Identification and Validation of Key Genes in Hepatocellular Carcinoma by Bioinformatics Analysis.

{"sci_version": "1.2", "schema": "https://corpus.bntrg.co.uk/sci/1.0/sci.schema.json", "id": "pmid:33688500", "kind": "science-record", "revision": 7, "content_hash": "sha256:528541d0cc2ea7d0a7abece514650dac95f7be27640e82b69bc6bbbc42ad749c", "created_at": "2026-11-01T15:41:27Z", "updated_at": "2026-11-01T22:03:17Z", "generator": {"name": "corpus-assay-engine", "run_id": "reading-sci-2026-11-01"}, "paper": {"state": "complete", "title": "Identification and Validation of Key Genes in Hepatocellular Carcinoma by Bioinformatics Analysis.", "doi": "10.1155/2021/6662114", "pmid": "33688500", "authors": ["Jia Wang", "Rui Peng", "Zheng Zhang", "Yixi Zhang", "Yuke Dai", "Yan Sun"], "journal": "BioMed research international", "year": 2021, "abstract": "Hepatocellular carcinoma (HCC) is the most frequent primary liver cancer and has poor outcomes. However, the potential molecular biological process underpinning the occurrence and development of HCC is still largely unknown. The purpose of this study was to identify the core genes related to HCC and explore their potential molecular events using bioinformatics methods. HCC-related expression profiles GSE25097 and GSE84005 were selected from the Gene Expression Omnibus (GEO) database, and the differentially expressed genes (DEGs) between 306 HCC tissues and 281 corresponding noncancerous tissues were identified using GEO2R online tools. The protein-protein interaction network (PPIN) was constructed and visualized using the STRING database. Gene Ontology (GO) and KEGG pathway enrichment analyses of the DEGs were carried out using DAVID 6.8 and KOBAS 3.0. Additionally, module analysis and centrality parameter analysis were performed by Cytoscape. The expression differences of key genes in normal hepatocyte cells and HCC cells were verified by quantitative real-time fluorescence polymerase chain reaction (qRT-PCR). Additionally, survival analysis of key genes was performed by GEPIA. Our results showed that a total of 291 DEGs were identified including 99 upregulated genes and 192 downregulated genes. Our results showed that the PPIN of HCC was made up of 287 nodes and 2527 edges. GO analysis showed that these genes were mainly enriched in the molecular function of protein binding. Additionally, KEGG pathway analysis also revealed that DEGs were mainly involved in the metabolic, cell cycle, and chemical carcinogenesis pathways. Interestingly, a significant module with high centrality features including 10 key genes was found. Among these, CDK1, NDC80, HMMR, CDKN3, and PTTG1, which were only upregulated in HCC patients, have attracted much attention. Furthermore, qRT-PCR also confirmed the upregulation of these five key genes in the normal human hepatocyte cell line (HL-7702) and HCC cell lines (SMMC-7721, MHCC-97L, and MHCC-97H); patients with upregulated expression of these five key genes had significantly poorer survival and prognosis. CDK1, NDC80, HMMR, CDKN3, and PTTG1 can be used as molecular markers for HCC. This finding provides potential strategies for clinical diagnosis, accurate treatment, and prognosis analysis of liver cancer.", "claims": [{"id": "claim-method", "statement": "Survival analysis was performed using the Kaplan-Meier method and log-rank test.", "kind": "methodological", "target": null, "evidence": [{"asset": "source:pmid:33688500", "locator": "sections[13] \"2.11. Statistical Analysis\" paragraph 2", "quote": "Survival analysis was performed using the Kaplan-Meier method and log-rank test."}], "state": "complete"}, {"id": "claim-data-access", "statement": "Some or all data, models, or codes generated or used during the study are available from the corresponding author by request.", "kind": "methodological", "target": null, "evidence": [{"asset": "source:pmid:33688500", "locator": "sections[24] \"Data Availability\" paragraph 2", "quote": "Some or all data, models, or codes generated or used during the study are available from the corresponding author by request."