CCR7 and its related molecules may be potential biomarkers of pulmonary arterial hypertension.

{"sci_version": "1.2", "schema": "https://corpus.bntrg.co.uk/sci/1.0/sci.schema.json", "id": "pmid:33630421", "kind": "science-record", "revision": 7, "content_hash": "sha256:04ea84b1a073ccfba4b92cf36d37341b7a9032b519d8f14c8c5935b8a9eed8f2", "created_at": "2026-11-01T15:41:26Z", "updated_at": "2026-11-01T22:03:12Z", "generator": {"name": "corpus-assay-engine", "run_id": "reading-sci-2026-11-01"}, "paper": {"state": "complete", "title": "CCR7 and its related molecules may be potential biomarkers of pulmonary arterial hypertension.", "doi": "10.1002/2211-5463.13130", "pmid": "33630421", "authors": ["Mengsi Cai", "Xiuchun Li", "Haoru Dong", "Ying Wang", "Xiaoying Huang"], "journal": "FEBS open bio", "year": 2021, "abstract": "Pulmonary arterial hypertension (PAH) is a chronic progressive cardiovascular disease characterized by vascular remodeling and leading to right-heart failure. The purpose of this research was to further study the pathogenesis of PAH and to detect potential prognostic signatures. Differentially expressed genes (DEGs) selected from GSE38267 were mostly enriched in inflammation-related pathways, suggesting inflammation may be involved in the occurrence and development of PAH. Through the prediction and verification of related miRNAs and long noncoding RNAs using online databases and Gene Expression Omnibus (GEO) datasets, CCR7 and its related molecules, including hsa-let-7e-5p and SNHG12, were identified as possible targets. The expression levels of CCR7, hsa-let-7e-5p and SNHG12 were then verified by quantitative RT-PCR in vivo and in vitro. Further study showed that silencing of SNHG12 decreased the expression of CCR7 under hypoxia treatment in vitro. Dual-luciferase reporter assays were used to verify the relationship between hsa-let-7e-5p and SNHG12. Collectively, our research reveals that a long noncoding RNA-miRNA-mRNA interaction network may be involved in the pathogenesis of PAH and suggests SNHG12, hsa-let-7e-5p and CCR7 as potential biomarkers for PAH.", "claims": [{"id": "claim-data-access", "statement": "The data that support the findings of this study are available in GE0 dataset at https:/www.ncbi.nlm.nih.gov/geo/. These data were derived from the following resources available in the public domain: https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE38267; https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE44145; https://www.ncbi.nlm.nih.gov/ge/query/acc.cgi?acc=GSE67597.", "kind": "methodological", "target": null, "evidence": [{"asset": "source:pmid:33630421", "locator": "sections[34] \"Data accessibility\" paragraph 2", "quote": "The data that support the findings of this study are available in GE0 dataset at https:/www.ncbi.nlm.nih.gov/geo/. These data were derived from the following resources available in the public domain: https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE38267; https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE44145; https://www.ncbi.nlm.nih.gov/ge/query/acc.cgi?acc=GSE67597."}], "state": "complete"}], "gaps": []}, "experiment": {"state": "complete", "objective": null, "steps": [{"id": "read_published_estimate", "order": 1, "name": "Read the published estimate from the source", "kind": "other", "state": "complete", "blocked_on": null, "description": "The claim, method and evidence span published with the source article.", "duration_hours": null, "parameters": {}, "inputs": ["source:pmid:33630421"], "outputs": ["the published estimate and its evidence"], "instruments": [], "reagents": []}, {"id": "obtain_source_data", "order": 2, "name": "Obtain the source data from the named repository", "kind": "data-preparation", "state": "complete", "blocked_on": null, "description": "The GEO series accession resolves and its sample accessions are listed. This lane did not download the dataset or read