PECAM1 Combines With CXCR4 to Trigger Inflammatory Cell Infiltration and Pulpitis Progression Through Activating the NF-κB Signaling Pathway.

{"sci_version": "1.2", "schema": "https://corpus.bntrg.co.uk/sci/1.0/sci.schema.json", "id": "pmid:33425898", "kind": "science-record", "revision": 8, "content_hash": "sha256:67badc2f4995b4b7f4c546cf79f0a1c48d18e07f1a2c81408f620be8a51b4655", "created_at": "2026-11-01T15:41:22Z", "updated_at": "2026-11-01T22:45:57Z", "generator": {"name": "corpus-assay-engine", "run_id": "reading-sci-2026-11-01"}, "paper": {"state": "complete", "title": "PECAM1 Combines With CXCR4 to Trigger Inflammatory Cell Infiltration and Pulpitis Progression Through Activating the NF-κB Signaling Pathway.", "doi": "10.3389/fcell.2020.593653", "pmid": "33425898", "authors": ["Yonghong Liu", "Zhiyong Zhang", "Wenjing Li", "Songbo Tian"], "journal": "Frontiers in cell and developmental biology", "year": 2020, "abstract": "Pulpitis is a frequent bacterially driven inflammation featured with the local accumulation of inflammatory products in human dental pulps. A GEO dataset GSE16134 comprising data of inflamed dental pulp tissues was used for bioinformatics analyses. A protein-protein interaction (PPI) analysis suggested that chemokine receptor 4 (CXCR4) owned a high correlation with platelet endothelial cell adhesion molecule-1 (PECAM1). A rat model with pulpitis was established, and lipopolysaccharide (LPS)-induced human dental pulp fibroblasts (HDPFs) were used for in vitro experiments. Then, high expression of PECAM1 and CXCR4 was validated in the inflamed dental pulp tissues in rats and in LPS-induced HDPFs. Either downregulation of PECAM1 or CXCR4 suppressed inflammatory cell infiltration in inflamed tissues as well as the inflammation and apoptosis of HDPFs. A transcription factor myocyte-enhancer factor 2 (MEF2C) was predicted and validated as a positive regulator of either PECAM1 or CXCR4, which activated the NF-κB signaling pathway and promoted pulpitis progression. To sum up, this study suggested that MEF2C transcriptionally activates PECAM1 and CXCR4 to activate the B-cell and NF-κB signaling pathways, leading to inflammatory cell infiltration and pulpitis progression.", "claims": [{"id": "claim-method", "statement": "Differences were analyzed using the t-test (two groups) and one-way or two-way ANOVA (multiple groups) followed by Tukey’s multiple comparisons test.", "kind": "methodological", "target": null, "evidence": [{"asset": "source:pmid:33425898", "locator": "sections[18] \"Statistical Analysis\" paragraph 2", "quote": "Differences were analyzed using the t-test (two groups) and one-way or two-way ANOVA (multiple groups) followed by Tukey’s multiple comparisons test."}], "state": "complete"}, {"id": "claim-data-access", "statement": "The original contributions presented in the study are included in the article/supplementary material, further inquiries can be directed to the corresponding author/s.", "kind": "methodological", "target": null, "evidence": [{"asset": "source:pmid:33425898", "locator": "sections[29] \"Data Availability Statement\" paragraph 2", "quote": "The original contributions presented in the study are included in the article/supplementary material, further inquiries can be directed to the corresponding author/s."