miR-1249-5p regulates the osteogenic differentiation of ADSCs by targeting PDX1.

{"sci_version": "1.2", "schema": "https://corpus.bntrg.co.uk/sci/1.0/sci.schema.json", "id": "pmid:33407691", "kind": "science-record", "revision": 8, "content_hash": "sha256:96efc5e5e9a76b290d937e26a0d700a2f56e862605d97b72f2f494c72f2b6484", "created_at": "2026-11-01T15:41:21Z", "updated_at": "2026-11-01T22:45:55Z", "generator": {"name": "corpus-assay-engine", "run_id": "reading-sci-2026-11-01"}, "paper": {"state": "complete", "title": "miR-1249-5p regulates the osteogenic differentiation of ADSCs by targeting PDX1.", "doi": "10.1186/s13018-020-02147-x", "pmid": "33407691", "authors": ["Xiao-Mei Yang", "Ya-Qi Song", "Liang Li", "Dong-Ming Liu", "Guang-Dong Chen"], "journal": "Journal of orthopaedic surgery and research", "year": 2021, "abstract": "BACKGROUND: Osteoporosis (OP) is an age-related systemic bone disease. MicroRNAs (miRNAs) are involved in the regulation of osteogenic differentiation. The purpose of this study was to explore the role and mechanism of miR-1249-5p for promoting osteogenic differentiation of adipose-derived stem cells (ADSCs).\nMETHODS: GSE74209 dataset was retrieved from NCBI Gene Expression Omnibus (GEO) database and performed bioinformatic analyses. OP tissue and healthy control tissues were obtained and used for RT-PCR analyses. ADSCs were incubated with miR-1249-5p mimic, inhibitor and corresponding negative control (NC), alkaline phosphatase (ALP) staining, and Alizarin Red Staining (ARS) were then performed to assess the role of miR-1249-5p for osteogenesis of ADSCs. Targetscan online website and dual-luciferase reporter assay were performed to verify that the 3'-UTR of PDX1 mRNA is a direct target of miR-1249-5p. RT-PCR and western blot were also performed to identify the mechanism of miR-1249-5p for osteogenesis of ADSCs.\nRESULTS: A total of 170 differentially expressed miRNAs were selected, among which, 75 miRNAs were downregulated and 95 miRNAs were upregulated. Moreover, miR-1249-5p was decreased in OP patients, while showed a gradual increase with the extension of induction time. miR-1249-5p mimic significantly increased osteogenic differentiation capacity and p-PI3K and p-Akt protein levels. Luciferase activity in ADSCs co-transfected of miR-1249-5p mimic with PDX1-WT reporter plasmids was remarkably decreased, but there was no obvious change in miR-1249-5p mimic with PDX1-MUT reporter plasmids co-transfection group. Overexpression PDX1 could partially reverse the promotion effects of miR-1249-5p on osteogenesis of ADSCs.\nCONCLUSION: In conclusion, miR-1249-5p promotes osteogenic differentiation of ADSCs by targeting PDX1 through the PI3K/Akt signaling pathway.", "claims": [{"id": "claim-method", "statement": "Differential expression analysis between OP and healthy control was performed using the R package limma.", "kind": "methodological", "target": null, "evidence": [{"asset": "source:pmid:33407691", "locator": "sections[3] \"Differentially expressed miRNAs in GSE74209\" paragraph 2", "quote": "Differential expression analysis between OP and healthy control was performed using the R package limma."}], "state": "complete"}, {"id": "claim-data-access", "statement": "We state that the data will not be shared since all the raw data are present in the figures included in the article.", "kind": "methodological", "target": null, "evidence": [{"asset": "source:pmid:33407691", "locator": "sections[24] \"Availability of data and materials\" paragraph 2", "quote": "We state that the data will not be shared since all the raw data are present in the figures included in the article."