Wfs1 and Related Molecules as Key Candidate Genes in the Hippocampus of Depression.

{"sci_version": "1.2", "schema": "https://corpus.bntrg.co.uk/sci/1.0/sci.schema.json", "id": "pmid:33552119", "kind": "science-record", "revision": 7, "content_hash": "sha256:c5bfad758427c6f2232f11a30652eb1c292188ec9ee12fedba244540f4a20bb7", "created_at": "2026-11-01T15:41:24Z", "updated_at": "2026-11-01T22:03:03Z", "generator": {"name": "corpus-assay-engine", "run_id": "reading-sci-2026-11-01"}, "paper": {"state": "complete", "title": "Wfs1 and Related Molecules as Key Candidate Genes in the Hippocampus of Depression.", "doi": "10.3389/fgene.2020.589370", "pmid": "33552119", "authors": ["Jing Yang", "Chaoqin Chen", "Xiaoyuan Jin", "Lu Liu", "Jiajia Lin", "Xianhui Kang", "Shengmei Zhu"], "journal": "Frontiers in genetics", "year": 2020, "abstract": "BACKGROUND: Depression is a prevalent mental disorder, which is difficult to diagnose and treat due to its unclear pathogenic mechanisms. The discovery of novel and effective therapeutic targets for depression is urgently needed. The hippocampus is a crucial region involved in depression and has been a therapeutic target for many antidepressants. Thus, it is beneficial for comprehensive research to be carried out on the molecular mechanisms of the hippocampus involved in the pathogenesis of depression. This study aims to investigate the differentially expressed genes (DEG) in the hippocampus in a chronic unpredictable mild stress (CUMS) mouse model.\nMETHOD: The study obtained GSE84183 from the GEO database. The R language screened the differential expression genes (DEG) in the hippocampus tissue of depressed mice, and the enrichment pathways of DEGs were analyzed. A protein-protein interaction (PPI) network was constructed in the STRING database and visualized in Cytoscape software. MicroRNAs for these DEGs were obtained from TarBase and mortar base databases, and transcription factors (TF) related to DEG were predicted from the ENCODE database. Both networks used the visual analysis platform NetworkAnalyst. Finally, the microRNA-TF network was integrated based on the above two networks and imported into Cytoscape for further analysis.\nRESULTS: This study screened 325 differentially expressed genes, containing 42 downregulated genes and 283 upregulated genes. Most of these genes are enriched in the cell cycle and the chemokine signaling pathway. Meanwhile, Wfs1, one of the top ten DEGs, was identified as the key regulator of the cell cycle and the participator in the highest number of modules screened out in PPI networks. Wfs1-related molecules, including UBTF, mmu-mir-17-5p, and mmu-mir-7b-5p, were therefore screened out. Furthermore, we confirmed the downregulation of Wfs1 and upregulation of UBTF/mmu-mir-17-5p/mmu-mir-7b-5p in the hippocampus of the CUMS mouse model. Our data indicate that Wfs1 and related molecules were predicted to be associated with the pathological process of depression. This research provided potential new molecular targets of stress-induced depression.", "claims": [{"id": "claim-method", "statement": "Students’ t-test tests were used for analyzing statistic differences, as indicated in Figure legends.", "kind": "methodological", "target": null, "evidence": [{"asset": "source:pmid:33552119", "locator": "sections[13] \"Data and Statistical Analysis\" paragraph 2", "quote": "Students’ t-test tests were used for analyzing statistic differences, as indicated in Figure legends."