Identification and validation of three core genes in p53 signaling pathway in hepatitis B virus-related hepatocellular carcinoma.

{"sci_version": "1.2", "schema": "https://corpus.bntrg.co.uk/sci/1.0/sci.schema.json", "id": "pmid:33685467", "kind": "science-record", "revision": 7, "content_hash": "sha256:9ae4448deac6a87cbf7f71d94e735d7317c6c1d216c9c5bb3d6bd08979772bf7", "created_at": "2026-11-01T15:41:27Z", "updated_at": "2026-11-01T22:03:16Z", "generator": {"name": "corpus-assay-engine", "run_id": "reading-sci-2026-11-01"}, "paper": {"state": "complete", "title": "Identification and validation of three core genes in p53 signaling pathway in hepatitis B virus-related hepatocellular carcinoma.", "doi": "10.1186/s12957-021-02174-w", "pmid": "33685467", "authors": ["Mingxue Yu", "Wenli Xu", "Yusheng Jie", "Jiahui Pang", "Siqi Huang", "Jing Cao", "Jiao Gong", "Xinhua Li", "Yutian Chong"], "journal": "World journal of surgical oncology", "year": 2021, "abstract": "BACKGROUND: Hepatocellular carcinoma (HCC) is a common cancer and the leading cause is persistent hepatitis B virus (HBV) infection. We aimed to identify some core genes and pathways for HBV-related HCC.\nMETHODS: Gene expression profiles of GSE62232, GSE121248, and GSE94660 were available from Gene Expression Omnibus (GEO). The GSE62232 and GSE121248 profiles were the analysis datasets and GSE94660 was the validation dataset. The GEO2R online tool and Venn diagram software were applied to analyze commonly differentially expressed genes between HBV-related HCC tissues and normal tissues. Then, functional enrichment analysis using Gene Ontology (GO) and the Kyoto Encyclopedia of Gene and Genome (KEGG) as well as the protein-protein interaction (PPI) network was conducted. The overall survival rates and the expression levels were detected by Kaplan-Meier plotter and Gene Expression Profiling Interactive Analysis (GEPIA). Next, gene set enrichment analysis (GSEA) was performed to verify the KEGG pathway analysis. Furthermore, quantitative reverse transcriptase polymerase chain reaction (qRT-PCR) was performed to validate the levels of these three core genes in tumor tissues and adjacent non-tumor liver tissues from 12 HBV related HCC patients, HBV-associated liver cancer cell lines and normal liver cell lines, and HepG2 with p53 knockdown or deletion, respectively.\nRESULTS: Fifteen highly expressed genes associated with significantly worse prognoses were selected and CCNB1, CDK1, and RRM2 in the p53 signaling pathway were identified as core genes. GSEA results showed that samples highly expressing three core genes were all enriched in the p53 signaling pathway in a validation dataset (P < 0.0001). The expression of these three core genes in tumor tissue samples was higher than that in relevant adjacent non-tumor liver tissues (P < 0.0001). Furthermore, we also found that the above genes were highly expressed in liver cancer cell lines compared with normal liver cells. In addition, we found that the expression of these three core genes in p53 knockdown or knockout HCC cell lines was lower than that in negative control HCC cell lines (P < 0.05).\nCONCLUSIONS: CCNB1, CDK1, and RRM2 were enriched in the p53 signaling pathway and could be potential biomarkers and therapeutic targets for HBV-related HCC.", "claims": [{"id": "claim-data-access", "statement": "All data generated or analyzed during this study are included in this published article.", "kind": "methodological", "target": null, "evidence": [{"asset": "source:pmid:33685467", "locator": "sections[27] \"Availability of data and materials\" paragraph 2", "quote": "All data generated or analyzed during this study are included in this published article."