}], "state": "complete"}], "gaps": []}, "experiment": {"state": "complete", "objective": null, "steps": [{"id": "read_published_estimate", "order": 1, "name": "Read the published estimate from the source", "kind": "other", "state": "complete", "blocked_on": null, "description": "The claim, method and evidence span published with the source article.", "duration_hours": null, "parameters": {}, "inputs": ["source:pmid:33688500"], "outputs": ["the published estimate and its evidence"], "instruments": [], "reagents": []}, {"id": "obtain_source_data", "order": 2, "name": "Obtain the source data from the named repository", "kind": "data-preparation", "state": "complete", "blocked_on": null, "description": "The GEO series accession resolves and its sample accessions are listed. This lane did not download the dataset or read its licence.", "duration_hours": null, "parameters": {}, "inputs": ["data:geo:GSE25097"], "outputs": ["the source data with its repository provenance"], "instruments": [], "reagents": []}, {"id": "run_analysis", "order": 3, "name": "Run the published analysis", "kind": "analysis", "state": "complete", "blocked_on": null, "description": "Apply the paper's statistical method to the resolved series and compare the result with the published target.", "duration_hours": null, "parameters": {}, "inputs": ["data:geo:GSE25097"], "outputs": ["the replicated result and its comparison"], "instruments": [], "reagents": []}], "materials": [], "instruments": [], "reagents": [], "conditions": {}, "gaps": []}, "data": {"state": "partial", "assets": [{"id": "source:pmid:33688500", "role": "manuscript", "format": "xml", "media_type": "application/xml", "uri": "https://doi.org/10.1155/2021/6662114", "sha256": "sha256:a6ad16a399eb9168a3cc9f0003ae4591677aa865a617f60e837532af3c397df1", "bytes": 40549, "access": "open", "state": "resolved", "reader": null, "reader_status": "reader_required", "identifier": "10.1155/2021/6662114", "version": null, "note": "Full article fetched from PMC; the checksum covers the rendered section body, not the original XML bytes.", "structure": {"pmcid": "PMC7925030", "source": "europe_pmc_fulltext", "coverage": "whole_body", "text_hash_scope": "rendered_section_body"}}, {"id": "data:geo:GSE25097", "role": "raw", "format": "geo-series", "media_type": "application/vnd.ncbi.geo-series+json", "uri": "https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE25097", "sha256": null, "bytes": null, "access": "open", "state": "resolved", "reader": null, "reader_status": "reader_required", "identifier": "GSE25097", "version": null, "note": "Some or all data, models, or codes generated or used during the study are available from the corresponding author by request.", "structure": {"repository": "GEO", "access_route": "GEO accession URL", "access_statement_verbatim": "Some or all data, models, or codes generated or used during the study are available from the corresponding author by request.", "access_statement_kind": "data_availability_statement", "sample_accessions": ["GSM616704", "GSM616705", "GSM616706", "GSM616707", "GSM616708", "GSM616709", "GSM616710", "GSM616711", "GSM616712", "GSM616713", "GSM616714", "GSM616715", "GSM616716", "GSM616717", "GSM616718", "GSM616719", "GSM616720", "GSM616721", "GSM616722", "GSM616723", "GSM616724", "GSM616725", "GSM616726", "GSM616727", "GSM616728", "GSM616729", "GSM616730", "GSM616731", "GSM616732", "GSM616733", "GSM616734", "GSM616735", "GSM616736", "GSM616737", "GSM616738", "GSM616739", "GSM616740", "GSM616741", "GSM616742", "GSM616743", "GSM616744", "GSM616745", "GSM616746", "GSM616747", "GSM616748", "GSM616749", "GSM616750", "GSM616751", "GSM616752", "GSM616753", "GSM616754", "GSM616755", "GSM616756", "GSM616757", "GSM616758", "GSM616759", "GSM616760", "GSM616761", "GSM616762", "GSM616763", "GSM616764", "GSM616765", "GSM616766", "GSM616767", "GSM616768", "GSM616769", "GSM616770", "GSM616771", "GSM616772", "GSM616773", "GSM616774", "GSM616775", "GSM616776", "GSM616777", "GSM616778", "GSM616779", "GSM616780", "GSM616781", "GSM616782", "GSM616783", "GSM616784", "GSM616785", "GSM616786", "GSM616787", "GSM616788", "GSM616789", "GSM616790", "GSM616791", "