LncRNA NEAT1 promotes nucleus pulposus cell matrix degradation through regulating Nrf2/ARE axis.

{"sci_version": "1.2", "schema": "https://corpus.bntrg.co.uk/sci/1.0/sci.schema.json", "id": "pmid:33478594", "kind": "science-record", "revision": 8, "content_hash": "sha256:bc39919dcd5ed70466f5738eb359f94e8cdf74060a10a6ce8ce3455c4af42d6f", "created_at": "2026-11-01T15:41:23Z", "updated_at": "2026-11-01T22:46:01Z", "generator": {"name": "corpus-assay-engine", "run_id": "reading-sci-2026-11-01"}, "paper": {"state": "complete", "title": "LncRNA NEAT1 promotes nucleus pulposus cell matrix degradation through regulating Nrf2/ARE axis.", "doi": "10.1186/s40001-021-00481-2", "pmid": "33478594", "authors": ["Cheng Li", "Xinjian Ma", "Chenfei Ni", "Jingyan Xu", "Yinfei Xie", "Junwei Kan", "Xiaoli Wei"], "journal": "European journal of medical research", "year": 2021, "abstract": "BACKGROUND: This study aimed to assess the role and mechanism of lncRNA NEAT1 in intervertebral disc degeneration (IVD).\nMETHODS: LncRNA profile (GSE56081) between IVD and healthy control was downloaded from the Gene Expression Omnibus (GEO) database and analyzes differential lncRNA expression. Expression of lncRNA NEAT1 in IVD tissue and TNF-α/IL-1β-stimulated nucleus pulposus cells were further measured by RT-PCR. The lncRNA NEAT1 overexpression plasmids (pcDNA-NEAT1) were constructed and transfected into nucleus pulposus cells. Catabolic biomarkers (MMP-3 and MMP-13), anabolic biomarkers (Col II and Aggrecan) and Nrf2 expression were further measured. To further investigate the function of Nrf2, nucleus pulposus cells were pretreated with or without 25 μM tert-Butylhydroquinone (TBHQ), a Nrf2 activator, for 18 h and subsequently cotreated with pcDNA-NEAT1.\nRESULTS: A total of 1432 lncRNAs were differentially expressed in GSE56081. Bioinformatic analysis found that these lncRNAs mainly enriched in Nrf2/ARE signaling pathway. LncRNA NEAT1 was highly expressed in IVD tissues than that of healthy control. Moreover, TNF-α/IL-1β induced a time- and dose-dependent increase in the mRNA expression of lncRNA NEAT1 in the nucleus pulposus cells. Overexpression of lncRNA NEAT1 abates promotes nucleus pulposus cells proliferation but induces matrix degradation. Meanwhile, nucleus and cytoplasm Nrf2 expression was significantly down-regulated by lncRNA NEAT1 upregulation. Nrf2 activator (TBHQ) could partially reverse the inhibitory effects of overexpression of lncRNA NEAT1 on matrix degradation.\nCONCLUSION: Collectively, our data unveiled the lncRNA NEAT1 promotes matrix degradation by regulating Nrf2/ARE signaling pathway, suggesting a potential therapeutic for IVD in the future.", "claims": [{"id": "claim-method", "statement": "We identified differentially expressed lncRNAs with the limma package.", "kind": "methodological", "target": null, "evidence": [{"asset": "source:pmid:33478594", "locator": "sections[3] \"Differential expression analysis\" paragraph 2", "quote": "We identified differentially expressed lncRNAs with the limma package."}], "state": "complete"}, {"id": "claim-data-access", "statement": "We declare that the materials described in the manuscript will be freely available to all scientists for non-commercial purposes.", "kind": "methodological", "target": null, "evidence": [{"asset": "source:pmid:33478594", "locator": "sections[23] \"Availability of data and materials\" paragraph 2", "quote": "We declare that the materials described in the manuscript will be freely available to all scientists for non-commercial purposes."