miRNA mature strand expression RNA-Seq, phenotypic, and DNA methylation data pertaining to the TCGA Melanoma cohort. Differentially expressed miRNAs (DEMs) between metastatic and primary melanoma patient tissues were then identified, and miR-675-3p expression in melanoma patient peripheral blood was confirmed using the GSE20994 GEO dataset, while its expression in melanoma cell lines was evaluated via qRT-RCR. The clinical and prognostic implications of miR-675-3p in melanoma were assessed, and miR-675-3p target genes were identified using bioinformatics tools. Functional roles of this miRNA were explored via Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) analyses. We identified 3 and 22 miRNAs that were up- and downregulated, respectively, in metastatic melanoma samples relative to primary melanoma samples. Upregulation of miR-675-3p was associated with poorer overall patient survival, tumor histologic grade, and Clark's level. Consistently, miR-675-3p was also overexpressed in the peripheral blood of melanoma patients relative to healthy controls, and in melanoma cell lines relative to control cells. Gene regulatory networks indicated that 32 transcription factors control miR-675-3p expression, and that it, in turn, regulates 10 target genes. KEGG analyses indicated that these genes were associated with cell cycle, transcriptional misregulation in cancer, TGF-beta signaling, and HIF-1 signaling pathways. Gain-of-function assays revealed that miR-675-3p could promote cell proliferation via accelerating cell cycle progression. Western blotting results indicated that miR-675-3p could active TGF-beta and HIF-1 signaling. Through upstream and downstream analyses of miR-675-3p-related regulatory activity, we confirmed that this miRNA participates in key melanoma-related processes and offers value as a prognostic biomarker in melanoma patients.", "claims": [{"id": "claim-method", "statement": "Kaplan–Meier analyses and log-rank tests were used to assess patient overall survival (OS), with patients being separated into miR-675-3p-low or -high expression groups according to optimal expression cut-off values calculated based upon survival outcomes using X-tile [20].", "kind": "methodological", "target": null, "evidence": [{"asset": "source:pmid:33400243", "locator": "sections[14] \"Statistical analysis\" paragraph 2", "quote": "Kaplan–Meier analyses and log-rank tests were used to assess patient overall survival (OS), with patients being separated into miR-675-3p-low or -high expression groups according to optimal expression cut-off values calculated based upon survival outcomes using X-tile [20]."}], "state": "complete"}, {"id": "claim-data-access", "statement": "We downloaded miRNA mature strand expression RNA-Seq, phenotypic, and DNA methylation 450 k data pertaining to the TCGA Melanoma cohort from these UCSC Xena datasets.", "kind": "methodological", "target": null, "evidence": [{"asset": "source:pmid:33400243", "locator": "sections[3] \"Database analyses\" paragraph 2", "quote": "We downloaded miRNA mature strand expression RNA-Seq, phenotypic, and DNA methylation 450 k data pertaining to the TCGA Melanoma cohort from these UCSC Xena datasets."