its licence.", "duration_hours": null, "parameters": {}, "inputs": ["data:geo:GSE38267"], "outputs": ["the source data with its repository provenance"], "instruments": [], "reagents": []}, {"id": "run_analysis", "order": 3, "name": "Run the published analysis", "kind": "analysis", "state": "complete", "blocked_on": null, "description": "Apply the paper's statistical method to the resolved series and compare the result with the published target.", "duration_hours": null, "parameters": {}, "inputs": ["data:geo:GSE38267"], "outputs": ["the replicated result and its comparison"], "instruments": [], "reagents": []}], "materials": [], "instruments": [], "reagents": [], "conditions": {}, "gaps": []}, "data": {"state": "partial", "assets": [{"id": "source:pmid:33630421", "role": "manuscript", "format": "xml", "media_type": "application/xml", "uri": "https://doi.org/10.1002/2211-5463.13130", "sha256": "sha256:97fd819d5c30d261550e33622ba81f552994a3bcf5e0138446106829a0c7ba2d", "bytes": 40400, "access": "open", "state": "resolved", "reader": null, "reader_status": "reader_required", "identifier": "10.1002/2211-5463.13130", "version": null, "note": "Full article fetched from PMC; the checksum covers the rendered section body, not the original XML bytes.", "structure": {"pmcid": "PMC8167855", "source": "europe_pmc_fulltext", "coverage": "whole_body", "text_hash_scope": "rendered_section_body"}}, {"id": "data:geo:GSE38267", "role": "raw", "format": "geo-series", "media_type": "application/vnd.ncbi.geo-series+json", "uri": "https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE38267", "sha256": null, "bytes": null, "access": "open", "state": "resolved", "reader": null, "reader_status": "reader_required", "identifier": "GSE38267", "version": null, "note": "The data that support the findings of this study are available in GE0 dataset at https:/www.ncbi.nlm.nih.gov/geo/. These data were derived from the following resources available in the public domain: https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE38267; https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE44145; https://www.ncbi.nlm.nih.gov/ge/query/acc.cgi?acc=GSE67597.", "structure": {"repository": "GEO", "access_route": "GEO accession URL", "access_statement_verbatim": "The data that support the findings of this study are available in GE0 dataset at https:/www.ncbi.nlm.nih.gov/geo/. These data were derived from the following resources available in the public domain: https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE38267; https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE44145; https://www.ncbi.nlm.nih.gov/ge/query/acc.cgi?acc=GSE67597.", "access_statement_kind": "data_availability_statement", "sample_accessions": ["GSM937756", "GSM937757", "GSM937758", "GSM937759", "GSM937760", "GSM937761", "GSM937762", "GSM937763", "GSM937764", "GSM937765", "GSM937766", "GSM937767", "GSM937768", "GSM937769", "GSM937770", "GSM937771", "GSM937772", "GSM937773", "GSM937774", "GSM937775", "GSM937776", "GSM937777", "GSM937778", "GSM937779", "GSM937780", "GSM937781", "GSM937782", "GSM937783", "GSM937784", "GSM937785", "GSM937786", "GSM937787", "GSM937788", "GSM937789", "GSM937790", "GSM937791", "GSM937792", "GSM937793", "GSM937794", "GSM937795", "GSM937796", "GSM937797", "GSM937798", "GSM937799", "GSM937800", "GSM937801", "GSM937802", "GSM937803", "GSM937804", "GSM937805", "GSM937806", "GSM937807", "GSM937808", "GSM937809", "GSM937810", "GSM937811", "GSM937812", "GSM937813", "GSM937814", "GSM937815", "GSM937816", "GSM937817", "GSM937818", "GSM937819"], "sample_count": 64, "group_sizes": null, "group_sizes_basis": null, "platform": "13607", "taxon": "Homo sapiens", "title": "Gene expression profiling in blood of patients with chronic respiratory