Identification of key pathways and core genes involved in atherosclerotic plaque progression.

{"sci_version": "1.2", "schema": "https://corpus.bntrg.co.uk/sci/1.0/sci.schema.json", "id": "pmid:33708894", "kind": "science-record", "revision": 8, "content_hash": "sha256:8dbedcfe4adf7ff1e842490aaa80bd96bc21fb39e463b422fcb08b019aebd632", "created_at": "2026-11-01T15:41:28Z", "updated_at": "2026-11-01T22:46:17Z", "generator": {"name": "corpus-assay-engine", "run_id": "reading-sci-2026-11-01"}, "paper": {"state": "complete", "title": "Identification of key pathways and core genes involved in atherosclerotic plaque progression.", "doi": "10.21037/atm-21-193", "pmid": "33708894", "authors": ["Rong Yang", "Linpeng Yao", "Chengli Du", "Yihe Wu"], "journal": "Annals of translational medicine", "year": 2021, "abstract": "BACKGROUND: Atherosclerosis leads to the occurrence of cardiovascular diseases. However, the molecular mechanisms that contribute to atherosclerotic plaque rupture are incompletely characterized. We aimed to identify the genes related to atherosclerotic plaque progression that could serve as novel biomarkers and interventional targets for plaque progression.\nMETHODS: The datasets of GSE28829 in early vs. advanced atherosclerotic plaques and those of GSE41571 in stable vs. ruptured plaques from Gene Expression Omnibus (GEO) were analyzed by using bioinformatics methods. In addition, we used quantitative reverse transcription polymerase chain reaction (qRT-PCR) to verify the expression level of core genes in a mouse atherosclerosis model.\nRESULTS: There were 29 common differentially expressed genes (DEGs) between the GSE28829 and GSE41571 datasets, and the DEGs were mainly enriched in the chemokine signaling pathway and the Staphylococcus aureus infection pathway (P<0.05). We identified 6 core genes (FPR3, CCL18, MS4A4A, CXCR4, CXCL2, and C1QB) in the protein-protein interaction (PPI) network, 3 of which (CXCR4, CXCL2, and CCL18) were markedly enriched in the chemokine signaling pathway. qRT-PCR analysis showed that the messenger RNA levels of two core genes (CXCR4 and CXCL2) increased significantly during plaque progression in the mouse atherosclerosis model.\nCONCLUSIONS: In summary, bioinformatics techniques proved useful for the screening and identification of novel biomarkers of disease. A total of 29 DEGs and 6 core genes were linked to atherosclerotic plaque progression, in particular the CXCR4 and CXCL2 genes.", "claims": [{"id": "claim-method", "statement": "One-way analysis of variance was used for comparisons among three groups, and a P value <0.05 was considered statistically significant.", "kind": "methodological", "target": null, "evidence": [{"asset": "source:pmid:33708894", "locator": "sections[9] \"Statistical analysis\" paragraph 2", "quote": "One-way analysis of variance was used for comparisons among three groups, and a P value <0.05 was considered statistically significant."}], "state": "complete"}, {"id": "claim-data-access", "statement": "Data Sharing Statement: Available at http://dx.doi.org/10.21037/atm-21-193", "kind": "methodological", "target": null, "evidence": [{"asset": "source:pmid:33708894", "locator": "sections[19] \"fn-group\" paragraph 1", "quote": "Data Sharing Statement: Available at http://dx.doi.org/10.21037/atm-21-193"}], "state": "complete"}], "gaps": []}, "experiment": {"state": "complete", "objective": null, "steps": [{"id": "read_published_estimate", "order": 1, "name": "Read the published estimate from the source", "kind": "other", "state": "complete", "blocked_on": null, "description": "The claim, method and evidence span published with the source article.", "duration_hours": null, "parameters": {}, "inputs": ["source:pmid:33708894"], "outputs": ["the published estimate and its evidence"], "instruments": [], "reagents": []}, {"id": "obtain_source_data", "order": 2, "name": "Obtain the source data from the named repository", "kind": "data-preparation", "state": "complete", "blocked_on": null, "description": "The GEO series accession resolves and its sample accessions are listed. This lane did not download the dataset or read its