}], "state": "complete"}], "gaps": []}, "experiment": {"state": "complete", "objective": null, "steps": [{"id": "read_published_estimate", "order": 1, "name": "Read the published estimate from the source", "kind": "other", "state": "complete", "blocked_on": null, "description": "The claim, method and evidence span published with the source article.", "duration_hours": null, "parameters": {}, "inputs": ["source:pmid:33685467"], "outputs": ["the published estimate and its evidence"], "instruments": [], "reagents": []}, {"id": "obtain_source_data", "order": 2, "name": "Obtain the source data from the named repository", "kind": "data-preparation", "state": "complete", "blocked_on": null, "description": "The GEO series accession resolves and its sample accessions are listed. This lane did not download the dataset or read its licence.", "duration_hours": null, "parameters": {}, "inputs": ["data:geo:GSE121248"], "outputs": ["the source data with its repository provenance"], "instruments": [], "reagents": []}, {"id": "run_analysis", "order": 3, "name": "Run the published analysis", "kind": "analysis", "state": "complete", "blocked_on": null, "description": "Apply the paper's statistical method to the resolved series and compare the result with the published target.", "duration_hours": null, "parameters": {}, "inputs": ["data:geo:GSE121248"], "outputs": ["the replicated result and its comparison"], "instruments": [], "reagents": []}], "materials": [], "instruments": [], "reagents": [], "conditions": {}, "gaps": []}, "data": {"state": "partial", "assets": [{"id": "source:pmid:33685467", "role": "manuscript", "format": "xml", "media_type": "application/xml", "uri": "https://doi.org/10.1186/s12957-021-02174-w", "sha256": "sha256:122fcc32b347c06e1ac4f3396ba030b34d0bae81b1b9a6c2b14f79e89959b9b8", "bytes": 39406, "access": "open", "state": "resolved", "reader": null, "reader_status": "reader_required", "identifier": "10.1186/s12957-021-02174-w", "version": null, "note": "Full article fetched from PMC; the checksum covers the rendered section body, not the original XML bytes.", "structure": {"pmcid": "PMC7938465", "source": "europe_pmc_fulltext", "coverage": "whole_body", "text_hash_scope": "rendered_section_body"}}, {"id": "data:geo:GSE121248", "role": "raw", "format": "geo-series", "media_type": "application/vnd.ncbi.geo-series+json", "uri": "https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE121248", "sha256": null, "bytes": null, "access": "open", "state": "resolved", "reader": null, "reader_status": "reader_required", "identifier": "GSE121248", "version": null, "note": "All data generated or analyzed during this study are included in this published article.", "structure": {"repository": "GEO", "access_route": "GEO accession URL", "access_statement_verbatim": "All data generated or analyzed during this study are included in this published article.", "access_statement_kind": "data_availability_statement", "sample_accessions": ["GSM3428716", "GSM3428717", "GSM3428718", "GSM3428719", "GSM3428720", "GSM3428721", "GSM3428722", "GSM3428723", "GSM3428724", "GSM3428725", "GSM3428726", "GSM3428727", "GSM3428728", "GSM3428729", "GSM3428730", "GSM3428731", "GSM3428732", "GSM3428733", "GSM3428734", "GSM3428735", "GSM3428736", "GSM3428737", "GSM3428738", "GSM3428739", "GSM3428740", "GSM3428741", "GSM3428742", "GSM3428743", "GSM3428744", "GSM3428745", "GSM3428746", "GSM3428747", "GSM3428748", "GSM3428749", "GSM3428750", "GSM3428751", "GSM3428752", "GSM3428753", "GSM3428754", "GSM3428755", "GSM3428756", "GSM3428757", "GSM3428758", "GSM3428759", "GSM3428760", "GSM3428761", "GSM3428762", "GSM3428763", "GSM3428764", "GSM3428765", "GSM3428766", "GSM3428767", "GSM3428768", "GSM3428769", "GSM3428770", "GSM3428771", "GSM3428772", "GSM3428773", "GSM3428774", "GSM3428775", "GSM3428776", "GSM3428777", "GSM3428778", "GSM3428779", "GSM3428780", "GSM3428781", "GSM3428782", "GSM3428783", "GSM3428784", "GSM3428785", "GSM3428786", "GSM3428787", "GSM3428788", "GSM3428789", "GSM3428790", "GSM3428791", "GSM3428792", "GSM3428793", "GSM3428794", "GSM3428795", "GSM3428796", "GSM3428797", "GSM3428798", "GSM3428799", "GSM3428800", "GSM3428801", "GSM3428802", "GSM3428803", "GSM3428804", "GSM3428805", "GSM3428806", "GSM3428807", "GSM3428808", "GSM3428809", "GSM3428810", "GSM3428811", "GSM3428812", "GSM3428813", "GSM3428814", "GSM3428815", "GSM3428816", "GSM3428817", "GSM3428818", "GSM3428819", "GSM3428820", "GSM3428821", "GSM3428822"], "sample_count": 107, "group_sizes": null, "group_sizes_basis": null, "platform": "570", "taxon": "Homo sapiens", "title": "Gene expression profiling of chronic hepatitis B induced HCC and adjacent-normal tissues", "resolution_checked_at": "2026-11-01T15:39:54Z", "resolution_check": "identifier_resolution_only_no_download_no_licence_read", "downloaded": false, "licence_read": false}}, {"id": "data:geo:GSE62232", "role": "raw", "format": "geo-series", "media_type": "application/vnd.ncbi.geo-series+json", "uri": "https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE62232", "sha256": null, "bytes": null, "access": "open", "state": "resolved", "reader": null, "reader_status": "reader_required", "identifier": "GSE62232", "version": null, "note": "All data generated or analyzed during this study are included in this published article.", "structure": {"repository": "GEO", "access_route": "GEO accession URL", "access_statement_verbatim": "All data generated or analyzed during this study are included in this published article.", "access_statement_kind": "data_availability_statement", "sample_accessions": ["GSM1523329", "GSM1523330", "GSM1523331", "GSM1523332", "GSM1523333", "GSM1523334", "GSM1523335", "GSM1523336", "GSM1523337", "GSM1523338", "GSM1523339", "GSM1523340", "GSM1523341", "GSM1523342", "GSM1523343", "GSM1523344", "GSM1523345", "GSM1523346", "GSM1523347", "GSM1523348", "GSM1523349", "GSM1523350", "GSM1523351", "GSM1523352", "GSM1523353", "GSM1523354", "GSM1523355", "GSM1523356", "GSM1523357", "GSM1523358", "GSM1523359", "GSM1523360", "GSM1523361", "GSM1523362", "GSM1523363", "GSM1523364", "GSM1523365", "GSM1523366", "GSM1523367", "GSM1523368", "GSM1523369", "GSM1523370", "GSM1523371", "GSM1523372", "GSM1523373", "GSM1523374", "GSM1523375", "GSM1523376", "GSM1523377", "GSM1523378", "GSM1523379", "GSM1523380", "GSM1523381", "GSM1523382", "GSM1523383", "GSM1523384", "GSM1523385", "GSM1523386", "GSM1523387", "GSM1523388", "GSM1523389", "GSM1523390", "GSM1523391", "GSM1523392", "GSM1523393", "GSM1523394", "GSM1523395", "GSM1523396", "GSM1523397", "GSM1523398", "GSM1523399", "GSM1523400", "GSM1523401", "GSM1523402", "GSM1523403", "GSM1523404", "GSM1523405", "GSM1523406", "GSM1523407", "GSM1523408", "GSM1523409", "GSM1523410", "GSM1523411", "GSM1523412", "GSM1523413", "GSM1523414", "GSM1523415", "GSM1523416", "GSM1523417", "GSM1523418", "GSM1523419"], "sample_count": 91, "group_sizes": null, "group_sizes_basis": null, "platform": "570", "taxon": "Homo sapiens", "title": "Large-scale gene expression profiling  of 81 hepatocellular