}], "state": "complete"}, {"id": "claim-data-access", "statement": "The datasets presented in this study can be found in online repositories. The names of the repository/repositories and accession number(s) can be found in the article/Supplementary Material.", "kind": "methodological", "target": null, "evidence": [{"asset": "source:pmid:33552119", "locator": "sections[23] \"Data Availability Statement\" paragraph 2", "quote": "The datasets presented in this study can be found in online repositories. The names of the repository/repositories and accession number(s) can be found in the article/Supplementary Material."}], "state": "complete"}], "gaps": []}, "experiment": {"state": "complete", "objective": null, "steps": [{"id": "read_published_estimate", "order": 1, "name": "Read the published estimate from the source", "kind": "other", "state": "complete", "blocked_on": null, "description": "The claim, method and evidence span published with the source article.", "duration_hours": null, "parameters": {}, "inputs": ["source:pmid:33552119"], "outputs": ["the published estimate and its evidence"], "instruments": [], "reagents": []}, {"id": "obtain_source_data", "order": 2, "name": "Obtain the source data from the named repository", "kind": "data-preparation", "state": "complete", "blocked_on": null, "description": "The GEO series accession resolves and its sample accessions are listed. This lane did not download the dataset or read its licence.", "duration_hours": null, "parameters": {}, "inputs": ["data:geo:GSE84183"], "outputs": ["the source data with its repository provenance"], "instruments": [], "reagents": []}, {"id": "run_analysis", "order": 3, "name": "Run the published analysis", "kind": "analysis", "state": "complete", "blocked_on": null, "description": "Apply the paper's statistical method to the resolved series and compare the result with the published target.", "duration_hours": null, "parameters": {}, "inputs": ["data:geo:GSE84183"], "outputs": ["the replicated result and its comparison"], "instruments": [], "reagents": []}], "materials": [], "instruments": [], "reagents": [], "conditions": {}, "gaps": []}, "data": {"state": "partial", "assets": [{"id": "source:pmid:33552119", "role": "manuscript", "format": "xml", "media_type": "application/xml", "uri": "https://doi.org/10.3389/fgene.2020.589370", "sha256": "sha256:3296a3d6ac433b8543bf2cfb3dd46bcc04f117f7f0bf2af1cad9aa39e6727c4e", "bytes": 30283, "access": "open", "state": "resolved", "reader": null, "reader_status": "reader_required", "identifier": "10.3389/fgene.2020.589370", "version": null, "note": "Full article fetched from PMC; the checksum covers the rendered section body, not the original XML bytes.", "structure": {"pmcid": "PMC7863986", "source": "europe_pmc_fulltext", "coverage": "whole_body_without_references", "text_hash_scope": "rendered_section_body"}}, {"id": "data:geo:GSE84183", "role": "raw", "format": "geo-series", "media_type": "application/vnd.ncbi.geo-series+json", "uri": "https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE84183", "sha256": null, "bytes": null, "access": "open", "state": "resolved", "reader": null, "reader_status": "reader_required", "identifier": "GSE84183", "version": null, "note": "The datasets presented in this study can be found in online repositories. The names of the repository/repositories and accession number(s) can be found in the article/Supplementary Material.", "structure": {"repository": "GEO", "access_route": "GEO accession URL", "access_statement_verbatim": "The datasets presented in this study can be found in online repositories. The names of the repository/repositories and accession number(s) can be found in the article/Supplementary