}], "state": "complete"}], "gaps": []}, "experiment": {"state": "complete", "objective": null, "steps": [{"id": "read_published_estimate", "order": 1, "name": "Read the published estimate from the source", "kind": "other", "state": "complete", "blocked_on": null, "description": "The claim, method and evidence span published with the source article.", "duration_hours": null, "parameters": {}, "inputs": ["source:pmid:33425898"], "outputs": ["the published estimate and its evidence"], "instruments": [], "reagents": []}, {"id": "obtain_source_data", "order": 2, "name": "Obtain the source data from the named repository", "kind": "data-preparation", "state": "complete", "blocked_on": null, "description": "The GEO series accession resolves and its sample accessions are listed. This lane did not download the dataset or read its licence.", "duration_hours": null, "parameters": {}, "inputs": ["data:geo:GSE16134"], "outputs": ["the source data with its repository provenance"], "instruments": [], "reagents": []}, {"id": "run_analysis", "order": 3, "name": "Run the published analysis", "kind": "analysis", "state": "complete", "blocked_on": null, "description": "Apply the paper's statistical method to the resolved series and compare the result with the published target.", "duration_hours": null, "parameters": {}, "inputs": ["data:geo:GSE16134"], "outputs": ["the replicated result and its comparison"], "instruments": [], "reagents": []}], "materials": [], "instruments": [], "reagents": [], "conditions": {}, "gaps": []}, "data": {"state": "partial", "assets": [{"id": "source:pmid:33425898", "role": "manuscript", "format": "xml", "media_type": "application/xml", "uri": "https://doi.org/10.3389/fcell.2020.593653", "sha256": "sha256:4782a0e6c92a3b616795ac949e22cc1cb5f27e07d795dc79d9f116956fa392f7", "bytes": 41342, "access": "open", "state": "resolved", "reader": null, "reader_status": "reader_required", "identifier": "10.3389/fcell.2020.593653", "version": null, "note": "Full article fetched from PMC; the checksum covers the rendered section body, not the original XML bytes.", "structure": {"pmcid": "PMC7786183", "source": "europe_pmc_fulltext", "coverage": "whole_body_without_references", "text_hash_scope": "rendered_section_body"}}, {"id": "data:geo:GSE16134", "role": "raw", "format": "geo-series", "media_type": "application/vnd.ncbi.geo-series+json", "uri": "https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE16134", "sha256": null, "bytes": null, "access": "open", "state": "resolved", "reader": null, "reader_status": "reader_required", "identifier": "GSE16134", "version": null, "note": "The original contributions presented in the study are included in the article/supplementary material, further inquiries can be directed to the corresponding author/s.", "structure": {"repository": "GEO", "access_route": "GEO accession URL", "access_statement_verbatim": "The original contributions presented in the study are included in the article/supplementary material, further inquiries can be directed to the corresponding author/s.", "access_statement_kind": "data_availability_statement", "sample_accessions": ["GSM404005", "GSM404006", "GSM404007", "GSM404008", "GSM404009", "GSM404010", "GSM404011", "GSM404012", "GSM404013", "GSM404014", "GSM404015", "GSM404016", "GSM404017", "GSM404018", "GSM404019", "GSM404020", "GSM404021", "GSM404022", "GSM404023", "GSM404024", "GSM404025", "GSM404026", "GSM404027", "GSM404028", "GSM404029", "GSM404030", "GSM404031", "GSM404032", "GSM404033", "GSM404034", "GSM404035", "GSM404036", "GSM404037", "GSM404038", "GSM404039", "GSM404040", "GSM404041", "GSM404042", "GSM404043", "GSM404044", "GSM404045", "GSM404046", "GSM404047", "GSM404048", "GSM404049", "GSM404050", "GSM404051", "GSM404052", "GSM404053", "GSM404054", "GSM404055", "GSM404056", "GSM404057", "GSM404058", "GSM404059", "GSM404060", "GSM404061", "GSM404062", "GSM404063", "GSM404064", "GSM404065", "GSM404066", "GSM404067", "GSM404068", "GSM404069", "GSM404070", "GSM404071", "GSM404072", "GSM404073", "GSM404074", "GSM404075", "GSM404076", "GSM404077", "GSM404078", "GSM404079", "GSM404080", "GSM404081", "GSM404082", "GSM404083", "GSM404084", "GSM404085", "GSM404086", "GSM404087", "GSM404088", "GSM404089", "GSM404090", "GSM404091", "GSM404092", "GSM404093", "GSM404094", "GSM404095", "GSM404096", "GSM404097", "GSM404