Integrated bioinformatics analysis for differentially expressed genes and signaling pathways identification in gastric cancer.

{"sci_version": "1.2", "schema": "https://corpus.bntrg.co.uk/sci/1.0/sci.schema.json", "id": "pmid:33437215", "kind": "science-record", "revision": 8, "content_hash": "sha256:8391e2f5955f8d1b353b4cf11df9bfb83ec13f0b58226d1f8ff91fc39ea74c2e", "created_at": "2026-11-01T15:41:22Z", "updated_at": "2026-11-01T22:02:55Z", "generator": {"name": "corpus-assay-engine", "run_id": "reading-sci-2026-11-01"}, "paper": {"state": "complete", "title": "Integrated bioinformatics analysis for differentially expressed genes and signaling pathways identification in gastric cancer.", "doi": "10.7150/ijms.47339", "pmid": "33437215", "authors": ["ChenChen Yang", "Aifeng Gong"], "journal": "International journal of medical sciences", "year": 2021, "abstract": "Background: Gastric cancer (GC) has a high mortality rate in cancer-related deaths worldwide. Currently, the pathogenesis of gastric cancer progression remains unclear. Here, we identified several vital candidate genes related to gastric cancer development and revealed the potential pathogenic mechanisms using integrated bioinformatics analysis. Methods: Two microarray datasets from Gene Expression Omnibus (GEO) database integrated. Limma package was used to analyze differentially expressed genes (DEGs) between GC and matched normal specimens. DAVID was utilized to conduct Gene ontology (GO) and KEGG enrichment analysis. The relative expression of OLFM4, IGF2BP3, CLDN1 and MMP1were analyzed based on TCGA database provided by UALCAN. Western blot and quantitative real time PCR assay were performed to determine the protein and mRNA levels of OLFM4, IGF2BP3, CLDN1 and MMP1 in GC tissues and cell lines, respectively. Results: We downloaded the expression profiles of GSE103236 and GSE118897 from the Gene Expression Omnibus (GEO) database. Two integrated microarray datasets were used to obtain differentially expressed genes (DEGs), and bioinformatics methods were used for in-depth analysis. After gene ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway enrichments analysis, we identified 61 DEGs in common, of which the expression of 34 genes were elevated and 27 genes were decreased. GO analysis displayed that the biological functions of DEGs mainly focused on negative regulation of growth, fatty acid binding, cellular response to zinc ion and calcium-independent cell-cell adhesion. KEGG pathway analysis demonstrated that these DEGs mainly related to the Wnt and tumor signaling pathway. Interestingly, we found 4 genes were most significantly upregulated in the DEGs, which were OLFM4, IGF2BP3, CLDN1 and MMP1. Then, we confirmed the upregulation of these genes in STAD based on sample types. In the final, western blot and qRT-PCR assay were performed to determine the protein and mRNA levels of OLFM4, IGF2BP3, CLDN1 and MMP1 in GC tissues and cell lines. Conclusion: In our study, using integrated bioinformatics to screen DEGs in gastric cancer could benefit us for understanding the pathogenic mechanism underlying gastric cancer progression. Meanwhile, we also identified four significantly upregulated genes in DEGs from both two datasets, which might be used as the biomarkers for early diagnosis and prevention of gastric cancer.", "claims": [{"id": "claim-method", "statement": "GraphPad Prism 5.0 software was utilized to perform all the experiments. Results were displayed as the mean±SD and analyzed using the two-tailed Student t-test.", "kind": "methodological", "target": null, "evidence": [{"asset": "source:pmid:33437215", "locator": "sections[11] \"Statistical analysis\" paragraph 2", "quote": "GraphPad Prism 5.0 software was utilized to perform all the experiments. Results were displayed as the mean±SD and analyzed using the two-tailed Student t-test."