}], "state": "complete"}], "gaps": []}, "experiment": {"state": "complete", "objective": null, "steps": [{"id": "read_published_estimate", "order": 1, "name": "Read the published estimate from the source", "kind": "other", "state": "complete", "blocked_on": null, "description": "The claim, method and evidence span published with the source article.", "duration_hours": null, "parameters": {}, "inputs": ["source:pmid:33478594"], "outputs": ["the published estimate and its evidence"], "instruments": [], "reagents": []}, {"id": "obtain_source_data", "order": 2, "name": "Obtain the source data from the named repository", "kind": "data-preparation", "state": "complete", "blocked_on": null, "description": "The GEO series accession resolves and its sample accessions are listed. This lane did not download the dataset or read its licence.", "duration_hours": null, "parameters": {}, "inputs": ["data:geo:GSE56081"], "outputs": ["the source data with its repository provenance"], "instruments": [], "reagents": []}, {"id": "run_analysis", "order": 3, "name": "Run the published analysis", "kind": "analysis", "state": "complete", "blocked_on": null, "description": "Apply the paper's statistical method to the resolved series and compare the result with the published target.", "duration_hours": null, "parameters": {}, "inputs": ["data:geo:GSE56081"], "outputs": ["the replicated result and its comparison"], "instruments": [], "reagents": []}], "materials": [], "instruments": [], "reagents": [], "conditions": {}, "gaps": []}, "data": {"state": "partial", "assets": [{"id": "source:pmid:33478594", "role": "manuscript", "format": "xml", "media_type": "application/xml", "uri": "https://doi.org/10.1186/s40001-021-00481-2", "sha256": "sha256:d13a846252edc35208ef6a51b460bc8444728fea27c8ce6d0a5189aa00b7cefc", "bytes": 28564, "access": "open", "state": "resolved", "reader": null, "reader_status": "reader_required", "identifier": "10.1186/s40001-021-00481-2", "version": null, "note": "Full article fetched from PMC; the checksum covers the rendered section body, not the original XML bytes.", "structure": {"pmcid": "PMC7818737", "source": "europe_pmc_fulltext", "coverage": "whole_body", "text_hash_scope": "rendered_section_body"}}, {"id": "data:geo:GSE56081", "role": "raw", "format": "geo-series", "media_type": "application/vnd.ncbi.geo-series+json", "uri": "https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE56081", "sha256": null, "bytes": null, "access": "open", "state": "resolved", "reader": null, "reader_status": "reader_required", "identifier": "GSE56081", "version": null, "note": "We declare that the materials described in the manuscript will be freely available to all scientists for non-commercial purposes.", "structure": {"repository": "GEO", "access_route": "GEO accession URL", "access_statement_verbatim": "We declare that the materials described in the manuscript will be freely available to all scientists for non-commercial purposes.", "access_statement_kind": "data_availability_statement", "sample_accessions": ["GSM1354764", "GSM1354765", "GSM1354766", "GSM1354767", "GSM1354768", "GSM1354769", "GSM1354770", "GSM1354771", "GSM1354772", "GSM1354773"], "sample_count": 10, "group_sizes": null, "group_sizes_basis": null, "platform": "15314", "taxon": "Homo sapiens", "title": "The long noncoding RNA expression profile of human intervertebral disc degeneration identified by microarray analysis", "resolution_checked_at": "2026-11-01T15:39:54Z", "resolution_check": "identifier_resolution_only_no_download_no_licence_read", "downloaded": false, "licence_read": false}}, {"id": "asset:table:pmid:33478594:1", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:b8f270eb9daf4cb3f41aaac6daca5081a433fff8f27a59635ea62ed0991b6167", "bytes": 611, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[9]/table-wrap[1]#Tab1", "version": null, "note": "Sequences of primers used for