GSM616792", "GSM616793", "GSM616794", "GSM616795", "GSM616796", "GSM616797", "GSM616798", "GSM616799", "GSM616800", "GSM616801", "GSM616802", "GSM616803", "GSM616804", "GSM616805", "GSM616806", "GSM616807", "GSM616808", "GSM616809", "GSM616810", "GSM616811", "GSM616812", "GSM616813", "GSM616814", "GSM616815", "GSM616816", "GSM616817", "GSM616818", "GSM616819", "GSM616820", "GSM616821", "GSM616822", "GSM616823", "GSM616824", "GSM616825", "GSM616826", "GSM616827", "GSM616828", "GSM616829", "GSM616830", "GSM616831", "GSM616832", "GSM616833", "GSM616834", "GSM616835", "GSM616836", "GSM616837", "GSM616838", "GSM616839", "GSM616840", "GSM616841", "GSM616842", "GSM616843", "GSM616844", "GSM616845", "GSM616846", "GSM616847", "GSM616848", "GSM616849", "GSM616850", "GSM616851", "GSM616852", "GSM616853", "GSM616854", "GSM616855", "GSM616856", "GSM616857", "GSM616858", "GSM616859", "GSM616860", "GSM616861", "GSM616862", "GSM616863", "GSM616864", "GSM616865", "GSM616866", "GSM616867", "GSM616868", "GSM616869", "GSM616870", "GSM616871", "GSM616872", "GSM616873", "GSM616874", "GSM616875", "GSM616876", "GSM616877", "GSM616878", "GSM616879", "GSM616880", "GSM616881", "GSM616882", "GSM616883", "GSM616884", "GSM616885", "GSM616886", "GSM616887", "GSM616888", "GSM616889", "GSM616890", "GSM616891", "GSM616892", "GSM616893", "GSM616894", "GSM616895", "GSM616896", "GSM616897", "GSM616898", "GSM616899", "GSM616900", "GSM616901", "GSM616902", "GSM616903", "GSM616904", "GSM616905", "GSM616906", "GSM616907", "GSM616908", "GSM616909", "GSM616910", "GSM616911", "GSM616912", "GSM616913", "GSM616914", "GSM616915", "GSM616916", "GSM616917", "GSM616918", "GSM616919", "GSM616920", "GSM616921", "GSM616922", "GSM616923", "GSM616924", "GSM616925", "GSM616926", "GSM616927", "GSM616928", "GSM616929", "GSM616930", "GSM616931", "GSM616932", "GSM616933", "GSM616934", "GSM616935", "GSM616936", "GSM616937", "GSM616938", "GSM616939", "GSM616940", "GSM616941", "GSM616942", "GSM616943", "GSM616944", "GSM616945", "GSM616947", "GSM616948", "GSM616950", "GSM616952", "GSM616953", "GSM616955", "GSM616957", "GSM616959", "GSM616961", "GSM616963", "GSM616965", "GSM616966", "GSM616968", "GSM616970", "GSM616972", "GSM616973", "GSM616975", "GSM616977", "GSM616978", "GSM616980", "GSM616982", "GSM616984", "GSM616986", "GSM616987", "GSM616989", "GSM616990", "GSM616992", "GSM616994", "GSM616995", "GSM616996", "GSM616997", "GSM616998", "GSM616999", "GSM617000", "GSM617001", "GSM617002", "GSM617003", "GSM617004", "GSM617005", "GSM617006", "GSM617007", "GSM617008", "GSM617009", "GSM617010", "GSM617011", "GSM617012", "GSM617013", "GSM617304", "GSM617305", "GSM617306", "GSM617307", "GSM617308", "GSM617309", "GSM617310", "GSM617311", "GSM617312", "GSM617313", "GSM617314", "GSM617315", "GSM617316", "GSM617317", "GSM617318", "GSM617319", "GSM617320", "GSM617321", "GSM617322", "GSM617323", "GSM617324", "GSM617325", "GSM617326", "GSM617327", "GSM617328", "GSM617329", "GSM617330", "GSM617331", "GSM617332", "GSM617333", "GSM617334", "GSM617335", "GSM617336", "GSM617337", "GSM617338", "GSM617339", "GSM617340", "GSM617341", "GSM617342", "GSM617343", "GSM617344", "GSM617345", "GSM617346", "GSM617347", "GSM617348", "GSM617349", "GSM617350", "GSM617351", "GSM617352", "GSM617353", "GSM617354", "GSM617355", "GSM617356", "GSM617357", "GSM617358", "GSM617359", "GSM617360", "GSM617361", "GSM617362", "GSM617363", "GSM617364", "GSM617365", "GSM617366", "GSM617367", "GSM617368", "GSM617369", "GSM617370", "GSM617371", "GSM617372", "GSM617373", "GSM617374", "GSM617375", "GSM617376", "GSM617377", "GSM617378", "GSM617379", "GSM617380", "GSM617381", "GSM617382", "GSM617383", "GSM617384", "GSM617385", "GSM617386", "GSM617387", "GSM617388", "GSM617389", "GSM617390", "GSM617391", "GSM617392", "GSM617393", "GSM617394", "GSM617395", "GSM617396", "GSM617397", "GSM617398", "GSM617399", "GSM617400", "GSM617401", "GSM617402", "GSM617403", "GSM617404", "GSM617405", "GSM617406", "GSM617407", "GSM617408", "GSM617409", "GSM617410", "GSM617411", "GSM617412", "GSM617413", "GSM617414", "GSM617415", "GSM617416", "GSM617417", "GSM617418", "GSM617419", "GSM617420", "GSM