}], "state": "complete"}, {"id": "claim-data-access", "statement": "We downloaded two data sets of GC, which were the gene expression profiles of GSE103236 and GSE118897, from GEO.", "kind": "methodological", "target": null, "evidence": [{"asset": "source:pmid:33437215", "locator": "sections[5] \"Microarray data sets\" paragraph 2", "quote": "We downloaded two data sets of GC, which were the gene expression profiles of GSE103236 and GSE118897, from GEO."}], "state": "complete"}], "gaps": []}, "experiment": {"state": "partial", "objective": null, "steps": [{"id": "read_published_estimate", "order": 1, "name": "Read the published estimate from the source", "kind": "other", "state": "complete", "blocked_on": null, "description": "The claim, method and evidence span published with the source article.", "duration_hours": null, "parameters": {}, "inputs": ["source:pmid:33437215"], "outputs": ["the published estimate and its evidence"], "instruments": [], "reagents": []}, {"id": "obtain_source_data", "order": 2, "name": "Obtain the source data from the named repository", "kind": "data-preparation", "state": "complete", "blocked_on": null, "description": "The GEO series accession resolves and its sample accessions are listed. This lane did not download the dataset or read its licence.", "duration_hours": null, "parameters": {}, "inputs": ["data:geo:GSE103236"], "outputs": ["the source data with its repository provenance"], "instruments": [], "reagents": []}, {"id": "run_analysis", "order": 3, "name": "Run the published analysis", "kind": "analysis", "state": "blocked", "blocked_on": "method:student_t", "description": "Apply the paper's statistical method to the resolved series and compare the result with the published target.", "duration_hours": null, "parameters": {}, "inputs": ["data:geo:GSE103236"], "outputs": ["the replicated result and its comparison"], "instruments": [], "reagents": []}], "materials": [], "instruments": [], "reagents": [], "conditions": {}, "gaps": ["step:run_analysis blocked on method:student_t"]}, "data": {"state": "partial", "assets": [{"id": "source:pmid:33437215", "role": "manuscript", "format": "xml", "media_type": "application/xml", "uri": "https://doi.org/10.7150/ijms.47339", "sha256": "sha256:71adc420cf3b8583463cf0b63205949e9ba6d12b799b47bf37ba2af5392173a9", "bytes": 29061, "access": "open", "state": "resolved", "reader": null, "reader_status": "reader_required", "identifier": "10.7150/ijms.47339", "version": null, "note": "Full article fetched from PMC; the checksum covers the rendered section body, not the original XML bytes.", "structure": {"pmcid": "PMC7797537", "source": "europe_pmc_fulltext", "coverage": "whole_body", "text_hash_scope": "rendered_section_body"}}, {"id": "data:geo:GSE103236", "role": "raw", "format": "geo-series", "media_type": "application/vnd.ncbi.geo-series+json", "uri": "https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE103236", "sha256": null, "bytes": null, "access": "open", "state": "resolved", "reader": null, "reader_status": "reader_required", "identifier": "GSE103236", "version": null, "note": "We downloaded two data sets of GC, which were the gene expression profiles of GSE103236 and GSE118897, from GEO.", "structure": {"repository": "GEO", "access_route": "GEO accession URL", "access_statement_verbatim": "We downloaded two data sets of GC, which were the gene expression profiles of GSE103236 and GSE118897, from