}], "state": "complete"}], "gaps": []}, "experiment": {"state": "complete", "objective": null, "steps": [{"id": "read_published_estimate", "order": 1, "name": "Read the published estimate from the source", "kind": "other", "state": "complete", "blocked_on": null, "description": "The claim, method and evidence span published with the source article.", "duration_hours": null, "parameters": {}, "inputs": ["source:pmid:33400243"], "outputs": ["the published estimate and its evidence"], "instruments": [], "reagents": []}, {"id": "obtain_source_data", "order": 2, "name": "Obtain the source data from the named repository", "kind": "data-preparation", "state": "complete", "blocked_on": null, "description": "The GEO series accession resolves and its sample accessions are listed. This lane did not download the dataset or read its licence.", "duration_hours": null, "parameters": {}, "inputs": ["data:geo:GSE20994"], "outputs": ["the source data with its repository provenance"], "instruments": [], "reagents": []}, {"id": "run_analysis", "order": 3, "name": "Run the published analysis", "kind": "analysis", "state": "complete", "blocked_on": null, "description": "Apply the paper's statistical method to the resolved series and compare the result with the published target.", "duration_hours": null, "parameters": {}, "inputs": ["data:geo:GSE20994"], "outputs": ["the replicated result and its comparison"], "instruments": [], "reagents": []}], "materials": [], "instruments": [], "reagents": [], "conditions": {}, "gaps": []}, "data": {"state": "partial", "assets": [{"id": "source:pmid:33400243", "role": "manuscript", "format": "xml", "media_type": "application/xml", "uri": "https://doi.org/10.1007/s13577-020-00473-0", "sha256": "sha256:95ea88acbd85090a15de39bdaf9c19c3f030026eec5171ad5b3c8c91ea99b29a", "bytes": 33936, "access": "open", "state": "resolved", "reader": null, "reader_status": "reader_required", "identifier": "10.1007/s13577-020-00473-0", "version": null, "note": "Full article fetched from PMC; the checksum covers the rendered section body, not the original XML bytes.", "structure": {"pmcid": "PMC7900067", "source": "europe_pmc_fulltext", "coverage": "whole_body", "text_hash_scope": "rendered_section_body"}}, {"id": "data:geo:GSE20994", "role": "raw", "format": "geo-series", "media_type": "application/vnd.ncbi.geo-series+json", "uri": "https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE20994", "sha256": null, "bytes": null, "access": "open", "state": "resolved", "reader": null, "reader_status": "reader_required", "identifier": "GSE20994", "version": null, "note": "We downloaded miRNA mature strand expression RNA-Seq, phenotypic, and DNA methylation 450 k data pertaining to the TCGA Melanoma cohort from these UCSC Xena datasets.", "structure": {"repository": "GEO", "access_route": "GEO accession URL", "access_statement_verbatim": "We downloaded miRNA mature strand expression RNA-Seq, phenotypic, and DNA methylation 450 k data pertaining to the TCGA Melanoma cohort from these UCSC Xena datasets.", "access_statement_kind": "repository_route_statement", "sample_accessions": ["GSM524757", "GSM524758", "GSM524759", "GSM524760", "GSM524761", "GSM524762", "GSM524763", "GSM524764", "GSM524765", "GSM524766", "GSM524767", "GSM524768", "GSM524769", "GSM524770", "GSM524771", "GSM524772", "GSM524773", "GSM524774", "GSM524775", "GSM524776", "GSM524777", "GSM524778", "GSM524779", "GSM524780", "GSM524781", "GSM524782", "GSM524783", "GSM524784", "GSM524785", "GSM524786", "GSM524787", "GSM524788", "GSM524789", "GSM524790", "GSM524791", "GSM524792", "GSM524793", "GSM524794", "GSM524795", "GSM524796", "GSM524797", "GSM524798", "GSM524799", "GSM524800", "GSM524801", "GSM524802", "GSM524803", "GSM524804", "GSM524805", "GSM524806", "GSM524807", "GSM524808", "GSM524809", "GSM524810", "GSM524811", "GSM524812", "GSM524813"], "sample_count": 