Material.", "access_statement_kind": "data_availability_statement", "sample_accessions": ["GSM2228639", "GSM2228640", "GSM2228641", "GSM2228642", "GSM2228643", "GSM2228644", "GSM2228645", "GSM2228646", "GSM2228647", "GSM2228648", "GSM2228649", "GSM2228650", "GSM2228651", "GSM2228652", "GSM2228653", "GSM2228654", "GSM2228655", "GSM2228656", "GSM2228657", "GSM2228658", "GSM2228659", "GSM2228660", "GSM2228661", "GSM2228662", "GSM2228663", "GSM2228664", "GSM2228665", "GSM2228666", "GSM2228667", "GSM2228668", "GSM2228669", "GSM2228670", "GSM2228671", "GSM2228672", "GSM2228673", "GSM2228674", "GSM2228675", "GSM2228676", "GSM2228677", "GSM2228678", "GSM2228679", "GSM2228680", "GSM2228681", "GSM2228682", "GSM2228683", "GSM2228684", "GSM2228685", "GSM2228686", "GSM2228687", "GSM2228688", "GSM2228689", "GSM2228690", "GSM2228691", "GSM2228692", "GSM2228693", "GSM2228694", "GSM2228695", "GSM2228696", "GSM2228697", "GSM2228698", "GSM2228699", "GSM2228700", "GSM2228701", "GSM2228702"], "sample_count": 64, "group_sizes": null, "group_sizes_basis": null, "platform": "13912", "taxon": "Mus musculus", "title": "Transcription profiling of dentate gyrus and anterior cingulate cortex in mice exposed Unpredicatble Chronic Mild Stress and treated with fluoxetine", "resolution_checked_at": "2026-11-01T15:39:55Z", "resolution_check": "identifier_resolution_only_no_download_no_licence_read", "downloaded": false, "licence_read": false}}, {"id": "asset:table:pmid:33552119:1", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:ddc3fbaa8bf6ba4a76a35cf80074943bee049a835d237507d6bbdc65060cecea", "bytes": 814, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[12]/table-wrap[1]#T1", "version": null, "note": "Primer used in this study.", "structure": {"pmcid": "PMC7863986", "section_index": 12, "section_title": "Real-Time Polymerase Chain Reaction (RT-PCR)", "row_count": 13, "column_count": 3}, "table": {"label": "TABLE 1", "caption": "Primer used in this study.", "rows": [["Gene", "Primers", "Sequence"], ["GAPDH", "Forward primers", "AAGGTCGGTGTGAACGGATT"], ["", "Reverse primers", "TGAACTTGCCGTGGGTAGAG"], ["Wfs1", "Forward primers", "GGAAACTAACATGGCCCGGA"], ["", "Reverse primers", "GTGATGGAGGGTCTTTGGGG"], ["UBTF", "Forward primers", "ACAACCTCCCATCCAACGAC"], ["", "Reverse primers", "TGTTGTGTTGACCCCTCCAC"], ["U6", "Forward primers", "AGAGAAGATTAGCATGGCCCCTG"], ["", "Reverse primers", "ATCCAGTGCAGGGTCCGAGG"], ["mmu-mir-17-5p", "Forward primers", "ACACTCCAGCTGGGCAAAGTGCTTACAGTGCAG"], ["", "Reverse primers", "CTCAACTGGTGTCGTGGA"], ["mmu-mir-7b-5p", "Forward primers", "TCCAAGACATGTGATCCGTGTT"], ["", "Reverse primers", "GGGTTACTCCCGTTTGGTTGT"]], "row_count": 13, "column_count": 3, "numeric_cells": 2, "header_rows": 1, "locator": "section[12]/table-wrap[1]#T1"}}, {"id": "asset:table:pmid:33552119:2", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:cf434a4ce96aa1d0f09552b5068adae5a14fe2cb395a41d8564154cb5bb8a88a", "bytes": 1259, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[17]/table-wrap[1]#T2", "version": null, "note": "Top 10 biological process of DEGs.", "structure": {"pmcid": "PMC7863986", "section_index": 17, "section_title": "Functional Enrichment Analysis of DEGs", "row_count": 11, "column_count": 3}, "table": {"label": "TABLE 2", "caption": "Top 10 biological process of DEGs.", "rows": [["Term", "Genes", "P value"], ["GO: 0050795 ∼ circadian rhythm", "Lepr/Ptger3/Mc3r/Ghsr/Pmch/Ptgds/Casp1/Cckbr", "9.60E-06"], ["GO: 0007622 ∼ cytokine biosynthesis processes", "Lepr/Chat/Ptger3/Mc3r/Pmch/Ptgds/Casp1", "5.17E-06"], ["GO: 0061053 ∼ prostaglandin biosynthesis processes", "Gdf3/Frzb/Ror2/Foxc2/Dmrt2/Cobl/Aldh1a2", "7.71E-05"], ["GO: 0048592 ∼ synaptic vesicle fusion on the regulation of presynaptic active zone membrane", "Kdr/Vax2/Hcn1/Trpm1/Rs1/Prox1/Rbp4/Nrl/Col8a2", "0.000130269"], ["GO:0030335∼segmentation", "Gdf3/Sema3a/Ror2/Foxc2/Dmrt2/Cobl/Aldh1a2", "7.88E-13"], ["GO: 0048512 ∼circadian behavior", "Lepr/Ptger3/Mc3r/Pmch/Ptgds/Casp1", "5.02E-05"], ["GO: 0048520 ∼positive regulation of behavior", "Ptger3/Ghsr/Pmch/Casp1/Cckbr", "6.79E-05"], ["GO:0045087∼ positive regulation of sprouting angiogenesis", "Kdr/Srpx2/Ghsr/Foxc2/Fgfbp1", "2.01E-09"], ["GO: 0051764 ∼actin crosslink formation", "Baiap2l2/Tnnt2/Baiap2l1/Cobl", "4.11E-06"], ["GO: 0090050 positive regulation of cell migration involved in sprouting angiogenesis", "Kdr/Srpx2/Foxc2/Fgfbp1", "6.85E-05"]], "row_count": 11, "column_count": 3, "numeric_cells": 20, "header_rows": 1, "locator": "section[17]/table-wrap[1]#T2"}}, {"id": "asset:table:pmid:33552119:3", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:23fa27dc374870030e35fbecd2aa7deede783621ebe19700a41a9c083e96f68d", "bytes": 664, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[18]/table-wrap[1]#T3", "version": null, "note": "Module analysis of DEGs using Cytoscape.", "structure": {"pmcid": "PMC7863986", "section_index": 18, "section_title": "PPI Network and Module Analysis", "row_count": 10, "column_count": 5}, "table": {"label": "TABLE 3", "caption": "Module analysis of DEGs using Cytoscape.", "rows": [["Cluster", "Score", "Nodes", "Edges", "Node IDs"], ["1", "6", "6", "15", "Serpind1/Ckap4/Wfs1/Notum/Serpina1e/Apol9a"], ["2", "6", "6", "15", "Ghsr/Ntsr1/Cckbr/Adra1d/Pmch/Avp"], ["3", "6", "6", "15", "Gm17669/Rpl30/Rpl4/Rpl34/Rps21/Rps23"], ["4", "4.5", "5", "9", "Gdf3/Lin28a/Sall4/Utf1/Tfcp2l1"], ["5", "4", "4", "6", "H2-Eb1/Cd4/Cd3e/Zap70"], ["6", "3", "3", "3", "Ptger3/Tas2r113/Tas2r109"], ["7", "3", "3", "3", "Kdf1/Tjp3/Grb7"], ["8", "3", "3", "3", "Bmp3/Wfikkn2/Fst"], ["9", "3", "3", "3", "Rapsn/Chrna1/Chrna2"]], "row_count": 10, "column_count": 5, "numeric_cells": 40, "header_rows": 1, "locator": "section[18]/table-wrap[1]#T3"}}, {"id": "asset:table:pmid:33552119:4", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:95f8864467bd029d09baf710bef3dd8a35d3757f1a233b83239aebf7f93b654a", "bytes": 1732, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[19]/table-wrap[1]#T4", "version": null, "note": "Co-DEGs regulated by TF and miRNAs.", "structure": {"pmcid": "PMC7863986", "section_index": 19, "section_title": "Construction of the TF-DEG- MicroRNA Network Analysis", "row_count": 21, "column_count": 6}, "table": {"label": "TABLE 4", "caption": "Co-DEGs regulated by TF and miRNAs.", "rows": [["TF", "DEGs", "Gene counts", "miRNA", "DEGs", "Gene counts"], ["UBTF", "Arid4b, Aff4, Raver1, Wfs1, Dtl, Camk2n1", "6", "mmu-mir-17-5p", "Wfs1, Camk2n1, Aff4", "3"], ["ELF1", "Aff4, Utf1, Raver1, Wfs1, Ckap4", "5", "mmu-let-7b-5p", "Ptgds, Khsrp, Arhgap1", "3"], ["CHD2", "Arhgap1, Khsrp, Dtl, Lin28a, Sall4", "5", "mmu-mir-362-3p", "Lin28a, Wfs1, Igf1", "3"], ["HCFC1", "Prox1, Raver1, Aff4, Ror2, Cbln1", "5", "mmu-mir-329-3p", "Lin28a, Wfs1, Igf1", "3"], ["TBP", "Aff4, Raver1, Wfs1, Dtl", "4", "mmu-mir-3473c", "Camk2n1, Ror2, Shc4", "3"], ["MXI1", "Utf1, Raver1, Ckap4, Khsrp", "4", "mmu-mir-7b-5p", "Camk2n1, Raver1, Ubr2", "3"], ["MAZ", "Raver1, Wfs1, Ckap4", "3", "mmu-mir-19b-3p", "Arid4b, Camk2n1, Aff4", "3"], ["E2F4", "Wfs1, Dtl, Khsrp", "3", "mmu-mir-340-5p", "Arid4b, Camk2n1, Aff4", "3"], ["BHLHE40", "Ckap4, Utf1, Shc4", "3", "mmu-mir-30e-5p", "Arid4b, Camk2n1, Aff4", "3"], ["ETS1", "Igf1, Dtl, Raver1", "3", "mmu-mir-466f-3p", "Wfs1, Arid4b", "2"], ["USF1", "Khsrp, Ptgds, Nrl", "3", "mmu-mir-466i-3p", "Wfs1, Igf1", "2"], ["SIN3A", "E2F4, Igf1, Dtl", "3", "mmu-let-7c-5p", "Sall4, Lin28a", "2"], ["TCF12", "Aff4, TCF12", "2", "mmu-mir-124-3p", "Cbln1, Prox1", "2"], ["MYC", "Utf1, Raver1", "2", "mmu-mir-26a-5p", "Shc4, Ckap4", "2"], ["MYB", "Utf1, Raver1", "2", "mmu-mir-9-5p", "Ptgds, Ror2", "2"], ["ZMIZ1", "Utf1, Raver1", "2", "mmu-mir-181a-5p", "Aff4, Prox1", "2"], ["MEF2A", "Ubr2, Shc4", "2", "mmu-mir-758-3p", "Khsrp, Arid4b", "2"], ["KAT2A", "Dtl, Raver1", "2", "mmu-mir-15a-5p", "Igf1, Cbln1", "2"], ["GATA1", "Raver1, Aff4", "2", "mmu-mir-149-5p", "Cbln1, Arid4b", "2"], ["RCOR1", "Raver1, Dtl", "2", "mmu-mir-301b-3p", "Camk2n1, Aff4", "2"]], "row_count": 