carcinomas", "resolution_checked_at": "2026-11-01T15:39:55Z", "resolution_check": "identifier_resolution_only_no_download_no_licence_read", "downloaded": false, "licence_read": false}}, {"id": "data:geo:GSE94660", "role": "raw", "format": "geo-series", "media_type": "application/vnd.ncbi.geo-series+json", "uri": "https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE94660", "sha256": null, "bytes": null, "access": "open", "state": "resolved", "reader": null, "reader_status": "reader_required", "identifier": "GSE94660", "version": null, "note": "All data generated or analyzed during this study are included in this published article.", "structure": {"repository": "GEO", "access_route": "GEO accession URL", "access_statement_verbatim": "All data generated or analyzed during this study are included in this published article.", "access_statement_kind": "data_availability_statement", "sample_accessions": ["GSM2480436", "GSM2480437", "GSM2480438", "GSM2480439", "GSM2480440", "GSM2480441", "GSM2480442", "GSM2480443", "GSM2480444", "GSM2480445", "GSM2480446", "GSM2480447", "GSM2480448", "GSM2480449", "GSM2480450", "GSM2480451", "GSM2480452", "GSM2480453", "GSM2480454", "GSM2480455", "GSM2480456", "GSM2480457", "GSM2480458", "GSM2480459", "GSM2480460", "GSM2480461", "GSM2480462", "GSM2480463", "GSM2480464", "GSM2480465", "GSM2480466", "GSM2480467", "GSM2480468", "GSM2480469", "GSM2480470", "GSM2480471", "GSM2480472", "GSM2480473", "GSM2480474", "GSM2480475", "GSM2480476", "GSM2480477"], "sample_count": 42, "group_sizes": null, "group_sizes_basis": null, "platform": "16791", "taxon": "Homo sapiens", "title": "RNA sequencing (RNA-SEQ) of 21 HBV-HCC patients with non-neoplastic liver and tumor tissues", "resolution_checked_at": "2026-11-01T15:39:55Z", "resolution_check": "identifier_resolution_only_no_download_no_licence_read", "downloaded": false, "licence_read": false}}, {"id": "asset:table:pmid:33685467:1", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:b8da2095f62eb4dfcb146b75b52fa07ba4944c00efefca744d2c991a10095053", "bytes": 1591, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[10]/table-wrap[1]#Tab1", "version": null, "note": "Clinical characteristic of the hepatocellular carcinoma patients", "structure": {"pmcid": "PMC7938465", "section_index": 10, "section_title": "The collection of human liver tissue samples", "row_count": 13, "column_count": 11}, "table": {"label": "Table 1", "caption": "Clinical characteristic of the hepatocellular carcinoma patients", "rows": [["Patient ID", "Age", "Sex", "Pathological type", "Size of tumor", "BCLC stage", "HBsAg (IU/mL)", "HBV-DNA (IU/mL)", "AFP (ng/mL)", "ALT(U/L)", "AST(U/L)"], ["1", "58", "M", "Moderately differentiated", "32 × 22 mm", "A", "> 180", "8.69E+3", "1073", "40.7", "33.3"], ["2", "47", "M", "Poorly differentiated", "28 × 25 mm", "A", "29.86", "1.06E+2", "1.43", "248.2", "183.2"], ["3", "64", "M", "Moderately differentiated", "77 × 71 mm", "B", "> 180", "1.08E+5", "110", "25.8", "55.1"], ["4", "60", "M", "Moderately to poorly differentiated", "106 × 73 mm", "C", "159.58", "3.24E+2", "16.09", "33.6", "46"], ["5", "61", "M", "Moderately differentiated", "16 × 17 mm", "O", "> 250", "5.89E+2", "766.5", "16", "12.9"], ["6", "46", "M", "Moderately to poorly differentiated", "27 × 28 mm", "A", "> 180", "2.60E+5", "4371", "37.2", "25.7"], ["7", "38", "M", "Moderately differentiated", "25 × 24 mm", "A", "251.9", "< 100", "0.746", "35", "43"], ["8", "76", "M", "S8:Well-differentiatedS7:Moderately to poorly differentiated", "15 × 13 mm", "O", "1.17", "< 100", "unknown", "28", "28"], ["9", "57", "M", "Moderately differentiated", "27 × 19 