57, "group_sizes": null, "group_sizes_basis": null, "platform": "9040", "taxon": "Homo sapiens", "title": "Melanoma Cancer miRNA Blood Profiles", "resolution_checked_at": "2026-11-01T15:39:54Z", "resolution_check": "identifier_resolution_only_no_download_no_licence_read", "downloaded": false, "licence_read": false}}, {"id": "asset:table:pmid:33400243:1", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:82ffbe8e447d69ff38d8155d51a1f0878fee7edf288da3efea83709181b976fb", "bytes": 893, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[6]/table-wrap[1]#Tab1", "version": null, "note": "Primers and sequence list", "structure": {"pmcid": "PMC7900067", "section_index": 6, "section_title": "qRT-PCR", "row_count": 17, "column_count": 2}, "table": {"label": "Table 1", "caption": "Primers and sequence list", "rows": [["Prime name", "Sequence (5ʹ–3ʹ)"], ["hsa-miR-675-3p-FO", "AACTTGCTGCTGTATGCCCTC"], ["hsa-miR-675-3p-RE", "TATGGTTGTTCACGACTCCTTCAC"], ["U6 snRNA-FO", "CGCTTCGGCAGCACATATAC"], ["U6 snRNA-RE", "TTCACGAATTTGCGTGTCATC"], ["hsa-miR-675-3p mimic-sense", "CUGUAUGCCCUCACCGCUCA"], ["hsa-miR-675-3p mimic-antisense", "AGCGGUGAGGGCAUACAGUU"], ["mimic NC-sense", "UUCUCCGAACGUGUCACGUTT"], ["mimic NC-antisense", "ACGUGACACGUUCGGAGAATT"], ["IGF1R-FO", "TGCTGACCTCTGTTACCTCTCCAC"], ["IGF1R-RE", "GTCTTCTCACACATCGGCTTCTCC"], ["EGR1-FO", "AGCAGCAGCAGCACCTTCAAC"], ["EGR1-RE", "CCACCAGCACCTTCTCGTTGTTC"], ["OPCML-FO", "ATCTCTGACATCAAGCGAGACC"], ["OPCML-RE", "CTTCTGACCGACTGAAACACC"], ["GAPDH-FO", "CAGCCTCAAGATCATCAGCAAT"], ["GAPDH-RE", "ATGAGTCCTTCCACGATACCAA"]], "row_count": 17, "column_count": 2, "numeric_cells": 5, "header_rows": 1, "locator": "section[6]/table-wrap[1]#Tab1"}}, {"id": "asset:table:pmid:33400243:2", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:7fcda852e8da2bd70c5ca5e31b6592d8089b8d82854c98acf6a21c6de2ade1f1", "bytes": 1557, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[16]/table-wrap[1]#Tab2", "version": null, "note": "The DEMs identified from TCGA miRNA-Seq data", "structure": {"pmcid": "PMC7900067", "section_index": 16, "section_title": "miR-675-3p is upregulated in melanoma cell lines, tissues, and blood", "row_count": 24, "column_count": 6}, "table": {"label": "Table 2", "caption": "The DEMs identified from TCGA miRNA-Seq data", "rows": [["Up-regulated miRNAs", "logFC", "Adjusted p value", "Down-regulated miRNAs", "logFC", "Adjusted p value"], ["hsa-miR-675-3p", "1.42", "1.61E−07", "hsa-miR-205-5p", "− 6.32", "1.48E−38"], ["hsa-miR-4491", "1.02", "9.5E−04", "hsa-miR-203a-3p", "− 5.0", "5.58E−35"], ["hsa-miR-4652-5p", "1.06", "7.1E−03", "hsa-miR-200c-3p", "− 2.65", "1.26E−26"], ["", "", "", "hsa-miR-141-5p", "− 2.39", "4.09E−19"], ["", "", "", "hsa-miR-200b-3p", "− 2.35", "7.54E−24"], ["", "", "", "hsa-miR-141-3p", "− 2.24", "1.84E−15"], ["", "", "", "hsa-miR-200a-5p", "− 2.22", "4.14E−22"], ["", "", "", "hsa-miR-944", "− 2.0", "6.51E−16"], ["", "", "", "hsa-miR-508-5p", "− 1.92", "6.07E−05"], ["", "", "", "hsa-miR-514a-3p", "− 1.91", "7.92E−05"], ["", "", "", "hsa-miR-508-3p", "− 1.87", "0.000112"], ["", "", "", "hsa-miR-509-3p", "− 