21, "column_count": 6, "numeric_cells": 67, "header_rows": 1, "locator": "section[19]/table-wrap[1]#T4"}}], "gaps": ["asset:data:geo:GSE84183 not downloaded", "asset:data:geo:GSE84183 licence not read"]}, "analysis": {"state": "partial", "methods": [{"id": "method-1", "family": "network_analysis", "specific": "ppi_network", "label": "Network / pathway analysis", "dsl_operations": ["build_graph", "centrality_scores", "pathway_enrich"], "missing_operations": [], "expressible": true, "parameters": {}, "data_shapes": ["edge_list"], "evidence": {"score": 0.7, "band": "medium", "quote": "protein-protein interaction"}}, {"id": "method-2", "family": null, "specific": null, "label": "Students’ t-test", "dsl_operations": [], "missing_operations": [], "expressible": null, "parameters": {}, "data_shapes": [], "evidence": {"score": 1.0, "band": "verbatim", "quote": "Students’ t-test tests were used for analyzing statistic differences, as indicated in Figure legends."}}], "targets": [], "gaps": ["method.reader_named_unmapped"]}, "capability": {"state": "complete", "requirements": [{"capability_id": "capability:computational_analysis", "label": "Computational analysis platform", "assay_families": ["meta_analysis", "machine_learning", "survival_analysis", "statistical_regression", "pca", "molecular_docking", "network_analysis", "differential_expression", "gwas"], "availability_state": "owned", "tier_unlocked": "R1", "candidate": "Automated Assays Laravel application and simulated adapters"}], "gaps": []}, "readiness": {"state": "complete", "tier": "R1", "blocking_axis": "none", "blocked_on": "nothing:replicable_now", "axes": {"method": {"tier": "R1", "expressible": true, "required_operations": ["build_graph", "centrality_scores", "pathway_enrich"], "missing_operations": [], "basis": "The paper names the method it used and the corpus's method extractor maps it onto the DSL catalogue: ppi_network."}, "capability": {"tier": "R1", "capability_id": "capability:computational_analysis", "availability_state": "owned", "basis": "The computational analysis is owned. The physical bench the paper used is not, so a physical validation cannot be run here."}, "data": {"tier": "R1", "reachable": true, "accessions": ["GSE84183"], "resolved_accessions": ["GSE84183"], "statements": ["The datasets presented in this study can be found in online repositories. The names of the repository/repositories and accession number(s) can be found in the article/Supplementary Material."], "basis": "The paper names GSE84183 in Gene Expression Omnibus (GEO) and the accession resolves in the repository. No dataset was downloaded and no licence was read."}}, "can_run": {"dsl_operations": ["build_graph", "centrality_scores", "pathway_enrich"], "assets": ["source:pmid:33552119", "data:geo:GSE84183", "asset:table:pmid:33552119:1", "asset:table:pmid:33552119:2", "asset:table:pmid:33552119:3", "asset:table:pmid:33552119:4"], "steps": ["run_analysis"]}, "must_build": {"dsl_operations": [], "converters": [], "readers": [], "capabilities": [], "data_gaps": ["data:geo:GSE84183"]}, "gaps": []}, "review": {"state": "partial", "machine_critique": {"kind": "extraction_review", "reader": {"model": "MiniMax-M3.1-Flash", "provider": "minimax", "provider_family": "minimax", "read_at": "2026-10-31T18:26:40Z", "independence": "single_reader"}, "evidence_check": {"method": "verbatim", "availability": "verbatim"}, "calls": 