failure", "resolution_checked_at": "2026-11-01T15:39:54Z", "resolution_check": "identifier_resolution_only_no_download_no_licence_read", "downloaded": false, "licence_read": false}}, {"id": "data:geo:GSE44145", "role": "raw", "format": "geo-series", "media_type": "application/vnd.ncbi.geo-series+json", "uri": "https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE44145", "sha256": null, "bytes": null, "access": "open", "state": "resolved", "reader": null, "reader_status": "reader_required", "identifier": "GSE44145", "version": null, "note": "The data that support the findings of this study are available in GE0 dataset at https:/www.ncbi.nlm.nih.gov/geo/. These data were derived from the following resources available in the public domain: https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE38267; https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE44145; https://www.ncbi.nlm.nih.gov/ge/query/acc.cgi?acc=GSE67597.", "structure": {"repository": "GEO", "access_route": "GEO accession URL", "access_statement_verbatim": "The data that support the findings of this study are available in GE0 dataset at https:/www.ncbi.nlm.nih.gov/geo/. These data were derived from the following resources available in the public domain: https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE38267; https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE44145; https://www.ncbi.nlm.nih.gov/ge/query/acc.cgi?acc=GSE67597.", "access_statement_kind": "data_availability_statement", "sample_accessions": ["GSM1079640", "GSM1079641"], "sample_count": 2, "group_sizes": null, "group_sizes_basis": null, "platform": "16601", "taxon": "Homo sapiens", "title": "Circulating miRNAs as novel marker of pulmonary hypertension", "resolution_checked_at": "2026-11-01T15:39:54Z", "resolution_check": "identifier_resolution_only_no_download_no_licence_read", "downloaded": false, "licence_read": false}}, {"id": "data:geo:GSE67597", "role": "raw", "format": "geo-series", "media_type": "application/vnd.ncbi.geo-series+json", "uri": "https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE67597", "sha256": null, "bytes": null, "access": "open", "state": "resolved", "reader": null, "reader_status": "reader_required", "identifier": "GSE67597", "version": null, "note": "The data that support the findings of this study are available in GE0 dataset at https:/www.ncbi.nlm.nih.gov/geo/. These data were derived from the following resources available in the public domain: https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE38267; https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE44145; https://www.ncbi.nlm.nih.gov/ge/query/acc.cgi?acc=GSE67597.", "structure": {"repository": "GEO", "access_route": "GEO accession URL", "access_statement_verbatim": "The data that support the findings of this study are available in GE0 dataset at https:/www.ncbi.nlm.nih.gov/geo/. These data were derived from the following resources available in the public domain: https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE38267; https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE44145; https://www.ncbi.nlm.nih.gov/ge/query/acc.cgi?acc=GSE67597.", "access_statement_kind": "data_availability_statement", "sample_accessions": ["GSM1650380", "GSM1650381", "GSM1650382", "GSM1650383", "GSM1650384", "GSM1650385", "GSM1650386", "GSM1650387", "GSM1650388", "GSM1650389", "GSM1650390", "GSM1650391", "GSM1650392", "GSM1650393", "GSM1650394"], "sample_count": 15, "group_sizes": null, "group_sizes_basis": null, "platform": "18402", "taxon": "Homo sapiens", "title": "Identifying microRNAs targeting WNT/β-catenin pathway in end-stage idiopathic pulmonary arterial hypertension", "resolution_checked_at": "2026-11-01T15:39:55Z", "resolution_check": "identifier_resolution_only_no_download_no_licence_read", "downloaded": false, "licence_read": false}}, {"id": "asset:table:pmid:33630421:1", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:3d1d89c8a6bca3256b9fc98fd56d89a361dece0e16ca7f357fe3350b5ad6a43f", "bytes": 1081, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[16]/table-wrap[1]#feb413130-tbl-0001", "version": null, "note": "Primers