mm", "A", "> 250", "5.05E+03", "3.129", "20", "16"], ["10", "64", "M", "Well-differentiated", "24 × 20 mm", "A", "2165", "< 100", "5.06", "24", "22"], ["11", "53", "M", "Moderately differentiated", "62 × 63 mm", "B", "1070", "4.21E+05", "3.516", "32", "53"], ["12", "45", "M", "Moderately differentiated", "81 × 51 mm", "B", "> 180", "1.21E+2", "855.5", "23.5", "19.2"]], "row_count": 13, "column_count": 11, "numeric_cells": 95, "header_rows": 1, "locator": "section[10]/table-wrap[1]#Tab1"}}, {"id": "asset:table:pmid:33685467:2", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:edb2c68ee08a684ed5598d75c5535664e639f25d1e3c5cbd8e7897e8f6e031b5", "bytes": 552, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[11]/table-wrap[1]#Tab2", "version": null, "note": "Sequences of primers and oligos", "structure": {"pmcid": "PMC7938465", "section_index": 11, "section_title": "RNA extraction and quantitative reverse transcriptase polymerase chain reaction (qRT-PCR)", "row_count": 7, "column_count": 3}, "table": {"label": "Table 2", "caption": "Sequences of primers and oligos", "rows": [["Gene name", "Forward", "Reverse"], ["GAPDH", "CCATGGGGAAGGTGAAGGTC", "GAAGGGGTCATTGATGGCAAC"], ["CCNB1", "GTGGATGCAGAAGATGGAGC", "CCGACCCAGTAGGTATTTTGG"], ["CDK1", "AGGAAGGGGTTCCTAGTACTGC", "TGGAATCCTGCATAAGCACA"], ["RRM2", "TCTATGGCTTCCAAATTGCC", "GACACAAGGCATCGTTTCAA"], ["p53", "TAACAGTTCCTGCATGGGCGGC", "AGGACAGGCACAAACACGCACC"], ["p21", "TGGAGACTCTCAGGGTCGAA", "GGATTAGGGCTTCCTCTTGG"]], "row_count": 7, "column_count": 3, "numeric_cells": 2, "header_rows": 1, "locator": "section[11]/table-wrap[1]#Tab2"}}, {"id": "asset:table:pmid:33685467:3", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:ee76e12e652011522b9633ed1de935897f962bf6e5a88d8fd9a2fcc9ea6f8873", "bytes": 1000, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[14]/table-wrap[1]#Tab3", "version": null, "note": "Commonly DEGs in GSE62232 and GSE121248", "structure": {"pmcid": "PMC7938465", "section_index": 14, "section_title": "Identification of DEGs in hepatitis B virus-related hepatocellular carcinoma", "row_count": 3, "column_count": 2}, "table": {"label": "Table 3", "caption": "Commonly DEGs in GSE62232 and GSE121248", "rows": [["DEGs", "Gene name"], ["Upregulated", "CDK1 SPINK1 CAP2 DTL RACGAP1 CTHRC1 RRM2 IGF2BP3 CCNB TOP2A ASPM HMMR CDKN3 AKR1B10 PBK GPC3 ROBO1 SPP1 ZIC2 NEK2 ANLN ACSL4 CRNDE BUB1B COL15A1 ECT2 PRC1"], ["Downregulated", "CYP4A22///CYP4A11 CYP26A1 BBOX1 CYP2A6 CNTN3 TENM1 LINC01093 CXCL14 SLC22A1 IGF1 SULT1E1 CYP39A1 HAO2 FAM134B MT1F SLC25A47 MFSD2A ZG16 FLJ22763 HHIP KCNN2 ZGPAT///LIME1 SLCO1B3 CYP1A2 CNDP1 BCO2 ACSM3 FCN3 GBA3 TTC36 CLEC4G C3P1 CDH19 CYP2B6 GYS2 FOLH1B KMO LPA CD5L GHR CLEC1B MIR675///H19 CXCL2 LIFR FAM65C CLRN3 CYP2C9 CYP2A7 LCAT CLEC4M VNN1 ESR1 LOC101928916///NNMT PLAC8 ALDOB HAMP DNASE1L3 DCN NAT2 BCHE IL1RAP AKR1D1 CXCL12 TMEM27 CRHBP TACSTD2 WDR72 THRSP IDO2 HGFAC IGFALS ADGRG7 ZGPAT FREM2 ADH4 GPM6A OIT3 HGF MT1M GLYAT CYP2B7P///CYP2B6 GLS2 SRD5A2 ADRA1A APOF C9 SRPX FCN2 LINC00844"]], "row_count": 3, "column_count": 2, "numeric_cells": 2, "header_rows": 1, "locator": "section[14]/table-wrap[1]#Tab3"}}], "gaps": ["asset:data:geo:GSE121248 not downloaded", "asset:data:geo:GSE121248 licence not read", "asset:data:geo:GSE62232 not downloaded", "asset:data:geo:GSE62232 licence not read", "asset:data:geo:GSE94660 not downloaded", "asset:data:geo:GSE94660 licence not read"]}, "analysis": {"state": "complete", "methods": [{"id": "method-1", "family": "survival_analysis", "specific": "kaplan_meier", "label": "Survival