098", "GSM404099", "GSM404100", "GSM404101", "GSM404102", "GSM404103", "GSM404104", "GSM404105", "GSM404106", "GSM404107", "GSM404108", "GSM404109", "GSM404110", "GSM404111", "GSM404112", "GSM404113", "GSM404114", "GSM404115", "GSM404116", "GSM404117", "GSM404118", "GSM404119", "GSM404120", "GSM404121", "GSM404122", "GSM404123", "GSM404124", "GSM404125", "GSM404126", "GSM404127", "GSM404128", "GSM404129", "GSM404130", "GSM404131", "GSM404132", "GSM404133", "GSM404134", "GSM404135", "GSM404136", "GSM404137", "GSM404138", "GSM404139", "GSM404140", "GSM404141", "GSM404142", "GSM404143", "GSM404144", "GSM404145", "GSM404146", "GSM404147", "GSM404148", "GSM404149", "GSM404150", "GSM404151", "GSM404152", "GSM404153", "GSM404154", "GSM404155", "GSM404156", "GSM404157", "GSM404158", "GSM404159", "GSM404160", "GSM404161", "GSM404162", "GSM404163", "GSM404164", "GSM404165", "GSM404166", "GSM404167", "GSM404168", "GSM404169", "GSM404170", "GSM404171", "GSM404172", "GSM404173", "GSM404174", "GSM404175", "GSM404176", "GSM404177", "GSM404178", "GSM404179", "GSM404180", "GSM404181", "GSM404182", "GSM404183", "GSM404184", "GSM404185", "GSM404186", "GSM404187", "GSM404188", "GSM404189", "GSM404190", "GSM404191", "GSM404192", "GSM404193", "GSM404194", "GSM404195", "GSM404196", "GSM404197", "GSM404198", "GSM404199", "GSM404200", "GSM404201", "GSM404202", "GSM404203", "GSM404204", "GSM404205", "GSM404206", "GSM404207", "GSM404208", "GSM404209", "GSM404210", "GSM404211", "GSM404212", "GSM404213", "GSM404214", "GSM404215", "GSM404216", "GSM404217", "GSM404218", "GSM404219", "GSM404220", "GSM404221", "GSM404222", "GSM404223", "GSM404224", "GSM404225", "GSM404226", "GSM404227", "GSM404228", "GSM404229", "GSM404230", "GSM404231", "GSM404232", "GSM404233", "GSM404234", "GSM404235", "GSM404236", "GSM404237", "GSM404238", "GSM404239", "GSM404240", "GSM404241", "GSM404242", "GSM404243", "GSM404244", "GSM404245", "GSM404246", "GSM404247", "GSM404248", "GSM404249", "GSM404250", "GSM404251", "GSM404252", "GSM404253", "GSM404254", "GSM404255", "GSM404256", "GSM404257", "GSM404258", "GSM404259", "GSM404260", "GSM404261", "GSM404262", "GSM404263", "GSM404264", "GSM404265", "GSM404266", "GSM404267", "GSM404268", "GSM404269", "GSM404270", "GSM404271", "GSM404272", "GSM404273", "GSM404274", "GSM404275", "GSM404276", "GSM404277", "GSM404278", "GSM404279", "GSM404280", "GSM404281", "GSM404282", "GSM404283", "GSM404284", "GSM404285", "GSM404286", "GSM404287", "GSM404288", "GSM404289", "GSM404290", "GSM404291", "GSM404292", "GSM404293", "GSM404294", "GSM404295", "GSM404296", "GSM404297", "GSM404298", "GSM404299", "GSM404300", "GSM404301", "GSM404302", "GSM404303", "GSM404304", "GSM404305", "GSM404306", "GSM404307", "GSM404308", "GSM404309", "GSM404310", "GSM404311", "GSM404312", "GSM404313", "GSM404314"], "sample_count": 310, "group_sizes": null, "group_sizes_basis": null, "platform": "570", "taxon": "Homo sapiens", "title": "Bacterial Correlates of Gingival Gene Expression", "resolution_checked_at": "2026-11-01T15:39:54Z", "resolution_check": "identifier_resolution_only_no_download_no_licence_read", "downloaded": false, "licence_read": false}}, {"id": "asset:table:pmid:33425898:1", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:641cda534e1be18b49c97ad20c04e403295ee4eb75371ea67e69fea2617af097", "bytes": 787, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[3]/table-wrap[1]#T1", "version": null, "note": "Primer sequences for RT-qPCR.", "structure": {"pmcid": "PMC7786183", "section_index": 3, "section_title": "Antibodies and Primers", "row_count": 17, "column_count": 2}, "table": {"label": "TABLE 1", "caption": "Primer sequences for RT-qPCR.", "rows": [["Gene", "Primer sequence (5′–3′)"], ["PECAM1", "F: AAGTGGAGTCCAGCCGCATATC"], ["", "R: ATGGAGCAGGACAGGTTCAGTC"], ["CXCR4", "F: CTCCTCTTTGTCATCACGCTTCC"], ["", "R: GGATGAGGACACTGCTGTAGAG"], ["MEF2C", "F: TCCACCAGGCAGCAAGAATACG"], ["", "R: GGAGTTGCTACGGAAACCACTG"], ["PGE2", "F: CCTTCAAGGTTCTGTGCTCAGC"], ["", "R: CATCAGCTTAGCTGGACACTGC"], ["TNF-α", "F: GGTGCCTATGTCTCAGCCTCTT"], ["", "R: GCCATAGAACTGATGAGAGGGAG"], ["IL-6", "F: AGACAGCCACTCACCTCTTCAG"], ["", "R: TTCTGCCAGTGCCTCTTTGCTG"], ["IL-8", "F: CCATTCCGTTCTGGTACAGTCTG"], ["", "R: TTTCCGCTTCCTGAGGCTGGAT"], ["GAPDH", "F: GTCTCCTCTGACTTCAACAGCG"], ["", "R: ACCACCCTGTTGCTGTAGCCAA"]], "row_count": 17, "column_count": 2, "numeric_cells": 3, "header_rows": 1, "locator": "section[3]/table-wrap[1]#T1"}}], "gaps": ["asset:data:geo:GSE16134 not downloaded", "asset:data:geo:GSE16134 licence not read"]}, "analysis": {"state": "complete", "methods": [{"id": "method-1", "family": "group_comparison", "specific": "anova", "label": "Group comparison", "dsl_operations": ["group_summary", "welch_t", "bootstrap_mean_difference", "group_comparison_anova"], "missing_operations": [], "expressible": true, "parameters": {}, "data_shapes": ["two_or_more_groups_continuous"], "evidence": {"score": 1.0, "band": "verbatim", "quote": "Differences were analyzed using the t-test (two groups) and one-way or two-way ANOVA (multiple groups) followed by Tukey’s multiple comparisons test."}}, {"id": "method-2", "family": "network_analysis", "specific": "ppi_network", "label": "Network / pathway analysis", "dsl_operations": ["build_graph", "centrality_scores", "pathway_enrich"], "missing_operations": [], "expressible": true, "parameters": {}, "data_shapes": ["edge_list"], "evidence": {"score": 0.7, "band": "medium", "quote": "protein-protein interaction"}}], "targets": [], "gaps": []}, "capability": {"state": "complete", "requirements": [{"capability_id": "capability:computational_analysis", "label": "Computational analysis platform", "assay_families": ["meta_analysis", "machine_learning", "survival_analysis", "statistical_regression", "pca", "molecular_docking", "network_analysis", "differential_expression", "gwas"], "availability_state": "owned", "tier_unlocked": "R1", "candidate": "Automated Assays Laravel application and simulated adapters"}], "gaps": []}, "readiness": {"state": "complete", "tier": "R1", "blocking_axis": "none", "blocked_on": "nothing:replicable_now", "axes": {"method": {"tier": "R1", "expressible": true, "required_operations": ["group_summary", "welch_t", "bootstrap_mean_difference", "group_comparison_anova"], "missing_operations": [], "basis": "The paper names the method it used and the corpus's method extractor maps it onto the DSL catalogue: anova."}, "capability": {"tier": "R1", "capability_id": "capability:computational_analysis", "availability_state": "owned", "basis": "The computational analysis is owned. The physical bench the paper used is not, so a physical validation cannot be run here."}, "data": {"tier": "R1", "reachable": true, "accessions": ["GSE16134"], "resolved_accessions": ["GSE16134"], "statements": ["The original contributions presented in the study are included in the article/supplementary material, further inquiries can be directed to the corresponding author/s."], "basis": "The paper names GSE16134 in Gene Expression Omnibus (GEO) and the accession resolves in the repository. No dataset was downloaded and no licence was read."