}], "state": "complete"}], "gaps": []}, "experiment": {"state": "complete", "objective": null, "steps": [{"id": "read_published_estimate", "order": 1, "name": "Read the published estimate from the source", "kind": "other", "state": "complete", "blocked_on": null, "description": "The claim, method and evidence span published with the source article.", "duration_hours": null, "parameters": {}, "inputs": ["source:pmid:33407691"], "outputs": ["the published estimate and its evidence"], "instruments": [], "reagents": []}, {"id": "obtain_source_data", "order": 2, "name": "Obtain the source data from the named repository", "kind": "data-preparation", "state": "complete", "blocked_on": null, "description": "The GEO series accession resolves and its sample accessions are listed. This lane did not download the dataset or read its licence.", "duration_hours": null, "parameters": {}, "inputs": ["data:geo:GSE74209"], "outputs": ["the source data with its repository provenance"], "instruments": [], "reagents": []}, {"id": "run_analysis", "order": 3, "name": "Run the published analysis", "kind": "analysis", "state": "complete", "blocked_on": null, "description": "Apply the paper's statistical method to the resolved series and compare the result with the published target.", "duration_hours": null, "parameters": {}, "inputs": ["data:geo:GSE74209"], "outputs": ["the replicated result and its comparison"], "instruments": [], "reagents": []}], "materials": [], "instruments": [], "reagents": [], "conditions": {}, "gaps": []}, "data": {"state": "partial", "assets": [{"id": "source:pmid:33407691", "role": "manuscript", "format": "xml", "media_type": "application/xml", "uri": "https://doi.org/10.1186/s13018-020-02147-x", "sha256": "sha256:12ed865303842088b94689cc8636b064fc4ac02ebe873f58dc340ad690ff64db", "bytes": 29959, "access": "open", "state": "resolved", "reader": null, "reader_status": "reader_required", "identifier": "10.1186/s13018-020-02147-x", "version": null, "note": "Full article fetched from PMC; the checksum covers the rendered section body, not the original XML bytes.", "structure": {"pmcid": "PMC7789402", "source": "europe_pmc_fulltext", "coverage": "whole_body", "text_hash_scope": "rendered_section_body"}}, {"id": "data:geo:GSE74209", "role": "raw", "format": "geo-series", "media_type": "application/vnd.ncbi.geo-series+json", "uri": "https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE74209", "sha256": null, "bytes": null, "access": "open", "state": "resolved", "reader": null, "reader_status": "reader_required", "identifier": "GSE74209", "version": null, "note": "We state that the data will not be shared since all the raw data are present in the figures included in the article.", "structure": {"repository": "GEO", "access_route": "GEO accession URL", "access_statement_verbatim": "We state that the data will not be shared since all the raw data are present in the figures included in the article.", "access_statement_kind": "data_availability_statement", "sample_accessions": ["GSM1914622", "GSM1914623", "GSM1914624", "GSM1914625", "GSM1914626", "GSM1914627", "GSM1914628", "GSM1914629", "GSM1914630", "GSM1914631", "GSM1914632", "GSM1914633"], "sample_count": 12, "group_sizes": null, "group_sizes_basis": null, "platform": "20999", "taxon": "Homo sapiens; Human alphaherpesvirus 1; Human betaherpesvirus 5; Betapolyomavirus hominis; Macacine alphaherpesvirus 1; Herpesvirus saimiri (strain 11); JC polyomavirus; Human immunodeficiency virus 1; Human gammaherpesvirus 8; Merkel cell polyomavirus; Human alphaherpesvirus 2; Human betaherpesvirus 6B; human gammaherpesvirus 4; Betapolyomavirus macacae", "title": "MiRNA Profiling of Whole Trabecular Bone: Identification of Osteoporosis-Related Changes in MiRNAs in Human Hip Bones", "resolution_checked_at": "2026-11-01T15:39:55Z", "resolution_check": "identifier_resolution_only_no_download_no_licence_read", "downloaded": false, "licence_read": false}}, {"id": "asset:table:pmid:33407691:1", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:9bef3416d36405c6d2624146c122f9bdc5c8d3686826f84fd037285a3c15d5f8", "bytes": 589, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[8]/table-wrap[1]#Tab1", "version": null, "note": "Primer sequences for qRT-PCR", "structure": {"pmcid": "PMC7789402", "section_index": 8, "section_title": "Quantitative real-time PCR (qRT-PCR)", "row_count": 7, "column_count": 3}, "table": {"label": "Table 1", "caption": "Primer sequences for qRT-PCR", "rows": [["Gene", "Forward