used for quantitative RT‐PCR in this study. F, forward; R, reverse.", "structure": {"pmcid": "PMC8167855", "section_index": 16, "section_title": "Quantitative RT‐PCR analysis for mRNA, miRNA and lncRNA", "row_count": 9, "column_count": 3}, "table": {"label": "Table 1", "caption": "Primers used for quantitative RT‐PCR in this study. F, forward; R, reverse.", "rows": [["Primer sets name", "Reverse transcriptase primer (5′–3′)", "Real‐time quantitative PCR primer (5′–3′)"], ["CCR7 (mouse)", "/", "F: GCTGAGATGCTCACTGGTCA R: AGCCAGCATAGGCACTAGGA"], ["CCR7 (human)", "/", "F: CCCACAGACTCAAATGCTCA R: CTTTTCCTCACCAAGCCAAG"], ["SNHG12 (mouse)", "/", "F: GATTTTTCCGTCTGGTCCAA R: TGGTCTCCCTCCTCACAATC"], ["SNHG12 (human)", "/", "F: AAGCCTCTGCCTGCCTTC R: GCCACATTCACCACCATCTC"], ["GAPDH", "/", "F: GAACGGGAAGCTCACTGG R: GCCTGCTTCACCACCTTCT"], ["mmu‐let‐7e‐5p", "GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACAACTAT", "F: GCCGGGTGAGGTAGGAGGTTGTATA R: CAGTGCAGGGTCCGAGGTAT"], ["hsa‐let‐7e‐5p", "GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACAACTAT", "F: GCCGTGAGGTAGGAGGTTG R: CAGTGCAGGGTCCGAGGTAT"], ["U6", "GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACAAAATATGGAAC", "F: TGCGGGTGCTCGCTTCGGCAGC R: CAGTGCAGGGTCCGAGGTAT"]], "row_count": 9, "column_count": 3, "numeric_cells": 6, "header_rows": 1, "locator": "section[16]/table-wrap[1]#feb413130-tbl-0001"}}, {"id": "asset:table:pmid:33630421:2", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:3491dfb19b48486ee3eea2167a0c6c633fce299c93db0e58e0325ee982991d17", "bytes": 657, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[22]/table-wrap[1]#feb413130-tbl-0002", "version": null, "note": "Significant gene clusters were analyzed using MCODE plug‐in. ID, identification number.", "structure": {"pmcid": "PMC8167855", "section_index": 22, "section_title": "PPI network construction and excavation of gene clusters", "row_count": 7, "column_count": 5}, "table": {"label": "Table 2", "caption": "Significant gene clusters were analyzed using MCODE plug‐in. ID, identification number.", "rows": [["Cluster", "Score", "Nodes", "Edges", "Node IDs"], ["1", "56.0", "10", "117", "OSBP2, SELENBP1, GYPB, KLF1, DMTN, SLC25A37, FECH, AHSP, ALAS2, SLC4A1"], ["2", "38.0", "8", "81", "CD40LG, BCL2L1, CD6, CD5, CD19, IL7R, CCR7, LCK"], ["3", "20.0", "5", "23", "GSPT1, RPL3L, RPS5, RPL10L, RPL13"], ["4", "12.5", "3", "36", "EPB42, ANK1, SPTB"], ["5", "6.0", "3", "8", "IFIT1B, IFI27, CMPK2"], ["6", "6.0", "3", "6", "SLC6A9, SLC7A5, SLC1A5"]], "row_count": 7, "column_count": 5, "numeric_cells": 29, "header_rows": 1, "locator": "section[22]/table-wrap[1]#feb413130-tbl-0002"}}, {"id": "asset:table:pmid:33630421:3", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:5c46c35e82450419f2d708b840ecc0b1857adaac64d3404feb43a89d94bf28bb", "bytes": 1239, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[23]/table-wrap[1]#feb413130-tbl-0003", "version": null, "note": "miRNAs and their direct target genes.", "structure": {"pmcid": "PMC8167855", "section_index": 23, "section_title": "Potential miRNA mining and enrichment analysis", "row_count": 24, "column_count": 3}, "table": {"label": "Table 3", "caption": "miRNAs and their direct target genes.", "rows": [["miRNA", "Genes targeted by miRNA", "Gene count"], ["hsa‐miR‐6753‐5p", "CD5, IL7R", "2"], ["hsa‐miR‐6825‐5p", "CD5, BCL2L1", "2"], ["hsa‐miR‐3664‐3p", "CD5, LCK", "2"], ["hsa‐miR‐3944‐5p", "CD5, LCK", "2"], ["hsa‐miR‐6766‐5p", "BCL2L1, LCK", "2"], ["hsa‐miR‐6756‐5p", "BCL2L1, LCK, CD6", "3"], ["hsa‐miR‐6731‐5p", "LCK, CCR7", "2"], ["hsa‐miR‐8085", "LCK, CCR7", "2"], ["hsa‐miR‐4652‐5p", "CD19, CD6", "2"], ["hsa‐miR‐149‐3p", "CD6, BCL2L1", "2"], ["hsa‐miR‐6751‐5p", "CD6, BCL2L1", "2"], ["hsa‐miR‐6829‐5p", "CD6, BCL2L1", "2"], ["hsa‐miR‐6773‐5p", "CD6, BCL2L1", "2"], ["hsa‐miR‐4534", "CD40LG, CD6", "2"], ["hsa‐miR‐6785‐5p", "CD6, CCR7, BCL2L1", "3"], ["hsa‐miR‐4728‐5p", "BCL2L1, CCR7", "2"], ["hsa‐let‐7c‐5p", "BCL2L1, CCR7", "2"], ["hsa‐let‐7e‐5p", "BCL2L1, CCR7", "2"], ["hsa‐miR‐7154‐3p", "BCL2L1, CCR7", "2"], ["hsa‐let‐7b‐5p", "BCL2L1, CCR7", "2"], ["hsa‐miR‐6778‐5p", "CCR7, IL7R", "2"], ["hsa‐miR‐646", "CCR7, IL7R", "2"], ["hsa‐miR‐1233‐5p", "CCR7, IL7R", "2"]], "row_count": 