Bovine Pre-adipocyte Adipogenesis Is Regulated by bta-miR-150 Through mTOR Signaling.

{"sci_version": "1.2", "schema": "https://corpus.bntrg.co.uk/sci/1.0/sci.schema.json", "id": "pmid:33633792", "kind": "science-record", "revision": 8, "content_hash": "sha256:f85b37293998b583fc23b07f2d6f574f333dac2c83e0f24bf096b76d70d8314a", "created_at": "2026-11-01T15:41:26Z", "updated_at": "2026-11-01T22:46:12Z", "generator": {"name": "corpus-assay-engine", "run_id": "reading-sci-2026-11-01"}, "paper": {"state": "complete", "title": "Bovine Pre-adipocyte Adipogenesis Is Regulated by bta-miR-150 Through mTOR Signaling.", "doi": "10.3389/fgene.2021.636550", "pmid": "33633792", "authors": ["Xingyi Chen", "Sayed Haidar Abbas Raza", "Xinhao Ma", "Jiangfang Wang", "Xiaohui Wang", "Chengcheng Liang", "Xinran Yang", "Chugang Mei", "Syed Muhammad Suhail", "Linsen Zan"], "journal": "Frontiers in genetics", "year": 2021, "abstract": "Micro RNA (miR) are recognized for their important roles in biological processes, particularly in regulatory componentization. Among the miR, miR-150 has been the focus of intense scrutiny, mostly due to its role in malignant tumors. A comparison between steer and bull adipose tissues identified bta-miR-150 as one of the nine downregulated miRNAs, although its function remains unknown (GEO:GSE75063). The present study aimed to further characterize the role of bta-miR-150 in cattle. bta-miR-150 has a negative regulatory effect on the differentiation of bovine adipocytes and promotes proliferation. Overexpression of bta-miR-150 can promote mRNA and protein expression of the marker genes CDK1, CDK2, and PCNA, increase the number of EdU-stained cells, promote adipocyte proliferation, inhibit adipocyte differentiation, and reduce lipid droplet formation. Results of RNA-seq and WGCNA analyses showed that the mammalian target of the rapamycin signaling pathway, which plays a major regulatory role, is dysregulated by the overexpression and inhibition of miR-150. We found that the target gene of bta-miR-150 is AKT1 and that bta-miR-150 affects AKT1 phosphorylation levels. These results showed that bta-miR-150 plays a role in adipogenic differentiation and might therefore have applications in the beef industry.", "claims": [{"id": "claim-method", "statement": "The DESeq2 R software package was used to screen DEGs, with Log2 fold change (log2FC) > 1 and false discovery rate (FDR) < 0.05 as the screening criteria.", "kind": "methodological", "target": null, "evidence": [{"asset": "source:pmid:33633792", "locator": "sections[5] \"Differential Expression and Pathway Enrichment Analyses\" paragraph 2", "quote": "The DESeq2 R software package was used to screen DEGs, with Log2 fold change (log2FC) > 1 and false discovery rate (FDR) < 0.05 as the screening criteria."}], "state": "complete"}, {"id": "claim-data-access", "statement": "The datasets presented in this study can be found in online repositories. The names of the repository/repositories and accession number(s) can be found below: NCBI SRA (accession: PRJNA684031).", "kind": "methodological", "target": null, "evidence": [{"asset": "source:pmid:33633792", "locator": "sections[23] \"Data Availability Statement\" paragraph 2", "quote": "The datasets presented in this study can be found in online repositories. The names of the repository/repositories and accession number(s) can be found below: NCBI SRA (accession: PRJNA684031)."