analysis", "dsl_operations": ["survival_km"], "missing_operations": [], "expressible": true, "parameters": {}, "data_shapes": ["time_to_event_with_censoring"], "evidence": {"score": 0.7, "band": "medium", "quote": "Kaplan-Meier"}}, {"id": "method-2", "family": "network_analysis", "specific": "ppi_network", "label": "Network / pathway analysis", "dsl_operations": ["build_graph", "centrality_scores", "pathway_enrich"], "missing_operations": [], "expressible": true, "parameters": {}, "data_shapes": ["edge_list"], "evidence": {"score": 0.7, "band": "medium", "quote": "protein-protein interaction"}}, {"id": "method-3", "family": "network_analysis", "specific": "pathway_enrichment", "label": "Network / pathway analysis", "dsl_operations": ["pathway_enrich"], "missing_operations": [], "expressible": true, "parameters": {}, "data_shapes": ["edge_list"], "evidence": {"score": 0.8, "band": "high", "quote": "pathway enrichment"}}], "targets": [], "gaps": []}, "capability": {"state": "complete", "requirements": [{"capability_id": "capability:computational_analysis", "label": "Computational analysis platform", "assay_families": ["meta_analysis", "machine_learning", "survival_analysis", "statistical_regression", "pca", "molecular_docking", "network_analysis", "differential_expression", "gwas"], "availability_state": "owned", "tier_unlocked": "R1", "candidate": "Automated Assays Laravel application and simulated adapters"}], "gaps": []}, "readiness": {"state": "complete", "tier": "R1", "blocking_axis": "none", "blocked_on": "nothing:replicable_now", "axes": {"method": {"tier": "R1", "expressible": true, "required_operations": ["survival_km"], "missing_operations": [], "basis": "The paper names the method it used and the corpus's method extractor maps it onto the DSL catalogue: kaplan_meier."}, "capability": {"tier": "R1", "capability_id": "capability:computational_analysis", "availability_state": "owned", "basis": "The computational analysis is owned. The physical bench the paper used is not, so a physical validation cannot be run here."}, "data": {"tier": "R1", "reachable": true, "accessions": ["GSE62232", "GSE121248", "GSE94660"], "resolved_accessions": ["GSE62232", "GSE121248", "GSE94660"], "statements": ["All data generated or analyzed during this study are included in this published article."], "basis": "The paper names GSE62232, GSE121248, GSE94660 in Gene Expression Omnibus (GEO) and the accession resolves in the repository. No dataset was downloaded and no licence was read."}}, "can_run": {"dsl_operations": ["survival_km"], "assets": ["source:pmid:33685467", "data:geo:GSE121248", "asset:table:pmid:33685467:1", "asset:table:pmid:33685467:2", "asset:table:pmid:33685467:3"], "steps": ["run_analysis"]}, "must_build": {"dsl_operations": [], "converters": [], "readers": [], "capabilities": [], "data_gaps": ["data:geo:GSE121248"]}, "gaps": []}, "review": {"state": "partial", "machine_critique": {"kind": "extraction_review", "reader": {"model": "MiniMax-M3.1-Flash", "provider": "minimax", "provider_family": "minimax", "read_at": "2026-10-31T19:27:10Z", "independence": "single_reader"}, "evidence_check": {"method": null, "availability": "verbatim"}, "calls": 3, "usage": {"prompt_tokens": 33758, "completion_tokens": 1792, "cached_tokens": 784}}, "human_critique": null, "stages": [{"id": "extraction", "state": "complete", "reader": "MiniMax-M3.1-Flash", "provider": "minimax"}], "gaps": ["review.independent_reader", "review.machine_critique", "review.human_critique"]}, "execution": {"state": "absent", "status": "not_run", "mode": null, "runs": [], "gaps": ["execution.not_run"]}, "provenance": {"entities": [{"id": "pmid:33685467", "type": "paper", "label": "pmid:33685467"}, {"id": "source:pmid:33685467", "type": "manuscript", "label": "PMID 