24, "column_count": 3, "numeric_cells": 48, "header_rows": 1, "locator": "section[23]/table-wrap[1]#feb413130-tbl-0003"}}, {"id": "asset:table:pmid:33630421:4", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:578bc98554a87a4291358db891f417d41ba3eb9b9c785a67d0eaa85be3bde226", "bytes": 2047, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[23]/table-wrap[2]#feb413130-tbl-0004", "version": null, "note": "Verification of candidate miRNAs through GSE44145 and GSE67597.", "structure": {"pmcid": "PMC8167855", "section_index": 23, "section_title": "Potential miRNA mining and enrichment analysis", "row_count": 24, "column_count": 5}, "table": {"label": "Table 4", "caption": "Verification of candidate miRNAs through GSE44145 and GSE67597.", "rows": [["miRNA", "mRNA", "Log(FC) [GSE44145]", "Log(FC) [GSE67597]", "lncRNA prediction in starBase"], ["hsa‐miR‐6753‐5p", "CD5, IL7R", "no significance", "no significance", "No"], ["hsa‐miR‐6825‐5p", "CD5, BCL2L1", "no significance", "no significance", "No"], ["hsa‐miR‐3664‐3p", "CD5, LCK", "no significance", "−5.3290E−15", "No"], ["hsa‐miR‐3944‐5p", "CD5, LCK", "0.3432", "−0.8840", "No"], ["hsa‐miR‐6766‐5p", "BCL2L1, LCK", "no significance", "no significance", "No"], ["hsa‐miR‐6756‐5p", "BCL2L1, LCK, CD6", "no significance", "no significance", "No"], ["hsa‐miR‐6731‐5p", "LCK, CCR7", "no significance", "no significance", "No"], ["hsa‐miR‐8085", "LCK, CCR7", "no significance", "no significance", "No"], ["hsa‐miR‐4652‐5p", "CD19, CD6", "no significance", "−0.6861", "No"], ["hsa‐miR‐149‐3p", "CD6, BCL2L1", "0.1904", "0.1252", "No"], ["hsa‐miR‐6751‐5p", "CD6, BCL2L1", "no significance", "no significance", "No"], ["hsa‐miR‐6829‐5p", "CD6, BCL2L1", "no significance", "no significance", "No"], ["hsa‐miR‐6773‐5p", "CD6, BCL2L1", "no significance", "no significance", "No"], ["hsa‐miR‐4534", "CD40LG, CD6", "−0.2778", "0.4174", "No"], ["hsa‐miR‐6785‐5p", "CD6, CCR7, BCL2L1", "no significance", "no significance", "No"], ["hsa‐miR‐4728‐5p", "BCL2L1, CCR7", "−0.0219", "1.8762", "No"], ["hsa‐let‐7c‐5p", "BCL2L1, CCR7", "no significance", "no significance", "Yes"], ["hsa‐let‐7e‐5p", "BCL2L1, CCR7", "0.6242", "0.0953", "Yes"], ["hsa‐miR‐7154‐3p", "BCL2L1, CCR7", "no significance", "no significance", "No"], ["hsa‐let‐7b‐5p", "BCL2L1, CCR7", "0.5005", "−0.0893", "Yes"], ["hsa‐miR‐6778‐5p", "CCR7, IL7R", "no significance", "no significance", "No"], ["hsa‐miR‐646", "CCR7, IL7R", "−4.5295", "−0.7849", "No"], ["hsa‐miR‐1233‐5p", "CCR7, IL7R", "no significance", "no significance", "No"]], "row_count": 24, "column_count": 5, "numeric_cells": 43, "header_rows": 1, "locator": "section[23]/table-wrap[2]#feb413130-tbl-0004"}}], "gaps": ["asset:data:geo:GSE38267 not downloaded", "asset:data:geo:GSE38267 licence not read", "asset:data:geo:GSE44145 not downloaded", "asset:data:geo:GSE44145 licence not read", "asset:data:geo:GSE67597 not downloaded", "asset:data:geo:GSE67597 licence not read"]}, "analysis": {"state": "complete", "methods": [{"id": "method-1", "family": "group_comparison", "specific": "anova", "label": "Group comparison", "dsl_operations": ["group_summary", "welch_t", "bootstrap_mean_difference", "group_comparison_anova"], "missing_operations": [], "expressible": true, "parameters": {}, "data_shapes": ["two_or_more_groups_continuous"], "evidence": {"score": 0.8, "band": "high", "quote": "ANOVA"}}, {"id": "method-2", "family": "differential_expression", "specific": "limma_voom", "label": "Differential expression