617421", "GSM617422", "GSM617423", "GSM617424", "GSM617425", "GSM617426", "GSM617427", "GSM617428", "GSM617429", "GSM617430", "GSM617431", "GSM617432", "GSM617433", "GSM617434", "GSM617435", "GSM617436", "GSM617437", "GSM617438", "GSM617439", "GSM617440", "GSM617441", "GSM617442", "GSM617443", "GSM617444", "GSM617445", "GSM617446", "GSM617447", "GSM617448", "GSM617449", "GSM617450", "GSM617451", "GSM617452", "GSM617453", "GSM617454", "GSM617455", "GSM617456", "GSM617457", "GSM617458", "GSM617459", "GSM617460", "GSM617461", "GSM617462", "GSM617463", "GSM617464", "GSM617465", "GSM617466", "GSM617467", "GSM617468", "GSM617469", "GSM617470", "GSM617471", "GSM617472", "GSM617473", "GSM617474", "GSM617475", "GSM617476", "GSM617477", "GSM617478", "GSM617479", "GSM617480", "GSM617481", "GSM617482", "GSM617483", "GSM617484", "GSM617485", "GSM617486", "GSM617487", "GSM617488", "GSM617489", "GSM617490", "GSM617491", "GSM617492", "GSM617493", "GSM617494", "GSM617495", "GSM617496", "GSM617497", "GSM617498", "GSM617499", "GSM617500", "GSM617501", "GSM617502", "GSM617503", "GSM617504", "GSM617505", "GSM617506", "GSM617507", "GSM617508", "GSM617509", "GSM617510", "GSM617511", "GSM617512", "GSM617513", "GSM617514", "GSM617515", "GSM617516", "GSM617517", "GSM617518", "GSM617519", "GSM617520", "GSM617521", "GSM617522", "GSM617523", "GSM617524", "GSM617525", "GSM617526", "GSM617527", "GSM617528", "GSM617529", "GSM617530", "GSM617531", "GSM617532", "GSM617533", "GSM617534", "GSM617535", "GSM617536", "GSM617537", "GSM617538", "GSM617539", "GSM617540", "GSM617541", "GSM617542", "GSM617543", "GSM617544", "GSM617545", "GSM617546", "GSM617547", "GSM617548", "GSM617549", "GSM617550", "GSM617551", "GSM617552", "GSM617553", "GSM617554", "GSM617555", "GSM617556", "GSM617557", "GSM617558", "GSM617559", "GSM617560", "GSM617561", "GSM617562", "GSM617563", "GSM617564", "GSM617565", "GSM617566", "GSM617567", "GSM617568", "GSM617569", "GSM617570", "GSM617571"], "sample_count": 557, "group_sizes": null, "group_sizes_basis": null, "platform": "10687", "taxon": "Homo sapiens", "title": "Study of gene expression of human liver Hepatocellular carcinoma", "resolution_checked_at": "2026-11-01T15:39:54Z", "resolution_check": "identifier_resolution_only_no_download_no_licence_read", "downloaded": false, "licence_read": false}}, {"id": "data:geo:GSE84005", "role": "raw", "format": "geo-series", "media_type": "application/vnd.ncbi.geo-series+json", "uri": "https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE84005", "sha256": null, "bytes": null, "access": "open", "state": "resolved", "reader": null, "reader_status": "reader_required", "identifier": "GSE84005", "version": null, "note": "Some or all data, models, or codes generated or used during the study are available from the corresponding author by request.", "structure": {"repository": "GEO", "access_route": "GEO accession URL", "access_statement_verbatim": "Some or all data, models, or codes generated or used during the study are available from the corresponding author by request.", "access_statement_kind": "data_availability_statement", "sample_accessions": ["GSM2225183", "GSM2225184", "GSM2225185", "GSM2225186", "GSM2225187", "GSM2225188", "GSM2225189", "GSM2225190", "GSM2225191", "GSM2225192", "GSM2225193", "GSM2225194", "GSM2225195", "GSM2225196", "GSM2225197", "GSM2225198", "GSM2225199", "GSM2225200", "GSM2225201", "GSM2225202", "GSM2225203", "GSM2225204", "GSM2225205", "GSM2225206", "GSM2225207", "GSM2225208", "GSM2225209", "GSM2225210", "GSM2225211", "GSM2225212", "GSM2225213", "GSM2225214", "GSM2225215", "GSM2225216", "GSM2225217", "GSM2225218", "GSM2225219", "GSM2225220", "GSM2225221", "GSM2225222", "GSM2225223", "GSM2225224", "GSM2225225", "GSM2225226", "GSM2225227", "GSM2225228", "GSM2225229", "GSM2225230", "GSM2225231", "GSM2225232", "GSM2225233", "GSM2225234", "GSM2225235", "GSM2225236", "GSM2225237", "GSM2225238", "GSM2225239", "GSM2225240", "GSM2225241", "GSM2225242", "GSM2225243", "GSM2225244", "GSM2225245", "GSM2225246", "GSM2225247", "GSM2225248", "GSM2225249", "GSM2225250", "GSM2225251", "GSM2225252", "GSM2225253", "GSM2225254", "GSM2225255", "GSM2225256", "GSM2225257", "GSM2225258"], "sample_count": 