33685467 full text"}, {"id": "data:geo:GSE121248", "type": "dataset", "label": "GEO GSE121248"}], "activities": [{"id": "activity-reading-sci-2026-11-01", "type": "classification", "used": [{"id": "pmid:33685467", "type": "paper", "label": "pmid:33685467"}, {"id": "source:pmid:33685467", "type": "manuscript", "label": "PMID 33685467 full text"}, {"id": "data:geo:GSE121248", "type": "dataset", "label": "GEO GSE121248"}], "agent": "agent:corpus-assay-engine"}, {"id": "activity-read-33685467", "type": "extraction", "used": ["source:pmid:33685467"], "agent": "agent:minimax-reader"}, {"id": "activity-resolve-GSE121248", "type": "accession_resolution", "used": ["data:geo:GSE121248"], "agent": "agent:corpus-assay-engine"}], "agents": [{"id": "agent:corpus-assay-engine", "type": "software", "label": "Corpus assay engine"}, {"id": "agent:minimax-reader", "type": "software", "label": "MiniMax literature reader"}], "source_run_id": "reading-sci-2026-11-01", "dsl_catalogue_fingerprint": "343fb30756ba6ec3", "capability_table_fingerprint": "2cb3e42f047d2ecf", "snapshot_id": "ba34b49490d9bfaf"}, "lineage": {"parent_id": "pmid:33685467", "parent_hash": "sha256:94af40d8997decce0d6b1a6abbf7798fb7ef92bea00968586c1dd1733042b920", "fork_of": null, "generation": 6}, "gaps": ["asset:data:geo:GSE121248 licence not read", "asset:data:geo:GSE121248 not downloaded", "asset:data:geo:GSE62232 licence not read", "asset:data:geo:GSE62232 not downloaded", "asset:data:geo:GSE94660 licence not read", "asset:data:geo:GSE94660 not downloaded", "execution.not_run", "review.human_critique", "review.independent_reader", "review.machine_critique"], "assays": [{"role": "data_generation", "definition_id": "cell_culture", "definition_version": "99e1195c7d6f", "definition_digest": null, "required_operations": [], "support_state": "partial", "source_hashes": {"assay_lexicon": "99e1195c7d6f"}, "confidence": 0.99, "evidence": ["cell lines and normal liver cell lines, and HepG2 with p53 knockdown or deletion, respectively", "en University, Guangzhou, China). Cells were cultured in MEM medium containing 10% fetal bovine serum", "RNA All three HBV-related liver cell lines (HepG2.215, HepG-AD-38, and HepG-DE-19) were obtain", "inese Academy of Sciences (Shanghai, China). HepG2 and HepG2-KO-p53 cell lines were gifts from"], "order_basis": "paper_text_order:1418", "id": "assay:1"}, {"role": "data_generation", "definition_id": "transfection", "definition_version": "99e1195c7d6f", "definition_digest": null, "required_operations": [], "support_state": "partial", "source_hashes": {"assay_lexicon": "99e1195c7d6f"}, "confidence": 0.99, "evidence": ["normal liver cell lines, and HepG2 with p53 knockdown or deletion, respectively. RESULTS: Fifteen", "expression of these three core genes in p53 knockdown or knockout HCC cell lines was lower than th", "nsidered upregulated genes. Cell culture and transfection of RNA All three HBV-related liver cell line", "5% CO2 atmosphere at 37 °C. HepG2 cells were transfected with p53 siRNAs at a final concentration of"], "order_basis": "paper_text_order:1433", "id": "assay:2"}, {"role": "analysis", "definition_id": "survival_analysis", "definition_version": "f2132e96ae6c7a4e", "definition_digest": null, "required_operations": ["survival_km"], "support_state": "supported", "source_hashes": {"dsl_catalogue": "f2132e96ae6c7a4e"}, "confidence": 0.7, "evidence": ["Kaplan-Meier"], "order_basis": "consumes_earlier_output", "id": "assay:3"}]}