analysis", "dsl_operations": ["normalise_counts", "differential_expression_fit", "fdr_bh"], "missing_operations": [], "expressible": true, "parameters": {}, "data_shapes": ["count_matrix_with_condition"], "evidence": {"score": 0.8, "band": "high", "quote": "limma"}}, {"id": "method-3", "family": "network_analysis", "specific": "pathway_enrichment", "label": "Network / pathway analysis", "dsl_operations": ["pathway_enrich"], "missing_operations": [], "expressible": true, "parameters": {}, "data_shapes": ["edge_list"], "evidence": {"score": 0.8, "band": "high", "quote": "pathway enrichment"}}], "targets": [], "gaps": []}, "capability": {"state": "complete", "requirements": [{"capability_id": "capability:computational_analysis", "label": "Computational analysis platform", "assay_families": ["meta_analysis", "machine_learning", "survival_analysis", "statistical_regression", "pca", "molecular_docking", "network_analysis", "differential_expression", "gwas"], "availability_state": "owned", "tier_unlocked": "R1", "candidate": "Automated Assays Laravel application and simulated adapters"}], "gaps": []}, "readiness": {"state": "complete", "tier": "R1", "blocking_axis": "none", "blocked_on": "nothing:replicable_now", "axes": {"method": {"tier": "R1", "expressible": true, "required_operations": ["group_summary", "welch_t", "bootstrap_mean_difference", "group_comparison_anova"], "missing_operations": [], "basis": "The paper names the method it used and the corpus's method extractor maps it onto the DSL catalogue: anova."}, "capability": {"tier": "R1", "capability_id": "capability:computational_analysis", "availability_state": "owned", "basis": "The computational analysis is owned. The physical bench the paper used is not, so a physical validation cannot be run here."}, "data": {"tier": "R1", "reachable": true, "accessions": ["GSE38267", "GSE44145", "GSE67597"], "resolved_accessions": ["GSE38267", "GSE44145", "GSE67597"], "statements": ["The data that support the findings of this study are available in GE0 dataset at https:/www.ncbi.nlm.nih.gov/geo/. These data were derived from the following resources available in the public domain: https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE38267; https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE44145; https://www.ncbi.nlm.nih.gov/ge/query/acc.cgi?acc=GSE67597."], "basis": "The paper names GSE38267, GSE44145, GSE67597 in Gene Expression Omnibus (GEO) and the accession resolves in the repository. No dataset was downloaded and no licence was read."}}, "can_run": {"dsl_operations": ["group_summary", "welch_t", "bootstrap_mean_difference", "group_comparison_anova"], "assets": ["source:pmid:33630421", "data:geo:GSE38267", "asset:table:pmid:33630421:1", "asset:table:pmid:33630421:2", "asset:table:pmid:33630421:3", "asset:table:pmid:33630421:4"], "steps": ["run_analysis"]}, "must_build": {"dsl_operations": [], "converters": [], "readers": [], "capabilities": [], "data_gaps": ["data:geo:GSE38267"]}, "gaps": []}, "review": {"state": "partial", "machine_critique": {"kind": "extraction_review", "reader": {"model": "MiniMax-M3.1-Flash", "provider": "minimax", "provider_family": "minimax", "read_at": "2026-10-31T19:26:02Z", "independence": "single_reader"}, "evidence_check": {"method": "absent", "availability": "verbatim"}, "calls": 3, "usage": {"prompt_tokens": 32979, "completion_tokens": 1743, "cached_tokens": 793}}, "human_critique": null, "stages": [{"id": "extraction", "state": "complete", "reader": "MiniMax-M3.1-Flash", "provider": "minimax"}], "gaps": ["review.independent_reader", "review.machine_critique", "review.human_critique"]}, "execution": {"state": "absent", "status": "not_run", "mode": null, "runs": [], "gaps": ["execution.not_run"]}, "provenance": {"entities": [{"id": "pmid:33630421", "type": "paper", "label": "pmid:33630421"}, {"id": "source:pmid:33630421", "type": "manuscript", "label": "PMID 33630421 full text"}, {"id": "data:geo:GSE38267", "type": "dataset", "label": "GEO