primer 5′-3′", "Reverse primer 5′-3′"], ["GAPDH", "GACAGTCAGCCGCATCTTCT", "GCGCCCAATACGACCAAATC"], ["U6", "GGCTTTTTGCGGTCTGG", "GCTTCGGCAGCACATATACTAAAAT"], ["miR-1249-5p", "ACACTCCAGCTGGGTTCACAGTGGCTAAG", "AGGGCTTAGCTGCTTGTGAGCA"], ["OSX", "AGACCTCCAGAGAGGAGAGAC", "GGGGACTGGAGCCATAGTGA"], ["ALP", "AATAGCCCTGGCAGATTCCC", "CTCTCATGGTGTCTCGGTGG"], ["PDX1", "TGCCACTGTTGAGTGCAAGTC", "ACCTGGAGAAGCCGAAGGTAA"]], "row_count": 7, "column_count": 3, "numeric_cells": 3, "header_rows": 1, "locator": "section[8]/table-wrap[1]#Tab1"}}], "gaps": ["asset:data:geo:GSE74209 not downloaded", "asset:data:geo:GSE74209 licence not read"]}, "analysis": {"state": "complete", "methods": [{"id": "method-1", "family": "differential_expression", "specific": "limma_voom", "label": "Differential expression analysis", "dsl_operations": ["normalise_counts", "differential_expression_fit", "fdr_bh"], "missing_operations": [], "expressible": true, "parameters": {}, "data_shapes": ["count_matrix_with_condition"], "evidence": {"score": 1.0, "band": "verbatim", "quote": "Differential expression analysis between OP and healthy control was performed using the R package limma."}}, {"id": "method-2", "family": "correlation_analysis", "specific": "pearson", "label": "Correlation analysis", "dsl_operations": ["pearson_r"], "missing_operations": [], "expressible": true, "parameters": {}, "data_shapes": ["paired_numeric_columns"], "evidence": {"score": 0.8, "band": "high", "quote": "Pearson correlation"}}], "targets": [], "gaps": []}, "capability": {"state": "complete", "requirements": [{"capability_id": "capability:computational_analysis", "label": "Computational analysis platform", "assay_families": ["meta_analysis", "machine_learning", "survival_analysis", "statistical_regression", "pca", "molecular_docking", "network_analysis", "differential_expression", "gwas"], "availability_state": "owned", "tier_unlocked": "R1", "candidate": "Automated Assays Laravel application and simulated adapters"}], "gaps": []}, "readiness": {"state": "complete", "tier": "R1", "blocking_axis": "none", "blocked_on": "nothing:replicable_now", "axes": {"method": {"tier": "R1", "expressible": true, "required_operations": ["normalise_counts", "differential_expression_fit", "fdr_bh"], "missing_operations": [], "basis": "The paper names the method it used and the corpus's method extractor maps it onto the DSL catalogue: limma_voom."}, "capability": {"tier": "R1", "capability_id": "capability:computational_analysis", "availability_state": "owned", "basis": "The computational analysis is owned. The physical bench the paper used is not, so a physical validation cannot be run here."}, "data": {"tier": "R1", "reachable": true, "accessions": ["GSE74209"], "resolved_accessions": ["GSE74209"], "statements": ["We state that the data will not be shared since all the raw data are present in the figures included in the article."], "basis": "The paper names GSE74209 in NCBI Gene Expression Omnibus (GEO) and the accession resolves in the repository. No dataset was downloaded and no licence was read."}}, "can_run": {"dsl_operations": ["normalise_counts", "differential_expression_fit", "fdr_bh"], "assets": ["source:pmid:33407691", "data:geo:GSE74209", "asset:table:pmid:33407691:1"], "steps": ["run_analysis"]}, "must_build": {"dsl_operations": [], "converters": [], "readers": [], "capabilities": [], "data_gaps": ["data:geo:GSE74209"]}, "gaps": []}, "review": {"state": "partial", "machine_critique": {"kind": "extraction_review", "reader": {"model": "MiniMax-M3.1-Flash", "provider": "minimax", "provider_family": "minimax", "read_at": "2026-10-31T18:26:06Z", "independence": "single_reader"}, "evidence_check": {"method": "verbatim", "availability": "verbatim"}, "calls": 3, "usage": {"prompt_tokens": 25924, "completion_tokens": 1451, "cached_tokens": 