1.82", "0.000188"], ["", "", "", "hsa-miR-211-5p", "− 1.62", "0.002545"], ["", "", "", "hsa-miR-506-3p", "− 1.60", "0.000907"], ["", "", "", "hsa-miR-200a-3p", "− 1.58", "5.58E−12"], ["", "", "", "hsa-miR-509-3-5p", "− 1.40", "0.003044"], ["", "", "", "hsa-miR-891a-5p", "− 1.39", "0.000563"], ["", "", "", "hsa-miR-513c-5p", "− 1.28", "0.002328"], ["", "", "", "hsa-miR-224-5p", "− 1.25", "3.83E−11"], ["", "", "", "hsa-miR-429", "− 1.25", "1.43E−06"], ["", "", "", "hsa-miR-4423-5p", "− 1.21", "0.000419"], ["", "", "", "hsa-miR-4423-3p", "− 1.11", "0.000371"], ["", "", "", "hsa-miR-31-3p", "− 1.04", "0.001113"]], "row_count": 24, "column_count": 6, "numeric_cells": 78, "header_rows": 1, "locator": "section[16]/table-wrap[1]#Tab2"}}, {"id": "asset:table:pmid:33400243:3", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:2cf0b0dcd2a5f1d2fa730b7634495af6504abaf986116caa5afa4ad95b2762a6", "bytes": 1617, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[17]/table-wrap[1]#Tab3", "version": null, "note": "Correlation between miR-675-3p expression and clinicopathological features", "structure": {"pmcid": "PMC7900067", "section_index": 17, "section_title": "Assessment of the clinical implications of miR-675-3p expression in melanoma", "row_count": 32, "column_count": 5}, "table": {"label": "Table 3", "caption": "Correlation between miR-675-3p expression and clinicopathological features", "rows": [["Variables", "Total (N = 230)", "miR-675-3p expression", "p value"], ["High (N = 115)", "Low (N = 115)"], ["Age (year)"], ["< 65", "120 (52.2%)", "61 (53.0%)", "59 (51.3%)", "0.792"], ["≥ 65", "110 (47.8%)", "54 (47.0%)", "56 (48.7%)", ""], ["Gender"], ["Male", "144 (62.6%)", "68 (59.1%)", "76 (66.1%)", "0.276"], ["Female", "86 (37.4%)", "47 (40.9%)", "39 (33.9%)", ""], ["Family history of cancer"], ["No", "133 (57.8%)", "66 (57.4%)", "67 (58.3%)", "0.713"], ["Yes", "67 (29.1%)", "32 (27.8%)", "35 (30.4%)", ""], ["Unknown", "30 (13.0%)", "17 (14.8%)", "13 (11.3%)", ""], ["TNM stage"], ["I", "57 (24.8%)", "31 (27.0%)", "26 (22.6%)", "0.531"], ["II", "78 (33.9%)", "35 (30.4%)", "43 (37.4%)", ""], ["III", "89 (38.7%)", "47 (40.9%)", "42 (36.5%)", ""], ["IV", "6 (2.6%)", "2 (1.7%)", "4 (3.5%)", ""], ["Histologic grade"], ["G1–G2", "155 (67.4%)", "70 (60.9%)", "85 (73.9%)", "0.035*"], ["G3–G4", "75 (32.6%)", "45 (39.1%)", "30 (26.1%)", ""], ["Pathologic_M"], ["M0", "224 (97.4%)", "113 (98.3%)", "111 (96.5%)", "0.408"], ["M1", "6 (2.6%)", "2 (1.7%)", "4 (3.5%)", ""], ["Clark's level"], ["I–III", "47 (20.4%)", "17 (14.8%)", "30 (26.1%)", "0.034*"], ["IV–V", "183 (79.6%)", "98 (85.2%)", "85 (73.9%)", ""], ["Pathologic_N"], ["N0–N1", "135 (75.2%)", "69 (60.0%)", "66 (57.4%)", "0.688"], ["N2–N4", "95 (24.8%)", "46 (40.0%)", "49 (42.6%)", ""], ["Pathologic_T"], ["T1–T2", "82 (35.7%)", "45 (39.1%)", "37 (32.2%)", "0.271"], ["T3–T4", "148 (64.3%)", "70 (60.9%)", "78 (67.8%)", ""]], "row_count": 32, "column_count": 5, "numeric_cells": 78, "header_rows": 2, "locator": "section[17]/table-wrap[1]#Tab3"}}], "gaps": ["asset:data:geo:GSE20994 not downloaded", "asset:data:geo:GSE20994 licence not read"]}, "analysis": {"state": "complete", "methods": [{"id": "method-1", "family": "survival_analysis", "specific": "log_rank_test", "label": "Survival analysis", "dsl_operations": ["logrank_test"], "missing_operations": [], "expressible": true, "parameters": {}, "data_shapes": ["time_to_event_with_censoring"], "evidence": {"score": 1.0, "band": "verbatim", "quote": "Kaplan–Meier analyses and log-rank tests were used to assess patient overall survival (OS), with patients being separated into miR-675-3p-low or -high expression groups according to optimal expression cut-off values calculated based upon survival outcomes using X-tile [20]."