GSE38267"}], "activities": [{"id": "activity-reading-sci-2026-11-01", "type": "classification", "used": [{"id": "pmid:33630421", "type": "paper", "label": "pmid:33630421"}, {"id": "source:pmid:33630421", "type": "manuscript", "label": "PMID 33630421 full text"}, {"id": "data:geo:GSE38267", "type": "dataset", "label": "GEO GSE38267"}], "agent": "agent:corpus-assay-engine"}, {"id": "activity-read-33630421", "type": "extraction", "used": ["source:pmid:33630421"], "agent": "agent:minimax-reader"}, {"id": "activity-resolve-GSE38267", "type": "accession_resolution", "used": ["data:geo:GSE38267"], "agent": "agent:corpus-assay-engine"}], "agents": [{"id": "agent:corpus-assay-engine", "type": "software", "label": "Corpus assay engine"}, {"id": "agent:minimax-reader", "type": "software", "label": "MiniMax literature reader"}], "source_run_id": "reading-sci-2026-11-01", "dsl_catalogue_fingerprint": "343fb30756ba6ec3", "capability_table_fingerprint": "2cb3e42f047d2ecf", "snapshot_id": "ba34b49490d9bfaf"}, "lineage": {"parent_id": "pmid:33630421", "parent_hash": "sha256:8f6396d09c35bec002a9cc2dc205b9db32376f17d7c5bd91e8df99e6ed31976a", "fork_of": null, "generation": 6}, "gaps": ["asset:data:geo:GSE38267 licence not read", "asset:data:geo:GSE38267 not downloaded", "asset:data:geo:GSE44145 licence not read", "asset:data:geo:GSE44145 not downloaded", "asset:data:geo:GSE67597 licence not read", "asset:data:geo:GSE67597 not downloaded", "execution.not_run", "review.human_critique", "review.independent_reader", "review.machine_critique"], "assays": [{"role": "data_generation", "definition_id": "animal_model", "definition_version": "99e1195c7d6f", "definition_digest": null, "required_operations": [], "support_state": "partial", "source_hashes": {"assay_lexicon": "99e1195c7d6f"}, "confidence": 0.99, "evidence": ["12 were then verified by quantitative RT-PCR in vivo and in vitro. Further study showed that sile", "tory Animal Technology (Beijing, China). All mice were housed under standard conditions (temperatur", "nsion models, after adapting for 1 week, all mice were randomly assigned to two groups, with n = 6", "poxia (Su/Hx)‐induced pulmonary hypertension mouse model, after adapting for 1 week, all mice were ra"], "order_basis": "paper_text_order:880", "id": "assay:1"}, {"role": "data_generation", "definition_id": "transfection", "definition_version": "99e1195c7d6f", "definition_digest": null, "required_operations": [], "support_state": "partial", "source_hashes": {"assay_lexicon": "99e1195c7d6f"}, "confidence": 0.99, "evidence": ["ontinued for 3 weeks. Cell culture and siRNA transfection Human pulmonary artery smooth muscle cells (", "% O2, 5% CO2, 90% N2) for 24 h. hPASMCs were transfected with siRNAs, which were purchased from Ribob", "e manufacturer’s protocol. The efficiency of knockdown was assessed by quantitative RT‐PCR (qRT‐PCR", "sure continued for 3 weeks. Cell culture and siRNA transfection Human pulmonary artery smooth m"], "order_basis": "paper_text_order:2693", "id": "assay:2"}, {"role": "data_generation", "definition_id": "cell_culture", "definition_version": "99e1195c7d6f", "definition_digest": null, "required_operations": [], "support_state": "partial", "source_hashes": {"assay_lexicon": "99e1195c7d6f"}, "confidence": 0.99, "evidence": ["co, Grand Island, NY, USA). The Nx group was cultured in a humidified incubator (37°C, 21% O2, 5% CO2", "CO2, 74% N2). The hypoxia‐treated group was cultured in a humidified incubator (37 °C, 5% O2, 5% CO2"], "order_basis": "paper_text_order:3042", "id": "assay:3"}, {"role": "analysis", "definition_id": "group_comparison", "definition_version": "f2132e96ae6c7a4e", "definition_digest": null, "required_operations": ["group_summary", "welch_t", "bootstrap_mean_difference", "group_comparison_anova"], "support_state": "supported", "source_hashes": {"dsl_catalogue": "f2132e96ae6c7a4e"}, "confidence": 0.8, "evidence": ["ANOVA"], "order_basis": "consumes_earlier_output", "id": "assay:4"}]}