}}, "can_run": {"dsl_operations": ["group_summary", "welch_t", "bootstrap_mean_difference", "group_comparison_anova"], "assets": ["source:pmid:33425898", "data:geo:GSE16134", "asset:table:pmid:33425898:1"], "steps": ["run_analysis"]}, "must_build": {"dsl_operations": [], "converters": [], "readers": [], "capabilities": [], "data_gaps": ["data:geo:GSE16134"]}, "gaps": []}, "review": {"state": "partial", "machine_critique": {"kind": "extraction_review", "reader": {"model": "MiniMax-M3.1-Flash", "provider": "minimax", "provider_family": "minimax", "read_at": "2026-10-31T18:25:59Z", "independence": "single_reader"}, "evidence_check": {"method": "verbatim", "availability": "verbatim"}, "calls": 3, "usage": {"prompt_tokens": 32832, "completion_tokens": 1049, "cached_tokens": 11016}}, "human_critique": null, "stages": [{"id": "extraction", "state": "complete", "reader": "MiniMax-M3.1-Flash", "provider": "minimax"}], "gaps": ["review.independent_reader", "review.machine_critique", "review.human_critique"]}, "execution": {"state": "absent", "status": "not_run", "mode": null, "runs": [], "gaps": ["execution.not_run"]}, "provenance": {"entities": [{"id": "pmid:33425898", "type": "paper", "label": "pmid:33425898"}, {"id": "source:pmid:33425898", "type": "manuscript", "label": "PMID 33425898 full text"}, {"id": "data:geo:GSE16134", "type": "dataset", "label": "GEO GSE16134"}], "activities": [{"id": "activity-reading-sci-2026-11-01", "type": "classification", "used": [{"id": "pmid:33425898", "type": "paper", "label": "pmid:33425898"}, {"id": "source:pmid:33425898", "type": "manuscript", "label": "PMID 33425898 full text"}, {"id": "data:geo:GSE16134", "type": "dataset", "label": "GEO GSE16134"}], "agent": "agent:corpus-assay-engine"}, {"id": "activity-read-33425898", "type": "extraction", "used": ["source:pmid:33425898"], "agent": "agent:minimax-reader"}, {"id": "activity-resolve-GSE16134", "type": "accession_resolution", "used": ["data:geo:GSE16134"], "agent": "agent:corpus-assay-engine"}], "agents": [{"id": "agent:corpus-assay-engine", "type": "software", "label": "Corpus assay engine"}, {"id": "agent:minimax-reader", "type": "software", "label": "MiniMax literature reader"}], "source_run_id": "reading-sci-2026-11-01", "dsl_catalogue_fingerprint": "343fb30756ba6ec3", "capability_table_fingerprint": "2cb3e42f047d2ecf", "snapshot_id": "ba34b49490d9bfaf"}, "lineage": {"parent_id": "pmid:33425898", "parent_hash": "sha256:e5e14856ee7cf6c9243e2661478ba51c1d8d937006311a47613887c4ee2ca53a", "fork_of": null, "generation": 7}, "gaps": ["asset:data:geo:GSE16134 licence not read", "asset:data:geo:GSE16134 not downloaded", "execution.not_run", "review.human_critique", "review.independent_reader", "review.machine_critique"], "assays": [{"role": "data_generation", "definition_id": "animal_model", "definition_version": "99e1195c7d6f", "definition_digest": null, "required_operations": [], "support_state": "partial", "source_hashes": {"assay_lexicon": "99e1195c7d6f"}, "confidence": 0.99, "evidence": ["alidated in the inflamed dental pulp tissues in rats and in LPS-induced HDPFs. Either downregulat", "thelial cell adhesion molecule-1 (PECAM1). A rat model with pulpitis was established, and lip", "dated in the inflamed dental pulp tissues in rats and in LPS-induced HDPFs. Either downregulat"], "order_basis": "paper_text_order:523", "id": "assay:1"}, {"role": "data_generation", "definition_id": "apoptosis_assay", "definition_version": "99e1195c7d6f", "definition_digest": null, "required_operations": [], "support_state": "partial", "source_hashes": {"assay_lexicon": "99e1195c7d6f"}, "confidence": 0.69, "evidence": ["amed tissues as well as the inflammation and apoptosis of HDPFs. A transcription factor myocyte-enh"], "order_basis": "paper_text_order:936", "id": "assay:2"}, {"role": "analysis", "definition_id": "group_comparison", "definition_version": "f2132e96ae6c7a4e", "definition_digest": null, "required_operations": ["group_summary", "welch_t", "bootstrap_mean_difference", "group_comparison_anova"], "support_state": "supported", "source_hashes": {"dsl_catalogue": "f2132e96ae6c7a4e"}, "confidence": 1.0, "evidence": ["Differences were analyzed using the t-test (two groups) and one-way or two-way ANOVA (multiple groups) followed by Tukey’s multiple comparisons test."], "order_basis": "consumes_earlier_output", "id": "assay:3"}]}