RT-PCR", "structure": {"pmcid": "PMC7818737", "section_index": 9, "section_title": "PCR", "row_count": 7, "column_count": 3}, "table": {"label": "Table 1", "caption": "Sequences of primers used for RT-PCR", "rows": [["Gene", "Forward primers (5′-3′)", "Reverse primers (5′-3′)"], ["GAPDH", "GGAGCGAGATCCCTCCAAAAT", "GGCTGTTGTCATACTTCTCATGG"], ["Col II", "TGCTGCCTTTTCTGTTCCTT", "AAGGTGCTGGGTAGGGAAGT"], ["Aggrecan", "ACATCTCAGCAGCATCATCACC", "CATCACCACGCAGTCCTCAC"], ["MMP-3", "ATGCCCACTTTGATGATGATGAAC", "CCACGCCTGAAGGAAGAGATG"], ["MMP-13", "CGGTTCCGCCTGTCTCAAG", "CGCCAAAAGTGCCTGTCTT"], ["lncRNA NEAT1", "TGGCTAGCTCAGGGCTTCAG", "TCTCCTTGCCAAGCTTCCTTC"]], "row_count": 7, "column_count": 3, "numeric_cells": 4, "header_rows": 1, "locator": "section[9]/table-wrap[1]#Tab1"}}], "gaps": ["asset:data:geo:GSE56081 not downloaded", "asset:data:geo:GSE56081 licence not read"]}, "analysis": {"state": "partial", "methods": [{"id": "method-1", "family": "differential_expression", "specific": "limma_voom", "label": "Differential expression analysis", "dsl_operations": ["normalise_counts", "differential_expression_fit", "fdr_bh"], "missing_operations": [], "expressible": true, "parameters": {}, "data_shapes": ["count_matrix_with_condition"], "evidence": {"score": 1.0, "band": "verbatim", "quote": "We identified differentially expressed lncRNAs with the limma package."}}, {"id": "method-2", "family": "group_comparison", "specific": "anova", "label": "Group comparison", "dsl_operations": ["group_summary", "welch_t", "bootstrap_mean_difference", "group_comparison_anova"], "missing_operations": [], "expressible": true, "parameters": {}, "data_shapes": ["two_or_more_groups_continuous"], "evidence": {"score": 0.8, "band": "high", "quote": "analysis of variance"}}], "targets": [], "gaps": ["method.reader_differs_from_extractor"]}, "capability": {"state": "complete", "requirements": [{"capability_id": "capability:computational_analysis", "label": "Computational analysis platform", "assay_families": ["meta_analysis", "machine_learning", "survival_analysis", "statistical_regression", "pca", "molecular_docking", "network_analysis", "differential_expression", "gwas"], "availability_state": "owned", "tier_unlocked": "R1", "candidate": "Automated Assays Laravel application and simulated adapters"}], "gaps": []}, "readiness": {"state": "complete", "tier": "R1", "blocking_axis": "none", "blocked_on": "nothing:replicable_now", "axes": {"method": {"tier": "R1", "expressible": true, "required_operations": ["normalise_counts", "differential_expression_fit", "fdr_bh"], "missing_operations": [], "basis": "The paper names the method it used and the corpus's method extractor maps it onto the DSL catalogue: limma_voom."}, "capability": {"tier": "R1", "capability_id": "capability:computational_analysis", "availability_state": "owned", "basis": "The computational analysis is owned. The physical bench the paper used is not, so a physical validation cannot be run here."}, "data": {"tier": "R1", "reachable": true, "accessions": ["GSE56081"], "resolved_accessions": ["GSE56081"], "statements": ["We declare that the materials described in the manuscript will be freely available to all scientists for non-commercial purposes."], "basis": "The paper names GSE56081 in NCBI Gene Expression Omnibus (GEO) and the accession resolves in the repository. No dataset was downloaded and no licence was read."