}}, {"id": "method-2", "family": "correlation_analysis", "specific": "pearson", "label": "Correlation analysis", "dsl_operations": ["pearson_r"], "missing_operations": [], "expressible": true, "parameters": {}, "data_shapes": ["paired_numeric_columns"], "evidence": {"score": 0.8, "band": "high", "quote": "Pearson correlation"}}], "targets": [], "gaps": []}, "capability": {"state": "complete", "requirements": [{"capability_id": "capability:computational_analysis", "label": "Computational analysis platform", "assay_families": ["meta_analysis", "machine_learning", "survival_analysis", "statistical_regression", "pca", "molecular_docking", "network_analysis", "differential_expression", "gwas"], "availability_state": "owned", "tier_unlocked": "R1", "candidate": "Automated Assays Laravel application and simulated adapters"}], "gaps": []}, "readiness": {"state": "complete", "tier": "R1", "blocking_axis": "none", "blocked_on": "nothing:replicable_now", "axes": {"method": {"tier": "R1", "expressible": true, "required_operations": ["logrank_test"], "missing_operations": [], "basis": "The paper names the method it used and the corpus's method extractor maps it onto the DSL catalogue: log_rank_test."}, "capability": {"tier": "R1", "capability_id": "capability:computational_analysis", "availability_state": "owned", "basis": "The computational analysis is owned. The physical bench the paper used is not, so a physical validation cannot be run here."}, "data": {"tier": "R1", "reachable": true, "accessions": ["GSE20994"], "resolved_accessions": ["GSE20994"], "statements": ["We downloaded miRNA mature strand expression RNA-Seq, phenotypic, and DNA methylation 450 k data pertaining to the TCGA Melanoma cohort from these UCSC Xena datasets."], "basis": "The paper names GSE20994 in Gene Expression Omnibus (GEO) and the accession resolves in the repository. No dataset was downloaded and no licence was read."}}, "can_run": {"dsl_operations": ["logrank_test"], "assets": ["source:pmid:33400243", "data:geo:GSE20994", "asset:table:pmid:33400243:1", "asset:table:pmid:33400243:2", "asset:table:pmid:33400243:3"], "steps": ["run_analysis"]}, "must_build": {"dsl_operations": [], "converters": [], "readers": [], "capabilities": [], "data_gaps": ["data:geo:GSE20994"]}, "gaps": []}, "review": {"state": "partial", "machine_critique": {"kind": "extraction_review", "reader": {"model": "MiniMax-M3.1-Flash", "provider": "minimax", "provider_family": "minimax", "read_at": "2026-10-31T18:25:50Z", "independence": "single_reader"}, "evidence_check": {"method": "verbatim", "availability": null}, "calls": 3, "usage": {"prompt_tokens": 28212, "completion_tokens": 1786, "cached_tokens": 784}}, "human_critique": null, "stages": [{"id": "extraction", "state": "complete", "reader": "MiniMax-M3.1-Flash", "provider": "minimax"}], "gaps": ["review.independent_reader", "review.machine_critique", "review.human_critique"]}, "execution": {"state": "absent", "status": "not_run", "mode": null, "runs": [], "gaps": ["execution.not_run"]}, "provenance": {"entities": [{"id": "pmid:33400243", "type": "paper", "label": "pmid:33400243"}, {"id": "source:pmid:33400243", "type": "manuscript", "label": "PMID 