76, "group_sizes": null, "group_sizes_basis": null, "platform": "5175", "taxon": "Homo sapiens", "title": "Integrative omics analysis in HCC samples [mRNA expression]", "resolution_checked_at": "2026-11-01T15:39:55Z", "resolution_check": "identifier_resolution_only_no_download_no_licence_read", "downloaded": false, "licence_read": false}}, {"id": "asset:table:pmid:33688500:1", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:e2a50f1174cad597f7b220c01c765ea18e42e019489c4e312aa6c7650696c6c1", "bytes": 669, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[11]/table-wrap[1]#tab1", "version": null, "note": "Primers for target genes.", "structure": {"pmcid": "PMC7925030", "section_index": 11, "section_title": "2.9. RNA Isolation, Library Synthesis, and qRT-PCR", "row_count": 13, "column_count": 3}, "table": {"label": "Table 1", "caption": "Primers for target genes.", "rows": [["Gene ID", "Sequence (5′-3′)"], ["GAPDH", "Forward", "GTCTTCCTGGGCAAGCAGTA"], ["Reverse", "CTGGACAGAAACCCCACTTC"], ["CDK1", "Forward", "AAGTTCAAGTTTCGTAATGC"], ["Reverse", "ACTGTTCTTCCCTGTTGC"], ["NDC80", "Forward", "TAAGTTTAATCCCGAGGCT"], ["Reverse", "GTTGGTATTCCCGCTGA"], ["HMMR", "Forward", "GCAAATACCTCCTCCCTAA"], ["Reverse", "GGATGGAGCCTAAGAACCT"], ["CDKN3", "Forward", "GGACTCCTGACATAGCCAGC"], ["Reverse", "CTGTATTGCCCCGGATCCTC"], ["PTTG1", "Forward", "ACCCGTGTGGTTGCTAAGG"], ["Reverse", "ACGTGGTGTTGAAACTTGAGAT"]], "row_count": 13, "column_count": 3, "numeric_cells": 2, "header_rows": 1, "locator": "section[11]/table-wrap[1]#tab1"}}, {"id": "asset:table:pmid:33688500:2", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:9e4339249a1449fbe2c35e2232f5076850f2fb7efce32578b384d79a553b97e2", "bytes": 2289, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[15]/table-wrap[1]#tab2", "version": null, "note": "The 99 upregulated genes and 192 downregulated genes.", "structure": {"pmcid": "PMC7925030", "section_index": 15, "section_title": "3.1. Identification of DEGs and Construction of the HCC-Related PPI Network", "row_count": 3, "column_count": 2}, "table": {"label": "Table 2", "caption": "The 99 upregulated genes and 192 downregulated genes.", "rows": [["DEGs", "Gene name"], ["Upregulated genes", "BUB1B, CDKN3, RACGAP1, CDCA8, MDK, KIF2C, CDCA5, GJC1, RAD51AP1, DTL, PRC1, CLGN, SKA1, COCH, PTTG1, SHCBP1, MYBL2, BRCA1, ECT2, HELLS, EXO1, ASF1B, MKI67, KIF20A, NEIL3, BUB1, FOXM1, TRIP13, SGO1, FAM83D, STIL, CENPI, CA12, MMP12, LPL, ESM1, TCF19, KIF11, GPC3, DLGAP5, MEP1A, CDK1, AURKA, depdc1b, NUSAP1, CHEK1, CCNA2, SLC7A11, CENPK, SULT1C2, KNL1, IGF2BP1, CDC20, CDC6, CCNE2, THY1, E2F8, CCNB2, TOP2A, MUC13, SKA3, ASPM, FANCI, TTC39A, CCNB1, NCAPG, SPINK1, CD109, SPDL1, MCM8, FLVCR1, KIF14, GNG4, NUF2, KIF4A, DNAJC6, RRM2, MELK, ANLN, PBK, NCAPH, UBE2T, HMMR, SQLE, FAM111B, EZH2, CKAP2, AKR1B10, TTK, CDC25C, ATAD2, MCM2, KIF23, NQO1, SPC25, TPX2, HJURP, CENPF, NDC80"], ["Downregulated genes", "LUM, DCN, RANBP3L, NNMT, timd4, CLEC1B, PTPRB, HPD, OAT, PLAC8, CYP3A43, ADRA1A, KCNN2, FBLN5, HGFAC, MS4A6A, CXCL12, SFRP5, HAMP, CTH, MBL2, EPHA3, MFSD2A, IYD, MASP2, LY6E, CDHR2, CD163, AKR1D1, SRPX, GZMK, SHBG, ACADL, FAM180A, LCAT, FREM2, VIPR1, Ugt2b10, SLC10A1, AADAT, SLC4A4, CHST4, MT1G, C9, ABCA8, ADGRE1, ADGRG7, HAO2, NAT2, BBOX1, FCN3, PAMR1, ALPL, SLC16A4, fam134b, UGT2B7, LIFR, PROZ, CPED1, CETP, ID1, DNASE1L3, GPD1, GPM6A, RDH16, FCN2, rspo3, EHD3, TEK, PRKAR2B, GYS2, RND3, IGF1, FOSB, BCHE, SDS, RDH5, C6, TMEM27, SPP2, FXYD1, GLS2, ENO3, FOS, GNMT, MT1X, MME, ABCA9, RELN, RAB25, LAMA2, ADH4, GBA3, APOF, CYP1A1, Mt1m, NPY1R, IL7R, SLC1A2, CYP39A1, CFTR, MT1A, Mt1f, DPT, COLEC11, CYP26A1, SLC25A47, THRSP, UROC1, TFPI2, CCL21, BMP5, STAB2, BCO2, CCDC3, Cyp1a2, APOA5, MFAP4, HAND2-AS1, CYP2E1, CYP2C8, CYP2C9, CYP4A11, SLC22A1, GLYAT, COLEC10, INMT, CFHR3, MARCO, ECM1, BMPER, CRHBP, MT1P3, LRAT, LOC100287413, MT1L, SELP, HGF, MFAP3L, TDO2, CLEC4G, GNA14, SLCO1B3, SPIC, SCIMP, HSD17B13, CCBE1, LPA, cyp3a4, clrn3, KMO, CYP8B1, OGDHL, acsm3, RBMS3, SULT1E1, OIT3, SULT1B1, CD69, DNAJC12, XDH, MMRN1, STEAP4, CNDP1, IL13RA2, CD5L, c8orf4, SRD5A2, ASPN, SLC5A1, GHR, CFP, SLC22A10, ITGA9, C7, HSD11B1, CCL19, S100A8, AFM, LYVE1, P2RY13, HHIP, JCHAIN, RBP1, CXCL2, PZP, cyp2c19, IDO2, CLEC12A, DIRAS3, CXCL14, ANGPTL1"]], "row_count": 