licence.", "duration_hours": null, "parameters": {}, "inputs": ["data:geo:GSE28829"], "outputs": ["the source data with its repository provenance"], "instruments": [], "reagents": []}, {"id": "run_analysis", "order": 3, "name": "Run the published analysis", "kind": "analysis", "state": "complete", "blocked_on": null, "description": "Apply the paper's statistical method to the resolved series and compare the result with the published target.", "duration_hours": null, "parameters": {}, "inputs": ["data:geo:GSE28829"], "outputs": ["the replicated result and its comparison"], "instruments": [], "reagents": []}], "materials": [], "instruments": [], "reagents": [], "conditions": {}, "gaps": []}, "data": {"state": "partial", "assets": [{"id": "source:pmid:33708894", "role": "manuscript", "format": "xml", "media_type": "application/xml", "uri": "https://doi.org/10.21037/atm-21-193", "sha256": "sha256:82077fc9976085179dbde795949c6dc497fcd840ff346e0a4825e9713ac1bb25", "bytes": 23734, "access": "open", "state": "resolved", "reader": null, "reader_status": "reader_required", "identifier": "10.21037/atm-21-193", "version": null, "note": "Full article fetched from PMC; the checksum covers the rendered section body, not the original XML bytes.", "structure": {"pmcid": "PMC7940950", "source": "europe_pmc_fulltext", "coverage": "whole_body_without_references", "text_hash_scope": "rendered_section_body"}}, {"id": "data:geo:GSE28829", "role": "raw", "format": "geo-series", "media_type": "application/vnd.ncbi.geo-series+json", "uri": "https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE28829", "sha256": null, "bytes": null, "access": "open", "state": "resolved", "reader": null, "reader_status": "reader_required", "identifier": "GSE28829", "version": null, "note": "Data Sharing Statement: Available at http://dx.doi.org/10.21037/atm-21-193", "structure": {"repository": "GEO", "access_route": "GEO accession URL", "access_statement_verbatim": "Data Sharing Statement: Available at http://dx.doi.org/10.21037/atm-21-193", "access_statement_kind": "data_availability_statement", "sample_accessions": ["GSM714070", "GSM714071", "GSM714072", "GSM714073", "GSM714074", "GSM714075", "GSM714076", "GSM714077", "GSM714078", "GSM714079", "GSM714080", "GSM714081", "GSM714082", "GSM714083", "GSM714084", "GSM714085", "GSM714086", "GSM714087", "GSM714088", "GSM714089", "GSM714090", "GSM714091", "GSM714092", "GSM714093", "GSM714094", "GSM714095", "GSM714096", "GSM714097", "GSM714098"], "sample_count": 29, "group_sizes": null, "group_sizes_basis": null, "platform": "570", "taxon": "Homo sapiens", "title": "Gene Expression in early and advanced atherosclerotic plaque from human carotid", "resolution_checked_at": "2026-11-01T15:39:54Z", "resolution_check": "identifier_resolution_only_no_download_no_licence_read", "downloaded": false, "licence_read": false}}, {"id": "data:geo:GSE41571", "role": "raw", "format": "geo-series", "media_type": "application/vnd.ncbi.geo-series+json", "uri": "https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE41571", "sha256": null, "bytes": null, "access": "open", "state": "resolved", "reader": null, "reader_status": "reader_required", "identifier": "GSE41571", "version": null, "note": "Data Sharing Statement: Available at http://dx.doi.org/10.21037/atm-21-193", "structure": {"repository": "GEO", "access_route": "GEO accession URL", "access_statement_verbatim": "Data Sharing Statement: Available at http://dx.doi.org/10.21037/atm-21-193", "access_statement_kind": "data_availability_statement", "sample_accessions": ["GSM1019539", "GSM1019540", "GSM1019541", "GSM1019542", "GSM1019543", "GSM1019544", "GSM1019545", "GSM1019546", "GSM1019547", "GSM1019548", "GSM1019549"], "sample_count": 11, "group_sizes": null, "group_sizes_basis": null, "platform": "570", "taxon": "Homo sapiens", "title": "Genome-wide expression profiling of laser micro-dissected macrophages from ruptured and stable atherosclerotic human plaques", "resolution_checked_at": "2026-11-01T15:39:54Z", "resolution_check": "identifier_resolution_only_no_download_no_licence_read", "downloaded": false, "licence_read": false}}, {"id": "asset:table:pmid:33708894:1", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:5256d299103134cab79ae4fb5cfa3570eb3a2b6df582ab33167f698e26d09966", "bytes": 416, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[8]/table-wrap[1]#t1", "version": null, "note": "Primer sequences for qRT-PCR", "structure": {"pmcid": "PMC7940950", "section_index": 8, "section_title": "Verification by quantitative reverse transcription quantitative polymerase chain reaction (qRT-PCR)", "row_count": 4, "column_count": 3}, "table": {"label": "Table 1", "caption": "Primer sequences for qRT-PCR", "rows": [["Targets", "Forward primer (5’-3’)", "Reverse primer (3’-5’)"], ["CXCR4", "GAGGCCAAGGAAACTGCTG", "GCGGTCACAGATGTACCTGTC"], ["CXCL2", "CTCAGACAGCGAGGCACATC", "CCTCAACGGAAGAACCAAAGAG"], ["GAPDH", "CACCATCTTCCAGGAGCGAG", "CCTTCTCCATGGTGGTGAAGAC"]], "row_count": 4, "column_count": 3, "numeric_cells": 2, "header_rows": 1, "locator": "section[8]/table-wrap[1]#t1"}}, {"id": "asset:table:pmid:33708894:2", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:6d0df5b5547ae0c6b5dcd6721bbb55427f867d47d55b5644c9bf5de3e5992c82", "bytes": 536, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[11]/table-wrap[1]#t2", "version": null, "note": "A total of 29 commonly differentially expressed genes (DEGs) identified from the GSE28829 and GSE41571 datasets", "structure": {"pmcid": "PMC7940950", "section_index": 11, "section_title": "Identification of DEGs", "row_count": 3, "column_count": 2}, "table": {"label": "Table 2", "caption": "A total of 29 commonly differentially expressed genes (DEGs) identified from the GSE28829 and GSE41571 datasets", "rows": [["DEGs", "Gene symbol"], ["Upregulated", "IGKV1OR2-108, CXCR4, CD37, CD36, IGHM, IGLC1, CD52, CYAT1, AQP9, CCL18, IGLJ3, FPR3, IGHV3-23, NPL, IGLL3P, RAC2, C1QB, IGKC, MS4A4A, HLA-DQB1, JCHAIN, MIR8071-2, CXCL2, IGK, SLC16A10, IGLV1-44, MLIP, IGHA2, CTSC"], ["Downregulated", "–"]], "row_count": 3, "column_count": 2, "numeric_cells": 1, "header_rows": 1, "locator": "section[11]/table-wrap[1]#t2"}}, {"id": "asset:table:pmid:33708894:3", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:5561db0a45bda5b3f6870fbb97ffdacdc4768144fff8c2eb3b44b0629c56e3e0", "bytes": 1906, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[12]/table-wrap[1]#t3", "version": null, "note": "Gene ontology analysis results of differentially expressed genes during the progression of atherosclerotic plaques", "structure": {"pmcid": "PMC7940950", "section_index": 12, "section_title": "DEGs GO and KEGG pathway analyses", "row_count": 18, "column_count": 7}, "table": {"label": "Table 3", "caption": "Gene ontology analysis results of differentially expressed genes during the progression of atherosclerotic plaques", "rows": [["Expression", "Category", "Term", "Count", "%", "P value", "FDR"], ["Upregulated", "GOTERM_BP_DIRECT", "GO: 0006955~immune response", "12", "57.7", "2.96E-13", "3.66E-10"], ["", "GOTERM_BP_DIRECT", "GO: 0006958~complement activation, classical pathway", "7", "33.6", "1.31E-09", "1.61E-06"], ["", "GOTERM_BP_DIRECT", "GO: 0006898~receptor-mediated endocytosis", "7", "33.6", "5.80E-08", "7.16E-05"], ["", "GOTERM_BP_DIRECT", "GO: 0045087~innate immune response", "7", "33.6", "7.78E-06", "0.009601"], ["", "GOTERM_BP_DIRECT", "GO: 0006910~phagocytosis, recognition", "6", "28.8", "1.35E-10", "1.66E-07"], ["", "GOTERM_BP_DIRECT", "GO: 0006508~proteolysis", "6", "28.8", "2.45E-04", "0.302523"], ["", "GOTERM_CC_DIRECT", "GO: 0005886~plasma membrane", "12", "57.7", "0.004436", "4.37306"], ["", "GOTERM_CC_DIRECT", "GO: 0070062~extracellular exosome", "11", "52.9", "8.10E-04", "0.812025"], ["", "GOTERM_CC_DIRECT", "GO: 0005615~extracellular space", "10", "48.1", "1.32E-05", "0.013256"], ["", "GOTERM_CC_DIRECT", "GO: 0005576~extracellular region", "8", "38.4", "0.002154", "2.144901"], ["", "GOTERM_CC_DIRECT", "GO: 0072562~blood microparticle", "7", "33.6", "2.04E-08", "2.05E-05"], ["", "GOTERM_MF_DIRECT", "GO: 0003823~antigen binding", "7", "33.6", "1.13E-09", "1.15E-06"], ["", "GOTERM_MF_DIRECT", "GO: 0034987~immunoglobulin receptor binding", "6", "28.8", "6.60E-11", "6.69E-08"], ["", "GOTERM_MF_DIRECT", "GO: 0004252~serine-type