GEO.", "access_statement_kind": "repository_route_statement", "sample_accessions": ["GSM2758660", "GSM2758661", "GSM2758662", "GSM2758663", "GSM2758664", "GSM2758665", "GSM2758666", "GSM2758667", "GSM2758668", "GSM2758669", "GSM2758670", "GSM2758671", "GSM2758672", "GSM2758673", "GSM2758674", "GSM2758675", "GSM2758676", "GSM2758677", "GSM2758678"], "sample_count": 19, "group_sizes": null, "group_sizes_basis": null, "platform": "4133", "taxon": "Homo sapiens", "title": "Microarray gene expresion analysis for early and advanced gastric adenocarcinoma vs normal adjacent tissue.", "resolution_checked_at": "2026-11-01T15:39:54Z", "resolution_check": "identifier_resolution_only_no_download_no_licence_read", "downloaded": false, "licence_read": false}}, {"id": "data:geo:GSE118897", "role": "raw", "format": "geo-series", "media_type": "application/vnd.ncbi.geo-series+json", "uri": "https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE118897", "sha256": null, "bytes": null, "access": "open", "state": "resolved", "reader": null, "reader_status": "reader_required", "identifier": "GSE118897", "version": null, "note": "We downloaded two data sets of GC, which were the gene expression profiles of GSE103236 and GSE118897, from GEO.", "structure": {"repository": "GEO", "access_route": "GEO accession URL", "access_statement_verbatim": "We downloaded two data sets of GC, which were the gene expression profiles of GSE103236 and GSE118897, from GEO.", "access_statement_kind": "repository_route_statement", "sample_accessions": ["GSM3350392", "GSM3350393", "GSM3350394", "GSM3350395", "GSM3350396", "GSM3350397", "GSM3350398", "GSM3350399", "GSM3350400", "GSM3350401", "GSM3350402", "GSM3350403", "GSM3350404", "GSM3350405", "GSM3350406", "GSM3350407", "GSM3350408", "GSM3350409", "GSM3350410", "GSM3350411"], "sample_count": 20, "group_sizes": null, "group_sizes_basis": null, "platform": "16686", "taxon": "Homo sapiens", "title": "Differentially expressed genes in normal gastric mucosa and gastric cancer tissues", "resolution_checked_at": "2026-11-01T15:39:54Z", "resolution_check": "identifier_resolution_only_no_download_no_licence_read", "downloaded": false, "licence_read": false}}, {"id": "asset:table:pmid:33437215:1", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:a23638f2ee8c80fd002765479ea9a6e1da22fdbdb29183039288db7187c52024", "bytes": 614, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[10]/table-wrap[1]#T1", "version": null, "note": "Primers used for qRT-PCR", "structure": {"pmcid": "PMC7797537", "section_index": 10, "section_title": "Quantitative real-time polymerase chain reaction (qRT-PCR)", "row_count": 11, "column_count": 3}, "table": {"label": "Table 1", "caption": "Primers used for qRT-PCR", "rows": [["Gene", "Primer", "Sequence 5' to 3'"], ["OLFM4", "Forward", "ACTGTCCGAATTGACATCATGG"], ["Reverse", "TTCTGAGCTTCCACCAAAACTC"], ["IGF2BP3", "Forward", "CCAAGCTAGACAAGCACTAGAC"], ["Reverse", "GCGGCCATTTCATCAGGGA"], ["CLDN1", "Forward", "CCTCCTGGGAGTGATAGCAAT"], ["Reverse", "GGCAACTAAAATAGCCAGACCT"], ["MMP1", "Forward", "CTCTGGAGTAATGTCACACCTCT"], ["Reverse", "TGTTGGTCCACCTTTCATCTTC"], ["GAPDH", "Forward", "CTGGGCTACACTGAGCACC"], ["Reverse", "AAGTGGTCGTTGAGGGCAATG"]], "row_count": 11, "column_count": 3, "numeric_cells": 1, "header_rows": 1, "locator": "section[10]/table-wrap[1]#T1"}}], "gaps": ["asset:data:geo:GSE103236 not downloaded", "asset:data:geo:GSE103236 licence not read", "asset:data:geo:GSE118897 not downloaded", "asset:data:geo:GSE118897 licence not read"]}, "analysis": {"state": "partial", "methods": [{"id": "method-1", "family": "group_comparison", "specific": "student_t_test", "label": "Group comparison", "dsl_operations": [], "missing_operations": ["student_t"], "expressible": false, "parameters": {}, "data_shapes": ["two_or_more_groups_continuous"], "evidence": {"score": 1.0, "band": "verbatim", "quote": "GraphPad Prism 5.0 software was utilized to perform all the experiments. Results were displayed as the mean±SD and analyzed using the two-tailed Student t-test."