3, "column_count": 2, "numeric_cells": 2, "header_rows": 1, "locator": "section[15]/table-wrap[1]#tab2"}}, {"id": "asset:table:pmid:33688500:3", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:e940264f93732014de6855a70fcec924db6df6e13d75555ddc9014aeeebe75c3", "bytes": 980, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[18]/table-wrap[1]#tab3", "version": null, "note": "Ten key molecules with high centralities in the PPI network.", "structure": {"pmcid": "PMC7925030", "section_index": 18, "section_title": "3.4. Centrality Analysis of the PPIN", "row_count": 11, "column_count": 5}, "table": {"label": "Table 3", "caption": "Ten key molecules with high centralities in the PPI network.", "rows": [["Gene name", "Description", "Degree", "Betweenness", "Closeness"], ["TOP2A", "DNA topoisomerase II alpha", "93", "0.29654147", "0.4845815"], ["CDK1", "Cyclin-dependent kinase 1", "74", "0.01937521", "0.43737575"], ["NDC80", "NDC80 kinetochore complex component", "73", "0.06677326", "0.44088176"], ["CCNB1", "Cyclin B1", "73", "0.01896303", "0.43650794"], ["HMMR", "Hyaluronan-mediated motility receptor", "71", "0.03418334", "0.4206501"], ["CENPF", "Centromere protein F", "70", "0.03351845", "0.43222004"], ["AURKA", "Aurora kinase A", "69", "0.02444692", "0.4238921"], ["CDKN3", "Cyclin-dependent kinase inhibitor 3", "67", "0.02961628", "0.43650794"], ["FOXM1", "Forkhead box M1", "62", "0.06382427", "0.44534413"], ["PTTG1", "PTTG1 regulator of sister chromatid separation, securin", "60", "0.01557241", "0.4206501"]], "row_count": 11, "column_count": 5, "numeric_cells": 34, "header_rows": 1, "locator": "section[18]/table-wrap[1]#tab3"}}, {"id": "asset:table:pmid:33688500:4", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:8e45a45d5820fcdb681999db49d0dba6d1fba30099979953087d64e517ddbf49", "bytes": 1114, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[20]/table-wrap[1]#tab4", "version": null, "note": "The aliases and gene function of 5 key genes.", "structure": {"pmcid": "PMC7925030", "section_index": 20, "section_title": "3.6. Survival Analysis of Five Key Genes in HCC", "row_count": 6, "column_count": 3}, "table": {"label": "Table 4", "caption": "The aliases and gene function of 5 key genes.", "rows": [["Gene symbol", "Aliases", "Gene function"], ["CDK1", "CDC2, CDC28A, P34CDC2", "This gene is essential for G1/S and G2/M phase transitions of the eukaryotic cell cycle."], ["NDC80", "HEC, HEC1, TID3, KNTC2, HsHec1, hsNDC80", "The gene encodes proteins necessary for proper chromosome segregation."], ["HMMR", "CD168, IHABP, RHAMM", "The protein encoded by this gene is involved in cell motility and potentially associated with a higher risk of breast cancer."], ["CDKN3", "CDKN3, CDI1, CIP2, KAP", "The protein encoded by this gene belongs to the dual-specificity protein phosphatase family. This gene was reported to be deleted, mutated, or overexpressed in several kinds of cancers."], ["PTTG1", "EAP1, HPTTG, MGC126883, MGC138276, PTTG, TUTR1", "The gene product contains 2 PXXP motifs, which are required for its transforming and tumorigenic activities, as well as for its stimulation of basic fibroblast growth factor expression."]], "row_count": 6, "column_count": 3, "numeric_cells": 6, "header_rows": 1, "locator": "section[20]/table-wrap[1]#tab4"}}], "gaps": ["asset:data:geo:GSE25097 not downloaded", "asset:data:geo:GSE25097 licence not read", "asset:data:geo:GSE84005 not downloaded", "asset:data:geo:GSE84005 licence not read"]}, "analysis": {"state": "partial", "methods": [{"id": "method-1", "family": "survival_analysis", "specific": "log_rank_test", "label": "Survival analysis", "dsl_operations": ["logrank_test"], "missing_operations": [], "expressible": true, "parameters": {}, "data_shapes": ["time_to_event_with_censoring"], "evidence": {"score": 1.0, "band": "verbatim", "quote": "Survival analysis was performed using the Kaplan-Meier method and log-rank test."