endopeptidase activity", "6", "28.8", "7.40E-06", "0.007488"], ["", "GOTERM_MF_DIRECT", "GO: 0042834~peptidoglycan binding", "2", "9.6", "0.013427", "12.79255"], ["", "GOTERM_MF_DIRECT", "GO: 0031210~phosphatidylcholine binding", "2", "9.6", "0.025586", "23.08273"], ["Downregulated", "–", "–", "–", "–", "–", "–"]], "row_count": 18, "column_count": 7, "numeric_cells": 80, "header_rows": 1, "locator": "section[12]/table-wrap[1]#t3"}}, {"id": "asset:table:pmid:33708894:4", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:3fda6fa9e507572f499832e7e4f5cd3d70d034f18e325a2a56c6904bfae695f0", "bytes": 497, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[12]/table-wrap[2]#t4", "version": null, "note": "KEGG pathway analysis results of differentially expressed genes during the progression of atherosclerotic plaques", "structure": {"pmcid": "PMC7940950", "section_index": 12, "section_title": "DEGs GO and KEGG pathway analyses", "row_count": 3, "column_count": 6}, "table": {"label": "Table 4", "caption": "KEGG pathway analysis results of differentially expressed genes during the progression of atherosclerotic plaques", "rows": [["Pathway ID", "Name", "Count", "%", "P value", "Genes"], ["hsa04062", "Chemokine signaling pathway", "4", "19.2", "0.003574", "RAC2, CXCR4, CXCL2, CCL18"], ["hsa05150", "Staphylococcus aureus infection", "3", "14.4", "0.003796", "HLA-DQB1, C1QB, FPR3"]], "row_count": 3, "column_count": 6, "numeric_cells": 9, "header_rows": 1, "locator": "section[12]/table-wrap[2]#t4"}}], "gaps": ["asset:data:geo:GSE28829 not downloaded", "asset:data:geo:GSE28829 licence not read", "asset:data:geo:GSE41571 not downloaded", "asset:data:geo:GSE41571 licence not read"]}, "analysis": {"state": "complete", "methods": [{"id": "method-1", "family": "group_comparison", "specific": "anova", "label": "Group comparison", "dsl_operations": ["group_summary", "welch_t", "bootstrap_mean_difference", "group_comparison_anova"], "missing_operations": [], "expressible": true, "parameters": {}, "data_shapes": ["two_or_more_groups_continuous"], "evidence": {"score": 1.0, "band": "verbatim", "quote": "One-way analysis of variance was used for comparisons among three groups, and a P value <0.05 was considered statistically significant."}}, {"id": "method-2", "family": "network_analysis", "specific": "ppi_network", "label": "Network / pathway analysis", "dsl_operations": ["build_graph", "centrality_scores", "pathway_enrich"], "missing_operations": [], "expressible": true, "parameters": {}, "data_shapes": ["edge_list"], "evidence": {"score": 0.7, "band": "medium", "quote": "protein-protein interaction"}}], "targets": [], "gaps": []}, "capability": {"state": "complete", "requirements": [{"capability_id": "capability:computational_analysis", "label": "Computational analysis platform", "assay_families": ["meta_analysis", "machine_learning", "survival_analysis", "statistical_regression", "pca", "molecular_docking", "network_analysis", "differential_expression", "gwas"], "availability_state": "owned", "tier_unlocked": "R1", "candidate": "Automated Assays Laravel application and simulated adapters"}], "gaps": []}, "readiness": {"state": "complete", "tier": "R1", "blocking_axis": "none", "blocked_on": "nothing:replicable_now", "axes": {"method": {"tier": "R1", "expressible": true, "required_operations": ["group_summary", "welch_t", "bootstrap_mean_difference", "group_comparison_anova"], "missing_operations": [], "basis": "The paper names the method it used and the corpus's method extractor maps it onto the DSL catalogue: anova."}, "capability": {"tier": "R1", "capability_id": "capability:computational_analysis", "availability_state": "owned", "basis": "The computational analysis is owned. The physical bench the paper used is not, so a physical validation cannot be run here."}, "data": {"tier": "R1", "reachable": true, "accessions": ["GSE28829", "GSE41571"], "resolved_accessions": ["GSE28829", "GSE41571"], "statements": ["Data Sharing Statement: Available at http://dx.doi.org/10.21037/atm-21-193"], "basis": "The paper names GSE28829, GSE41571 in National Center for Biotechnology Information Gene Expression Omnibus (NCBI-GEO) and the accession resolves in the repository. No dataset was downloaded and no licence was read."