}}, "can_run": {"dsl_operations": ["normalise_counts", "differential_expression_fit", "fdr_bh"], "assets": ["source:pmid:33478594", "data:geo:GSE56081", "asset:table:pmid:33478594:1"], "steps": ["run_analysis"]}, "must_build": {"dsl_operations": [], "converters": [], "readers": [], "capabilities": [], "data_gaps": ["data:geo:GSE56081"]}, "gaps": []}, "review": {"state": "partial", "machine_critique": {"kind": "extraction_review", "reader": {"model": "MiniMax-M3.1-Flash", "provider": "minimax", "provider_family": "minimax", "read_at": "2026-10-31T18:26:24Z", "independence": "single_reader"}, "evidence_check": {"method": "verbatim", "availability": "verbatim"}, "calls": 3, "usage": {"prompt_tokens": 25415, "completion_tokens": 625, "cached_tokens": 784}}, "human_critique": null, "stages": [{"id": "extraction", "state": "complete", "reader": "MiniMax-M3.1-Flash", "provider": "minimax"}], "gaps": ["review.independent_reader", "review.machine_critique", "review.human_critique"]}, "execution": {"state": "absent", "status": "not_run", "mode": null, "runs": [], "gaps": ["execution.not_run"]}, "provenance": {"entities": [{"id": "pmid:33478594", "type": "paper", "label": "pmid:33478594"}, {"id": "source:pmid:33478594", "type": "manuscript", "label": "PMID 33478594 full text"}, {"id": "data:geo:GSE56081", "type": "dataset", "label": "GEO GSE56081"}], "activities": [{"id": "activity-reading-sci-2026-11-01", "type": "classification", "used": [{"id": "pmid:33478594", "type": "paper", "label": "pmid:33478594"}, {"id": "source:pmid:33478594", "type": "manuscript", "label": "PMID 33478594 full text"}, {"id": "data:geo:GSE56081", "type": "dataset", "label": "GEO GSE56081"}], "agent": "agent:corpus-assay-engine"}, {"id": "activity-read-33478594", "type": "extraction", "used": ["source:pmid:33478594"], "agent": "agent:minimax-reader"}, {"id": "activity-resolve-GSE56081", "type": "accession_resolution", "used": ["data:geo:GSE56081"], "agent": "agent:corpus-assay-engine"}], "agents": [{"id": "agent:corpus-assay-engine", "type": "software", "label": "Corpus assay engine"}, {"id": "agent:minimax-reader", "type": "software", "label": "MiniMax literature reader"}], "source_run_id": "reading-sci-2026-11-01", "dsl_catalogue_fingerprint": "343fb30756ba6ec3", "capability_table_fingerprint": "2cb3e42f047d2ecf", "snapshot_id": "ba34b49490d9bfaf"}, "lineage": {"parent_id": "pmid:33478594", "parent_hash": "sha256:4055a85856c70542264c00a5d51119fda03f392692ececd717d402dd5a86951d", "fork_of": null, "generation": 7}, "gaps": ["asset:data:geo:GSE56081 licence not read", "asset:data:geo:GSE56081 not downloaded", "execution.not_run", "method.reader_differs_from_extractor", "review.human_critique", "review.independent_reader", "review.machine_critique"], "assays": [{"role": "data_generation", "definition_id": "transfection", "definition_version": "99e1195c7d6f", "definition_digest": null, "required_operations": [], "support_state": "partial", "source_hashes": {"assay_lexicon": "99e1195c7d6f"}, "confidence": 0.85, "evidence": ["plasmids (pcDNA-NEAT1) were constructed and transfected into nucleus pulposus cells. Catabolic bioma"], "order_basis": "paper_text_order:549", "id": "assay:1"}, {"role": "data_generation", "definition_id": "cell_culture", "definition_version": "99e1195c7d6f", "definition_digest": null, "required_operations": [], "support_state": "partial", "source_hashes": {"assay_lexicon": "99e1195c7d6f"}, "confidence": 0.77, "evidence": ["at 37 °C for 4 h. Then, isolated cells were cultured in Dulbecco’s modified Eagle medium containing"], "order_basis": "paper_text_order:2726", "id": "assay:2"}, {"role": "analysis", "definition_id": "differential_expression", "definition_version": "f2132e96ae6c7a4e", "definition_digest": null, "required_operations": ["normalise_counts", "differential_expression_fit", "fdr_bh"], "support_state": "supported", "source_hashes": {"dsl_catalogue": "f2132e96ae6c7a4e"}, "confidence": 1.0, "evidence": ["We identified differentially expressed lncRNAs with the limma package."], "order_basis": "consumes_earlier_output", "id": "assay:3"}]}