}}, {"id": "method-2", "family": "group_comparison", "specific": "student_t_test", "label": "Group comparison", "dsl_operations": [], "missing_operations": ["student_t"], "expressible": false, "parameters": {}, "data_shapes": ["two_or_more_groups_continuous"], "evidence": {"score": 0.8, "band": "high", "quote": "Student's t-test"}}, {"id": "method-3", "family": "group_comparison", "specific": "anova", "label": "Group comparison", "dsl_operations": ["group_summary", "welch_t", "bootstrap_mean_difference", "group_comparison_anova"], "missing_operations": [], "expressible": true, "parameters": {}, "data_shapes": ["two_or_more_groups_continuous"], "evidence": {"score": 0.8, "band": "high", "quote": "ANOVA"}}, {"id": "method-4", "family": "survival_analysis", "specific": "kaplan_meier", "label": "Survival analysis", "dsl_operations": ["survival_km"], "missing_operations": [], "expressible": true, "parameters": {}, "data_shapes": ["time_to_event_with_censoring"], "evidence": {"score": 0.8, "band": "high", "quote": "Kaplan-Meier"}}, {"id": "method-5", "family": "correlation_analysis", "specific": "pearson", "label": "Correlation analysis", "dsl_operations": ["pearson_r"], "missing_operations": [], "expressible": true, "parameters": {}, "data_shapes": ["paired_numeric_columns"], "evidence": {"score": 0.8, "band": "high", "quote": "Pearson correlation"}}, {"id": "method-6", "family": "network_analysis", "specific": "ppi_network", "label": "Network / pathway analysis", "dsl_operations": ["build_graph", "centrality_scores", "pathway_enrich"], "missing_operations": [], "expressible": true, "parameters": {}, "data_shapes": ["edge_list"], "evidence": {"score": 0.7, "band": "medium", "quote": "protein-protein interaction"}}, {"id": "method-7", "family": "network_analysis", "specific": "pathway_enrichment", "label": "Network / pathway analysis", "dsl_operations": ["pathway_enrich"], "missing_operations": [], "expressible": true, "parameters": {}, "data_shapes": ["edge_list"], "evidence": {"score": 0.7, "band": "medium", "quote": "pathway enrichment"}}, {"id": "method-8", "family": "network_analysis", "specific": "centrality", "label": "Network / pathway analysis", "dsl_operations": ["build_graph", "centrality_scores", "pathway_enrich"], "missing_operations": [], "expressible": true, "parameters": {}, "data_shapes": ["edge_list"], "evidence": {"score": 0.7, "band": "medium", "quote": "centrality"}}, {"id": "method-9", "family": "contingency_analysis", "specific": "chi_square", "label": "Categorical (contingency table) analysis", "dsl_operations": ["chi_square_test"], "missing_operations": [], "expressible": true, "parameters": {}, "data_shapes": ["categorical_cross_tabulation"], "evidence": {"score": 0.8, "band": "high", "quote": "χ2"}}], "targets": [], "gaps": ["method.reader_differs_from_extractor"]}, "capability": {"state": "complete", "requirements": [{"capability_id": "capability:computational_analysis", "label": "Computational analysis platform", "assay_families": ["meta_analysis", "machine_learning", "survival_analysis", "statistical_regression", "pca", "molecular_docking", "network_analysis", "differential_expression", "gwas"], "availability_state": "owned", "tier_unlocked": "R1", "candidate": "Automated Assays Laravel application and simulated adapters"}], "gaps": []}, "readiness": {"state": "complete", "tier": "R1", "blocking_axis": "none", "blocked_on": "nothing:replicable_now", "axes": {"method": {"tier": "R1", "expressible": true, "required_operations": ["logrank_test"], "missing_operations": [], "basis": "The paper names the method it used and the corpus's method extractor maps it onto the DSL catalogue: log_rank_test."}, "capability": {"tier": "R1", "capability_id": "capability:computational_analysis", "availability_state": "owned", "basis": "The computational analysis is owned. The physical bench the paper used is not, so a physical validation cannot be run here."