}}, {"id": "method-2", "family": "differential_expression", "specific": "limma_voom", "label": "Differential expression analysis", "dsl_operations": ["normalise_counts", "differential_expression_fit", "fdr_bh"], "missing_operations": [], "expressible": true, "parameters": {}, "data_shapes": ["count_matrix_with_condition"], "evidence": {"score": 0.7, "band": "medium", "quote": "Limma"}}], "targets": [], "gaps": ["method.student_t"]}, "capability": {"state": "complete", "requirements": [{"capability_id": "capability:computational_analysis", "label": "Computational analysis platform", "assay_families": ["meta_analysis", "machine_learning", "survival_analysis", "statistical_regression", "pca", "molecular_docking", "network_analysis", "differential_expression", "gwas"], "availability_state": "owned", "tier_unlocked": "R1", "candidate": "Automated Assays Laravel application and simulated adapters"}], "gaps": []}, "readiness": {"state": "complete", "tier": "R1", "blocking_axis": "none", "blocked_on": "nothing:replicable_now", "axes": {"method": {"tier": "R1", "expressible": false, "required_operations": [], "missing_operations": ["student_t"], "basis": "The paper names the method it used and the corpus's method extractor maps it onto the DSL catalogue: student_t_test."}, "capability": {"tier": "R1", "capability_id": "capability:computational_analysis", "availability_state": "owned", "basis": "The computational analysis is owned. The physical bench the paper used is not, so a physical validation cannot be run here."}, "data": {"tier": "R1", "reachable": true, "accessions": ["GSE103236", "GSE118897"], "resolved_accessions": ["GSE103236", "GSE118897"], "statements": ["We downloaded two data sets of GC, which were the gene expression profiles of GSE103236 and GSE118897, from GEO."], "basis": "The paper names GSE103236, GSE118897 in Gene Expression Omnibus (GEO) and the accession resolves in the repository. No dataset was downloaded and no licence was read."}}, "can_run": {"dsl_operations": [], "assets": ["source:pmid:33437215", "data:geo:GSE103236", "asset:table:pmid:33437215:1"], "steps": []}, "must_build": {"dsl_operations": [{"operation": "student_t", "unlocks_papers": null, "priority": null}], "converters": [], "readers": [], "capabilities": [], "data_gaps": ["data:geo:GSE103236"]}, "gaps": []}, "review": {"state": "partial", "machine_critique": {"kind": "extraction_review", "reader": {"model": "MiniMax-M3.1-Flash", "provider": "minimax", "provider_family": "minimax", "read_at": "2026-10-31T18:26:00Z", "independence": "single_reader"}, "evidence_check": {"method": "verbatim", "availability": null}, "calls": 3, "usage": {"prompt_tokens": 23364, "completion_tokens": 1062, "cached_tokens": 792}}, "human_critique": null, "stages": [{"id": "extraction", "state": "complete", "reader": "MiniMax-M3.1-Flash", "provider": "minimax"}], "gaps": ["review.independent_reader", "review.machine_critique", "review.human_critique"]}, "execution": {"state": "absent", "status": "not_run", "mode": null, "runs": [], "gaps": ["execution.not_run"]}, "provenance": {"entities": [{"id": "pmid:33437215", "type": "paper", "label": "pmid:33437215"}, {"id": "source:pmid:33437215", "type": "manuscript", "label": "PMID 33437215 full text"}, {"id": "data:geo:GSE103236", "type": "dataset", "label": "GEO GSE103236"}], "activities": [{"id": "activity-reading-sci-2026-11-01", "type": "classification", "used": [{"id": "pmid:33437215", "type": "paper", "label": "pmid:33437215"}, {"id": "source:pmid:33437215", "type": "manuscript", "label": "PMID 