33400243 full text"}, {"id": "data:geo:GSE20994", "type": "dataset", "label": "GEO GSE20994"}], "activities": [{"id": "activity-reading-sci-2026-11-01", "type": "classification", "used": [{"id": "pmid:33400243", "type": "paper", "label": "pmid:33400243"}, {"id": "source:pmid:33400243", "type": "manuscript", "label": "PMID 33400243 full text"}, {"id": "data:geo:GSE20994", "type": "dataset", "label": "GEO GSE20994"}], "agent": "agent:corpus-assay-engine"}, {"id": "activity-read-33400243", "type": "extraction", "used": ["source:pmid:33400243"], "agent": "agent:minimax-reader"}, {"id": "activity-resolve-GSE20994", "type": "accession_resolution", "used": ["data:geo:GSE20994"], "agent": "agent:corpus-assay-engine"}], "agents": [{"id": "agent:corpus-assay-engine", "type": "software", "label": "Corpus assay engine"}, {"id": "agent:minimax-reader", "type": "software", "label": "MiniMax literature reader"}], "source_run_id": "reading-sci-2026-11-01", "dsl_catalogue_fingerprint": "343fb30756ba6ec3", "capability_table_fingerprint": "2cb3e42f047d2ecf", "snapshot_id": "ba34b49490d9bfaf"}, "lineage": {"parent_id": "pmid:33400243", "parent_hash": "sha256:b781eb7226248cdde1336d46d357de2f2c8e996cfa1176ebf6256bbf764639db", "fork_of": null, "generation": 6}, "gaps": ["asset:data:geo:GSE20994 licence not read", "asset:data:geo:GSE20994 not downloaded", "execution.not_run", "review.human_critique", "review.independent_reader", "review.machine_critique"], "assays": [{"role": "data_generation", "definition_id": "western_blot", "definition_version": "99e1195c7d6f", "definition_digest": null, "required_operations": [], "support_state": "partial", "source_hashes": {"assay_lexicon": "99e1195c7d6f"}, "confidence": 0.93, "evidence": ["ion via accelerating cell cycle progression. Western blotting results indicated that miR-675-3p could acti"], "order_basis": "paper_text_order:1803", "id": "assay:1"}, {"role": "data_generation", "definition_id": "cell_culture", "definition_version": "99e1195c7d6f", "definition_digest": null, "required_operations": [], "support_state": "partial", "source_hashes": {"assay_lexicon": "99e1195c7d6f"}, "confidence": 0.99, "evidence": ["i, China). A375, A2058, and 451Lu cells were cultured in RPMI-1640 (Hyclone, UT, USA), 293 T cells we", "MI-1640 (Hyclone, UT, USA), 293 T cells were cultured in high glucose DMEM (Hyclone) supplemented wit", "lemented with 10% FBS, while PIG1 cells were cultured in Medium 254 with Human Melanocyte Growth Supp", "i, China). A375, A2058, and 451Lu cells were cultured in RPMI-1640 (Hyclone, UT, USA), 293 T cells"], "order_basis": "paper_text_order:2503", "id": "assay:2"}, {"role": "analysis", "definition_id": "survival_analysis", "definition_version": "f2132e96ae6c7a4e", "definition_digest": null, "required_operations": ["logrank_test"], "support_state": "supported", "source_hashes": {"dsl_catalogue": "f2132e96ae6c7a4e"}, "confidence": 1.0, "evidence": ["Kaplan–Meier analyses and log-rank tests were used to assess patient overall survival (OS), with patients being separated into miR-675-3p-low or -high expression groups according to optimal expression cut-off values calculated based upon survival outcomes using X-tile [20]."], "order_basis": "consumes_earlier_output", "id": "assay:3"}]}