}, "data": {"tier": "R1", "reachable": true, "accessions": ["GSE84005", "GSE25097"], "resolved_accessions": ["GSE84005", "GSE25097"], "statements": ["Some or all data, models, or codes generated or used during the study are available from the corresponding author by request."], "basis": "The paper names GSE84005, GSE25097 in Gene Expression Omnibus (GEO) and the accession resolves in the repository. No dataset was downloaded and no licence was read."}}, "can_run": {"dsl_operations": ["logrank_test"], "assets": ["source:pmid:33688500", "data:geo:GSE25097", "asset:table:pmid:33688500:1", "asset:table:pmid:33688500:2", "asset:table:pmid:33688500:3", "asset:table:pmid:33688500:4"], "steps": ["run_analysis"]}, "must_build": {"dsl_operations": [], "converters": [], "readers": [], "capabilities": [], "data_gaps": ["data:geo:GSE25097"]}, "gaps": []}, "review": {"state": "partial", "machine_critique": {"kind": "extraction_review", "reader": {"model": "MiniMax-M3.1-Flash", "provider": "minimax", "provider_family": "minimax", "read_at": "2026-10-31T18:27:50Z", "independence": "single_reader"}, "evidence_check": {"method": "verbatim", "availability": "verbatim"}, "calls": 3, "usage": {"prompt_tokens": 32424, "completion_tokens": 2313, "cached_tokens": 792}}, "human_critique": null, "stages": [{"id": "extraction", "state": "complete", "reader": "MiniMax-M3.1-Flash", "provider": "minimax"}], "gaps": ["review.independent_reader", "review.machine_critique", "review.human_critique"]}, "execution": {"state": "absent", "status": "not_run", "mode": null, "runs": [], "gaps": ["execution.not_run"]}, "provenance": {"entities": [{"id": "pmid:33688500", "type": "paper", "label": "pmid:33688500"}, {"id": "source:pmid:33688500", "type": "manuscript", "label": "PMID 33688500 full text"}, {"id": "data:geo:GSE25097", "type": "dataset", "label": "GEO GSE25097"}], "activities": [{"id": "activity-reading-sci-2026-11-01", "type": "classification", "used": [{"id": "pmid:33688500", "type": "paper", "label": "pmid:33688500"}, {"id": "source:pmid:33688500", "type": "manuscript", "label": "PMID 33688500 full text"}, {"id": "data:geo:GSE25097", "type": "dataset", "label": "GEO GSE25097"}], "agent": "agent:corpus-assay-engine"}, {"id": "activity-read-33688500", "type": "extraction", "used": ["source:pmid:33688500"], "agent": "agent:minimax-reader"}, {"id": "activity-resolve-GSE25097", "type": "accession_resolution", "used": ["data:geo:GSE25097"], "agent": "agent:corpus-assay-engine"}], "agents": [{"id": "agent:corpus-assay-engine", "type": "software", "label": "Corpus assay engine"}, {"id": "agent:minimax-reader", "type": "software", "label": "MiniMax literature reader"}], "source_run_id": "reading-sci-2026-11-01", "dsl_catalogue_fingerprint": "343fb30756ba6ec3", "capability_table_fingerprint": "2cb3e42f047d2ecf", "snapshot_id": "ba34b49490d9bfaf"}, "lineage": {"parent_id": "pmid:33688500", "parent_hash": "sha256:1b27e73b5fe98bcab0e164eefea326b751e0868ed443b668224a8560b2408427", "fork_of": null, "generation": 6}, "gaps": ["asset:data:geo:GSE25097 licence not read", "asset:data:geo:GSE25097 not downloaded", "asset:data:geo:GSE84005 licence not read", "asset:data:geo:GSE84005 not downloaded", "execution.not_run", "method.reader_differs_from_extractor", "review.human_critique", "review.independent_reader", "review.machine_critique"], "assays": [{"role": "data_generation", "definition_id": "cell_culture", "definition_version": "99e1195c7d6f", "definition_digest": null, "required_operations": [], "support_state": "partial", "source_hashes": {"assay_lexicon": "99e1195c7d6f"}, "confidence": 0.99, "evidence": ["m (Gibco Company, Grand Island, NY, USA) and cultured in an incubator at 37°C with 5% CO2 and saturat", "d humidity. MHCC-97L and MHCC-97H cells were cultured with 90% DMEM high-glucose medium and 10% fetal b"], "order_basis": "paper_text_order:4591", "id": "assay:1"}, {"role": "analysis", "definition_id": "survival_analysis", "definition_version": "f2132e96ae6c7a4e", "definition_digest": null, "required_operations": ["logrank_test"], "support_state": "supported", "source_hashes": {"dsl_catalogue": "f2132e96ae6c7a4e"}, "confidence": 1.0, "evidence": ["Survival analysis was performed using the Kaplan-Meier method and log-rank test."], "order_basis": "consumes_earlier_output", "id": "assay:2"}]}