784}}, "human_critique": null, "stages": [{"id": "extraction", "state": "complete", "reader": "MiniMax-M3.1-Flash", "provider": "minimax"}], "gaps": ["review.independent_reader", "review.machine_critique", "review.human_critique"]}, "execution": {"state": "absent", "status": "not_run", "mode": null, "runs": [], "gaps": ["execution.not_run"]}, "provenance": {"entities": [{"id": "pmid:33407691", "type": "paper", "label": "pmid:33407691"}, {"id": "source:pmid:33407691", "type": "manuscript", "label": "PMID 33407691 full text"}, {"id": "data:geo:GSE74209", "type": "dataset", "label": "GEO GSE74209"}], "activities": [{"id": "activity-reading-sci-2026-11-01", "type": "classification", "used": [{"id": "pmid:33407691", "type": "paper", "label": "pmid:33407691"}, {"id": "source:pmid:33407691", "type": "manuscript", "label": "PMID 33407691 full text"}, {"id": "data:geo:GSE74209", "type": "dataset", "label": "GEO GSE74209"}], "agent": "agent:corpus-assay-engine"}, {"id": "activity-read-33407691", "type": "extraction", "used": ["source:pmid:33407691"], "agent": "agent:minimax-reader"}, {"id": "activity-resolve-GSE74209", "type": "accession_resolution", "used": ["data:geo:GSE74209"], "agent": "agent:corpus-assay-engine"}], "agents": [{"id": "agent:corpus-assay-engine", "type": "software", "label": "Corpus assay engine"}, {"id": "agent:minimax-reader", "type": "software", "label": "MiniMax literature reader"}], "source_run_id": "reading-sci-2026-11-01", "dsl_catalogue_fingerprint": "343fb30756ba6ec3", "capability_table_fingerprint": "2cb3e42f047d2ecf", "snapshot_id": "ba34b49490d9bfaf"}, "lineage": {"parent_id": "pmid:33407691", "parent_hash": "sha256:47a3b8a346c0b12d07becdf0419f6ace1d4ef11fd0dd364ed527df5ac06394df", "fork_of": null, "generation": 7}, "gaps": ["asset:data:geo:GSE74209 licence not read", "asset:data:geo:GSE74209 not downloaded", "execution.not_run", "review.human_critique", "review.independent_reader", "review.machine_critique"], "assays": [{"role": "data_generation", "definition_id": "western_blot", "definition_version": "99e1195c7d6f", "definition_digest": null, "required_operations": [], "support_state": "partial", "source_hashes": {"assay_lexicon": "99e1195c7d6f"}, "confidence": 0.93, "evidence": ["s a direct target of miR-1249-5p. RT-PCR and western blot were also performed to identify the mechanis"], "order_basis": "paper_text_order:963", "id": "assay:1"}, {"role": "data_generation", "definition_id": "transfection", "definition_version": "99e1195c7d6f", "definition_digest": null, "required_operations": [], "support_state": "partial", "source_hashes": {"assay_lexicon": "99e1195c7d6f"}, "confidence": 0.99, "evidence": ["tein levels. Luciferase activity in ADSCs co-transfected of miR-1249-5p mimic with PDX1-WT reporter p", "-5p mimic with PDX1-MUT reporter plasmids co-transfection group. Overexpression PDX1 could partially r"], "order_basis": "paper_text_order:1478", "id": "assay:2"}, {"role": "data_generation", "definition_id": "microarray", "definition_version": "99e1195c7d6f", "definition_digest": null, "required_operations": [], "support_state": "partial", "source_hashes": {"assay_lexicon": "99e1195c7d6f"}, "confidence": 0.93, "evidence": ["patients To verify the results of the miRNAs microarray, we performed a real-time quantitative PCR a"], "order_basis": "paper_text_order:2027", "id": "assay:3"}, {"role": "data_generation", "definition_id": "qpcr", "definition_version": "99e1195c7d6f", "definition_digest": null, "required_operations": [], "support_state": "partial", "source_hashes": {"assay_lexicon": "99e1195c7d6f"}, "confidence": 0.93, "evidence": ["lts of the miRNAs microarray, we performed a real-time quantitative PCR assay. Result found that miR-1249-5p was sig"], "order_basis": "paper_text_order:2054", "id": "assay:4"}, {"role": "analysis", "definition_id": "differential_expression", "definition_version": "f2132e96ae6c7a4e", "definition_digest": null, "required_operations": ["normalise_counts", "differential_expression_fit", "fdr_bh"], "support_state": "supported", "source_hashes": {"dsl_catalogue": "f2132e96ae6c7a4e"}, "confidence": 1.0, "evidence": ["Differential expression analysis between OP and healthy control was performed using the R package limma."], "order_basis": "consumes_earlier_output", "id": "assay:5"}]}