}], "state": "complete"}], "gaps": []}, "experiment": {"state": "partial", "objective": null, "steps": [{"id": "read_published_estimate", "order": 1, "name": "Read the published estimate from the source", "kind": "other", "state": "complete", "blocked_on": null, "description": "The claim, method and evidence span published with the source article.", "duration_hours": null, "parameters": {}, "inputs": ["source:pmid:33633792"], "outputs": ["the published estimate and its evidence"], "instruments": [], "reagents": []}, {"id": "obtain_source_data", "order": 2, "name": "Obtain the source data from the named repository", "kind": "data-preparation", "state": "blocked", "blocked_on": "data:accession_unresolved", "description": "The GEO series accession resolves and its sample accessions are listed. This lane did not download the dataset or read its licence.", "duration_hours": null, "parameters": {}, "inputs": ["data:geo:PRJNA684031"], "outputs": ["the source data with its repository provenance"], "instruments": [], "reagents": []}, {"id": "run_analysis", "order": 3, "name": "Run the published analysis", "kind": "analysis", "state": "complete", "blocked_on": null, "description": "Apply the paper's statistical method to the resolved series and compare the result with the published target.", "duration_hours": null, "parameters": {}, "inputs": ["data:geo:PRJNA684031"], "outputs": ["the replicated result and its comparison"], "instruments": [], "reagents": []}], "materials": [], "instruments": [], "reagents": [], "conditions": {}, "gaps": ["step:obtain_source_data blocked on data:accession_unresolved"]}, "data": {"state": "partial", "assets": [{"id": "source:pmid:33633792", "role": "manuscript", "format": "xml", "media_type": "application/xml", "uri": "https://doi.org/10.3389/fgene.2021.636550", "sha256": "sha256:37408ec698ac3022f55ff05aba43f9aba23199e1c47213c696f350fa2d2317e5", "bytes": 48260, "access": "open", "state": "resolved", "reader": null, "reader_status": "reader_required", "identifier": "10.3389/fgene.2021.636550", "version": null, "note": "Full article fetched from PMC; the checksum covers the rendered section body, not the original XML bytes.", "structure": {"pmcid": "PMC7901978", "source": "europe_pmc_fulltext", "coverage": "whole_body", "text_hash_scope": "rendered_section_body"}}, {"id": "data:geo:PRJNA684031", "role": "raw", "format": "geo-series", "media_type": "application/vnd.ncbi.geo-series+json", "uri": "https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=PRJNA684031", "sha256": null, "bytes": null, "access": "open", "state": "resolved", "reader": null, "reader_status": "reader_required", "identifier": "PRJNA684031", "version": null, "note": "The datasets presented in this study can be found in online repositories. The names of the repository/repositories and accession number(s) can be found below: NCBI SRA (accession: PRJNA684031).", "structure": {"repository": "GEO", "access_route": "GEO accession URL", "access_statement_verbatim": "The datasets presented in this study can be found in online repositories. The names of the repository/repositories and accession number(s) can be found below: NCBI SRA (accession: PRJNA684031).", "access_statement_kind": "data_availability_statement", "sample_accessions": [], "sample_count": null, "group_sizes": null, "group_sizes_basis": null, "platform": null, "taxon": null, "title": null, "resolution_checked_at": "2026-10-31T18:35:43Z", "resolution_check": "identifier_resolution_only_no_download_no_licence_read", "downloaded": false, "licence_read": false}}, {"id": "asset:table:pmid:33633792:1", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:81742cc6c4f328af3f4bc53f0b3a35ff1a5e8cfd2ac0542dd7cfaea170a4186f", "bytes": 700, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[4]/table-wrap[1]#T1", "version": null, "note": "The sequence of RNA oligonucleotides and plasmid.", "structure": {"pmcid": "PMC7901978", "section_index": 4, "section_title": "Construction and Transfection of Plasmid and RNA Oligonucleotides", "row_count": 8, "column_count": 2}, "table": {"label": "Table 1", "caption": "The sequence of RNA oligonucleotides and plasmid.", "rows": [["Name", "Sequence (5′-3′)"], ["miR-150 mimic", "sense: UCUCCCAACCCUUGUACCAGUGU antisense: ACACUGGTACAAGGGUUGGGAGA"], ["mimic NC", "UUGUACUACACAAAAGUACUG"], ["miR-150 inhibitor", "ACACUGGUACAAGGGUUGGGAGA"], ["inhibitor NC", "CAGUACUUUUGUGUAGUACAA"], ["si-AKT1", "sense: GCCAUGAAGAUCCUAAAGATT antisense: UCUUUAGGAUCUUCAUGGCTT"], ["si-NC", "sense: UUCUCCGAACGUGCACGUTT antisense: ACGUGACACGUUCGGAGAATT"], ["psiCHECK-2", "5′… GAGCAGTAATTCTAGGCGATCGCTCGAG CCCGGGAATTCGTTTAAACCTAGAGCGGCCGCTGGCCGC AATAAAATA… 3′"]], "row_count": 8, "column_count": 2, "numeric_cells": 5, "header_rows": 1, "locator": "section[4]/table-wrap[1]#T1"}}, {"id": "asset:table:pmid:33633792:2", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:6bbff137259ecff011326187a92a962a8befbf862c54533d17adbbf11689da5d", "bytes": 1825, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[6]/table-wrap[1]#T2", "version": null, "note": "mRNA and miRNA Real-time quantitative PCR primer sequences.", "structure": {"pmcid": "PMC7901978", "section_index": 6, "section_title": "Extraction of RNA, Quantitative Real-Time PCR (qRT-PCR)", "row_count": 25, "column_count": 3}, "table": {"label": "Table 2", "caption": "mRNA and miRNA Real-time quantitative PCR primer sequences.", "rows": [["Genes", "Primer Sequence (5′-3′)", "Annealing"], ["", "", "temperature"], ["β-actin", "F: CATCGGCAATGAGCGGTTCC R: CCGTGTTGGCGTAGAGGTC", "60°C"], ["PCNA", "F: CCTTGGTGCAGCTAACCCTT R: TTGGACATGCTGGTGAGGTT", "60°C"], ["CDK1", "F:AGTGGAAACCAGGAAGCTTAG R:ATTCGTTTGGCAGGATCATAGA", "60°C"], ["CDK2", "F:GGGTCCCTGTTCGTACTTATAC R:CCACTGCTGTGGAGTAGTATTT", "60°C"], ["AKT-1", "F:AAGGAGATCATGCAGCACCGATTC R: GTCTTGGTCAGGTGGCGTAATGG", "60°C"], ["CEBPα", "F: ATCTGCGAACACGAGACG R: CCAGGAACTCGTCGTTGAA", "60°C"], ["PPARγ", "F: GACGACAGACAAATCACCGT R: CTTCCACGGAGCGAAACTGA", "60°C"], ["FABP4", "F:TGAGATTTCCTTCAAATTGGG R: CTTGTACCAGAGCACCTTCATC", "60°C"], ["RRAGD", "F: TAAGAAGGAGCGGCAAGT R: GGAAGTCCCAAATCTGAAA", "60°C"], ["RPS6KA3", "F:ACCTAGCAACATTCTTTATGTGGAT R: GCATCATAGCCTTGTCGT", "60°C"], ["RPS6KB1", "F: ATCACCAAGGTCACGTCAAAC R: TGCTCCCAAACTCCACCAAT", "60°C"], ["LPIN1", "F: AGTGAATCTTCAGATGCGTTTA R: CAGGTGTCGGCTTCGTTT", "60°C"], ["NFKB1", "F: GAGAACTTCGAGCCTCTGTAC R: CTCATAGGGTTTCCCATTTA", "60°C"], ["EIF4E", "F: TCTAATCAGGAGGTTGCT R: CCCACATAGGCTCAATAC", "60°C"], ["PIK3CA", "F:TGGGTTTCTCGGTCCTAA R:CAGTCCGTCCAGTCATCC", "60°C"], ["TNFRSF1B", "F: CCAGCACAGCTCCAAGCA R:CAACTATCAGAAGCAGACCCAAT", "60°C"], ["INSR", "F: GGAAGGCGAGAAGACCAT R: TGACACCAGGGCATAGGA", "60°C"], ["EIF4EBP2", "F: GTTCCTGATGGAGTGTCGGA R: AACTGTGACTCTTCACCGCCT", "60°C"], ["PIK3R1", "F: GAGCGGGAAGAGGACATTGA R: TCTCCCCTGTCGTCTCGTTA", "60°C"], ["mTOR", "F: TGATGCAGAAGGTCGAGGTG R: GATGGGTGTCTATCGCCCAG", "60°C"], ["PIK3R1", "F: CTATCTCCTGGACTTACCG R: GGCGACCTAATGAGTTTC", "60°C"], ["U6", "F:TAGCCACCCTCAAGTATGTTCG R:CGAGGTAGGAGGACAGGAGT", "60°C"], ["miR-150", "UCUCCCAACCCUUGUACCAGUGU", "60°C"]], "row_count": 25, "column_count": 3, "numeric_cells": 26, "header_rows": 2, "locator": "section[6]/table-wrap[1]#T2"}}, {"id": "asset:table:pmid:33633792:3", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:815317eba71bb804ccbaaeaefd75fd3859fded64266ffb37176994b11121e822", "bytes": 806, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[7]/table-wrap[1]#T3", "version": null, "note": "Antibody information.", "structure": {"pmcid": "PMC7901978", "section_index": 7, "section_title": "Western Blot Analysis", "row_count": 10, "column_count": 4}, "table": {"label": "Table 3", "caption": "Antibody information.", "rows": [["Name of antibody", "Immune features", "The company", "Dilution ratio"], ["Anti-AKT1 antibody", "Rabbit polyclonal", "CST", "1:1,000"], ["Phospho-Akt (Ser473) antibody", "Rabbit polyclonal", "CST", "1:1,000"], ["Anti-CDK1 antibody", "Rabbit monoclonal", "Abcam", "1:1,000"], ["Anti-CDK2 antibody", "Rabbit monoclonal", "Abcam", "1:1,000"], ["Anti-PCNA antibody", "Rabbit monoclonal", "Abcam", "1:5,000"], ["Anti-PPARγ antibody", "Rabbit polyclonal", "Boster", "1:1,000"], ["Anti-FABP4 antibody", "Rabbit monoclonal", "Abcam", "1:1,000"], ["Anti-CEBPα antibody", "Rabbit monoclonal", "Abcam", "1:1,000"], ["Anti-β-actin antibody", "Rabbit polyclonal", "Abcam", "1:10,000"]], "row_count": 10, "column_count": 4, "numeric_cells": 10, "header_rows": 1, "locator": "section[7]/table-wrap[1]#T3"}}], "gaps": ["asset:data:geo:PRJNA684031 not downloaded", "asset:data:geo:PRJNA684031 licence not read"]}, "analysis": {"state": "partial", "methods": [{"id": "method-1", "family": "differential_expression", "specific": "deseq2", "label": "Differential expression analysis", "dsl_operations": ["normalise_counts", "differential_expression_fit", "fdr_bh"], "missing_operations": [], "expressible": true, "parameters": {}, "data_shapes": ["count_matrix_with_condition"], "evidence": {"score": 1.0, "band": "verbatim", "quote": "The DESeq2 R software package was used to screen DEGs, with Log2 fold change (log2FC) > 1 and false discovery rate (FDR) < 0.05 as the screening criteria."}}, {"id": "method-2", "family": "group_comparison", "specific": "student_t_test", "label": "Group comparison", "dsl_operations": [], "missing_operations": ["student_t"], "expressible": false, "parameters": {}, "data_shapes": ["two_or_more_groups_continuous"], "evidence": {"score": 0.8, "band": "high", "quote": "Student's t-test"}}, {"id": "method-3", "family": "group_comparison", "specific": "anova", "label": "Group comparison", "dsl_operations": ["group_summary", "welch_t", "bootstrap_mean_difference", "group_comparison_anova"], "missing_operations": [], "expressible": true, "parameters": {}, "data_shapes": ["two_or_more_groups_continuous"], "evidence": {"score": 0.8, "band": "high", "quote": "ANOVA"}}, {"id": "method-4", "family": "network_analysis", "specific": "pathway_enrichment", "label": "Network / pathway analysis", "dsl_operations": ["pathway_enrich"], "missing_operations": [], "expressible": true, "parameters": {}, "data_shapes": ["edge_list"], "evidence": {"score": 0.8, "band": "high", "quote": "GO enrichment"}}], "targets": [], "gaps": ["method.reader_differs_from_extractor"]}, "capability": {"state": "complete", "requirements": [{"capability_id": "capability:computational_analysis", "label": "Computational analysis platform", "assay_families": ["meta_analysis", "machine_learning", "survival_analysis", "statistical_regression", "pca", "molecular_docking", "network_analysis", "differential_expression", "gwas"], "availability_state": "owned", "tier_unlocked": "R1", "candidate": "Automated Assays Laravel application and simulated adapters"}], "gaps": []}, "readiness": {"state": "blocked", "tier": "R4", "blocking_axis": "data", "blocked_on": "data:accession_absent", "axes": {"method": {"tier": "R1", "expressible": true, "required_operations": ["normalise_counts", "differential_expression_fit", "fdr_bh"], "missing_operations": [], "basis": "The paper names the method it used and the corpus's method extractor maps it onto the DSL catalogue: deseq2."}, "capability": {"tier": "R1", "capability_id": "capability:computational_analysis", "availability_state": "owned", "basis": "The computational analysis is owned. The physical bench the paper used is not, so a physical validation cannot be run here."}, "data": {"tier": "R4", "reachable": false, "accessions": ["PRJNA684031"], "resolved_accessions": [], "statements": ["The datasets presented in this study can be found in online repositories. The names of the repository/repositories and accession number(s) can be found below: NCBI SRA (accession: PRJNA684031)."], "basis": "The paper names PRJNA684031, but the accession does not resolve in the repository (not_in_ncbi_bioproject), so the data cannot be reached from here. No dataset was downloaded and no licence was read."}}, "can_run": {"dsl_operations": ["normalise_counts", "differential_expression_fit", "fdr_bh"], "assets": ["source:pmid:33633792", "data:geo:PRJNA684031", "asset:table:pmid:33633792:1", "asset:table:pmid:33633792:2", "asset:table:pmid:33633792:3"], "steps": ["run_analysis"]}, "must_build": {"dsl_operations": [], "converters": [], "readers": [], "capabilities": [], "data_gaps": ["data:geo:PRJNA684031"]}, "gaps": ["data:accession_absent"]}, "review": {"state": "partial", "machine_critique": {"kind": "extraction_review", "reader": {"model": "MiniMax-M3.1-Flash", "provider": "minimax", "provider_family": "minimax", "read_at": "2026-10-31T18:27:21Z", "independence": "single_reader"}, "evidence_check": {"method": "verbatim", "availability": "verbatim"}, "calls": 3, "usage": {"prompt_tokens": 40541, "completion_tokens": 1415, "cached_tokens": 793}}, "human_critique": null, "stages": [{"id": "extraction", "state": "complete", "reader": "MiniMax-M3.1-Flash", "provider": "minimax"}], "gaps": ["review.independent_reader", "review.machine_critique", "review.human_critique"]}, "execution": {"state": "absent", "status": "not_run", "mode": null, "runs": [], "gaps": ["execution.not_run"]}, "provenance": {"entities": [{"id": "pmid:33633792", "type": "paper", "label": "pmid:33633792"}, {"id": "source:pmid:33633792", "type": "manuscript", "label": "PMID 33633792 full