3, "usage": {"prompt_tokens": 23441, "completion_tokens": 712, "cached_tokens": 792}}, "human_critique": null, "stages": [{"id": "extraction", "state": "complete", "reader": "MiniMax-M3.1-Flash", "provider": "minimax"}], "gaps": ["review.independent_reader", "review.machine_critique", "review.human_critique"]}, "execution": {"state": "absent", "status": "not_run", "mode": null, "runs": [], "gaps": ["execution.not_run"]}, "provenance": {"entities": [{"id": "pmid:33552119", "type": "paper", "label": "pmid:33552119"}, {"id": "source:pmid:33552119", "type": "manuscript", "label": "PMID 33552119 full text"}, {"id": "data:geo:GSE84183", "type": "dataset", "label": "GEO GSE84183"}], "activities": [{"id": "activity-reading-sci-2026-11-01", "type": "classification", "used": [{"id": "pmid:33552119", "type": "paper", "label": "pmid:33552119"}, {"id": "source:pmid:33552119", "type": "manuscript", "label": "PMID 33552119 full text"}, {"id": "data:geo:GSE84183", "type": "dataset", "label": "GEO GSE84183"}], "agent": "agent:corpus-assay-engine"}, {"id": "activity-read-33552119", "type": "extraction", "used": ["source:pmid:33552119"], "agent": "agent:minimax-reader"}, {"id": "activity-resolve-GSE84183", "type": "accession_resolution", "used": ["data:geo:GSE84183"], "agent": "agent:corpus-assay-engine"}], "agents": [{"id": "agent:corpus-assay-engine", "type": "software", "label": "Corpus assay engine"}, {"id": "agent:minimax-reader", "type": "software", "label": "MiniMax literature reader"}], "source_run_id": "reading-sci-2026-11-01", "dsl_catalogue_fingerprint": "343fb30756ba6ec3", "capability_table_fingerprint": "2cb3e42f047d2ecf", "snapshot_id": "ba34b49490d9bfaf"}, "lineage": {"parent_id": "pmid:33552119", "parent_hash": "sha256:d8462a3247dedd1d51a7384f956b389e129fa82e4d07276231c30ad95ea6fb4b", "fork_of": null, "generation": 6}, "gaps": ["asset:data:geo:GSE84183 licence not read", "asset:data:geo:GSE84183 not downloaded", "execution.not_run", "method.reader_named_unmapped", "review.human_critique", "review.independent_reader", "review.machine_critique"], "assays": [{"role": "data_generation", "definition_id": "animal_model", "definition_version": "99e1195c7d6f", "definition_digest": null, "required_operations": [], "support_state": "partial", "source_hashes": {"assay_lexicon": "99e1195c7d6f"}, "confidence": 0.99, "evidence": ["n a chronic unpredictable mild stress (CUMS) mouse model. METHOD: The study obtained GSE84183 from th", "mmu-mir-7b-5p in the hippocampus of the CUMS mouse model. Our data indicate that Wfs1 and related mol", "n a chronic unpredictable mild stress (CUMS) mouse model. METHOD: The study obtained GSE84183 f", "mmu-mir-7b-5p in the hippocampus of the CUMS mouse model. Our data indicate that Wfs1 and relat"], "order_basis": "paper_text_order:684", "id": "assay:1"}, {"role": "data_generation", "definition_id": "microarray", "definition_version": "99e1195c7d6f", "definition_digest": null, "required_operations": [], "support_state": "partial", "source_hashes": {"assay_lexicon": "99e1195c7d6f"}, "confidence": 0.93, "evidence": ["performed GSEA analysis for all genes on the microarray. The significantly enriched gene sets were s"], "order_basis": "paper_text_order:5743", "id": "assay:2"}, {"role": "analysis", "definition_id": "network_analysis", "definition_version": "f2132e96ae6c7a4e", "definition_digest": null, "required_operations": ["build_graph", "centrality_scores", "pathway_enrich"], "support_state": "supported", "source_hashes": {"dsl_catalogue": "f2132e96ae6c7a4e"}, "confidence": 0.7, "evidence": ["protein-protein interaction"], "order_basis": "consumes_earlier_output", "id": "assay:3"}]}