33437215 full text"}, {"id": "data:geo:GSE103236", "type": "dataset", "label": "GEO GSE103236"}], "agent": "agent:corpus-assay-engine"}, {"id": "activity-read-33437215", "type": "extraction", "used": ["source:pmid:33437215"], "agent": "agent:minimax-reader"}, {"id": "activity-resolve-GSE103236", "type": "accession_resolution", "used": ["data:geo:GSE103236"], "agent": "agent:corpus-assay-engine"}], "agents": [{"id": "agent:corpus-assay-engine", "type": "software", "label": "Corpus assay engine"}, {"id": "agent:minimax-reader", "type": "software", "label": "MiniMax literature reader"}], "source_run_id": "reading-sci-2026-11-01", "dsl_catalogue_fingerprint": "343fb30756ba6ec3", "capability_table_fingerprint": "2cb3e42f047d2ecf", "snapshot_id": "ba34b49490d9bfaf"}, "lineage": {"parent_id": "pmid:33437215", "parent_hash": "sha256:59005375d8102fadacfdd0a33fe731f982a1888d74751332af7235c5a62f54f0", "fork_of": null, "generation": 7}, "gaps": ["asset:data:geo:GSE103236 licence not read", "asset:data:geo:GSE103236 not downloaded", "asset:data:geo:GSE118897 licence not read", "asset:data:geo:GSE118897 not downloaded", "execution.not_run", "method.student_t", "review.human_critique", "review.independent_reader", "review.machine_critique", "step:run_analysis blocked on method:student_t"], "assays": [{"role": "data_generation", "definition_id": "microarray", "definition_version": "99e1195c7d6f", "definition_digest": null, "required_operations": [], "support_state": "partial", "source_hashes": {"assay_lexicon": "99e1195c7d6f"}, "confidence": 0.99, "evidence": ["grated bioinformatics analysis. Methods: Two microarray datasets from Gene Expression Omnibus (GEO)", "ssion Omnibus (GEO) database. Two integrated microarray datasets were used to obtain differentially"], "order_basis": "paper_text_order:443", "id": "assay:1"}, {"role": "data_generation", "definition_id": "western_blot", "definition_version": "99e1195c7d6f", "definition_digest": null, "required_operations": [], "support_state": "partial", "source_hashes": {"assay_lexicon": "99e1195c7d6f"}, "confidence": 0.99, "evidence": ["d based on TCGA database provided by UALCAN. Western blot and quantitative real time PCR assay were pe", "in STAD based on sample types. In the final, western blot and qRT-PCR assay were performed to determin"], "order_basis": "paper_text_order:825", "id": "assay:2"}, {"role": "data_generation", "definition_id": "cell_culture", "definition_version": "99e1195c7d6f", "definition_digest": null, "required_operations": [], "support_state": "partial", "source_hashes": {"assay_lexicon": "99e1195c7d6f"}, "confidence": 0.99, "evidence": ["C cell lines NCI-N87, SNU-1 and MGC80-3 were cultured in RPMI 1640 Medium (Gibco, 31800022) with 10%", "(FBS). GC cell lines KATO III and SNU-5 were cultured in Iscove's Modified Dulbecco's Medium (IMDM) (", "S. Human fibroblast cells Hs 738.St/Int were cultured in dulbecco's modified eagle medium (DMEM) (Inv", "1960-044) with 10% heat‐inactivated FBS. All cultured cells were incubated in a humidified atmosph"], "order_basis": "paper_text_order:2632", "id": "assay:3"}, {"role": "analysis", "definition_id": "group_comparison", "definition_version": "f2132e96ae6c7a4e", "definition_digest": null, "required_operations": [], "support_state": "partial", "source_hashes": {"dsl_catalogue": "f2132e96ae6c7a4e"}, "confidence": 1.0, "evidence": ["GraphPad Prism 5.0 software was utilized to perform all the experiments. Results were displayed as the mean±SD and analyzed using the two-tailed Student t-test."], "order_basis": "consumes_earlier_output", "id": "assay:4"}]}