text"}, {"id": "data:geo:PRJNA684031", "type": "dataset", "label": "GEO PRJNA684031"}], "activities": [{"id": "activity-reading-sci-2026-11-01", "type": "classification", "used": [{"id": "pmid:33633792", "type": "paper", "label": "pmid:33633792"}, {"id": "source:pmid:33633792", "type": "manuscript", "label": "PMID 33633792 full text"}, {"id": "data:geo:PRJNA684031", "type": "dataset", "label": "GEO PRJNA684031"}], "agent": "agent:corpus-assay-engine"}, {"id": "activity-read-33633792", "type": "extraction", "used": ["source:pmid:33633792"], "agent": "agent:minimax-reader"}, {"id": "activity-resolve-PRJNA684031", "type": "accession_resolution", "used": ["data:geo:PRJNA684031"], "agent": "agent:corpus-assay-engine"}], "agents": [{"id": "agent:corpus-assay-engine", "type": "software", "label": "Corpus assay engine"}, {"id": "agent:minimax-reader", "type": "software", "label": "MiniMax literature reader"}], "source_run_id": "reading-sci-2026-11-01", "dsl_catalogue_fingerprint": "343fb30756ba6ec3", "capability_table_fingerprint": "2cb3e42f047d2ecf", "snapshot_id": "ba34b49490d9bfaf"}, "lineage": {"parent_id": "pmid:33633792", "parent_hash": "sha256:1891f67de0265ca99dae8e208f6d71a5ee67fa71b9a1fbc30abcf634af7a0129", "fork_of": null, "generation": 7}, "gaps": ["asset:data:geo:PRJNA684031 licence not read", "asset:data:geo:PRJNA684031 not downloaded", "execution.not_run", "method.reader_differs_from_extractor", "review.human_critique", "review.independent_reader", "review.machine_critique", "step:obtain_source_data blocked on data:accession_unresolved"], "assays": [{"role": "data_generation", "definition_id": "rna_seq", "definition_version": "99e1195c7d6f", "definition_digest": null, "required_operations": [], "support_state": "partial", "source_hashes": {"assay_lexicon": "99e1195c7d6f"}, "confidence": 0.99, "evidence": ["d reduce lipid droplet formation. Results of RNA-seq and WGCNA analyses showed that the mammalian", "fferentiation of bovine pre-adipocytes using RNA-seq. The miR-150 mimic, mimic NC, inhibitor, and", "Novo Gene, Beijing, China) (Figure 4A). The RNA-seq results of cells transfected with miR-150 mi", "cal process of adipogenesis. We combined the RNA-seq data with the WGCNA analysis of KEGG finding"], "order_basis": "paper_text_order:914", "id": "assay:1"}, {"role": "data_generation", "definition_id": "transfection", "definition_version": "99e1195c7d6f", "definition_digest": null, "required_operations": [], "support_state": "partial", "source_hashes": {"assay_lexicon": "99e1195c7d6f"}, "confidence": 0.99, "evidence": [", mimic NC, inhibitor, and inhibitor NC were transfected into bovine pre-adipocytes as described abov", "a) (Figure 4A). The RNA-seq results of cells transfected with miR-150 mimic, mimic NC, inhibitor, and"], "order_basis": "paper_text_order:3412", "id": "assay:2"}, {"role": "analysis", "definition_id": "differential_expression", "definition_version": "f2132e96ae6c7a4e", "definition_digest": null, "required_operations": ["normalise_counts", "differential_expression_fit", "fdr_bh"], "support_state": "supported", "source_hashes": {"dsl_catalogue": "f2132e96ae6c7a4e"}, "confidence": 1.0, "evidence": ["The DESeq2 R software package was used to screen DEGs, with Log2 fold change (log2FC) > 1 and false discovery rate (FDR) < 0.05 as the screening criteria."], "order_basis": "consumes_earlier_output", "id": "assay:3"}]}