}}, "can_run": {"dsl_operations": ["group_summary", "welch_t", "bootstrap_mean_difference", "group_comparison_anova"], "assets": ["source:pmid:33708894", "data:geo:GSE28829", "asset:table:pmid:33708894:1", "asset:table:pmid:33708894:2", "asset:table:pmid:33708894:3", "asset:table:pmid:33708894:4"], "steps": ["run_analysis"]}, "must_build": {"dsl_operations": [], "converters": [], "readers": [], "capabilities": [], "data_gaps": ["data:geo:GSE28829"]}, "gaps": []}, "review": {"state": "partial", "machine_critique": {"kind": "extraction_review", "reader": {"model": "MiniMax-M3.1-Flash", "provider": "minimax", "provider_family": "minimax", "read_at": "2026-10-31T18:27:50Z", "independence": "single_reader"}, "evidence_check": {"method": "verbatim", "availability": "verbatim"}, "calls": 3, "usage": {"prompt_tokens": 17552, "completion_tokens": 1974, "cached_tokens": 784}}, "human_critique": null, "stages": [{"id": "extraction", "state": "complete", "reader": "MiniMax-M3.1-Flash", "provider": "minimax"}], "gaps": ["review.independent_reader", "review.machine_critique", "review.human_critique"]}, "execution": {"state": "absent", "status": "not_run", "mode": null, "runs": [], "gaps": ["execution.not_run"]}, "provenance": {"entities": [{"id": "pmid:33708894", "type": "paper", "label": "pmid:33708894"}, {"id": "source:pmid:33708894", "type": "manuscript", "label": "PMID 33708894 full text"}, {"id": "data:geo:GSE28829", "type": "dataset", "label": "GEO GSE28829"}], "activities": [{"id": "activity-reading-sci-2026-11-01", "type": "classification", "used": [{"id": "pmid:33708894", "type": "paper", "label": "pmid:33708894"}, {"id": "source:pmid:33708894", "type": "manuscript", "label": "PMID 33708894 full text"}, {"id": "data:geo:GSE28829", "type": "dataset", "label": "GEO GSE28829"}], "agent": "agent:corpus-assay-engine"}, {"id": "activity-read-33708894", "type": "extraction", "used": ["source:pmid:33708894"], "agent": "agent:minimax-reader"}, {"id": "activity-resolve-GSE28829", "type": "accession_resolution", "used": ["data:geo:GSE28829"], "agent": "agent:corpus-assay-engine"}], "agents": [{"id": "agent:corpus-assay-engine", "type": "software", "label": "Corpus assay engine"}, {"id": "agent:minimax-reader", "type": "software", "label": "MiniMax literature reader"}], "source_run_id": "reading-sci-2026-11-01", "dsl_catalogue_fingerprint": "343fb30756ba6ec3", "capability_table_fingerprint": "2cb3e42f047d2ecf", "snapshot_id": "ba34b49490d9bfaf"}, "lineage": {"parent_id": "pmid:33708894", "parent_hash": "sha256:18491e08aefe0ea00f921f77f8110063b4a2781853f401b4186f2c6bd6d9dc62", "fork_of": null, "generation": 7}, "gaps": ["asset:data:geo:GSE28829 licence not read", "asset:data:geo:GSE28829 not downloaded", "asset:data:geo:GSE41571 licence not read", "asset:data:geo:GSE41571 not downloaded", "execution.not_run", "review.human_critique", "review.independent_reader", "review.machine_critique"], "assays": [{"role": "data_generation", "definition_id": "animal_model", "definition_version": "99e1195c7d6f", "definition_digest": null, "required_operations": [], "support_state": "partial", "source_hashes": {"assay_lexicon": "99e1195c7d6f"}, "confidence": 0.99, "evidence": ["ased significantly during plaque progression in the mouse atherosclerosis model. CONCLUSIONS: In summa", "rify the expression level of core genes in a mouse atherosclerosis model. RESULTS: There were 2", "gnificantly during plaque progression in the mouse atherosclerosis model. CONCLUSIONS: In summa", "l Animal Co., Ltd. (Shanghai, China). The WT mice were given a normal diet and used as controls, an"], "order_basis": "paper_text_order:767", "id": "assay:1"}, {"role": "data_generation", "definition_id": "microarray", "definition_version": "99e1195c7d6f", "definition_digest": null, "required_operations": [], "support_state": "partial", "source_hashes": {"assay_lexicon": "99e1195c7d6f"}, "confidence": 0.93, "evidence": ["tify the common DEGs between the two sets of microarray data (14). The DEGs with log FC <0 and log F"], "order_basis": "paper_text_order:1964", "id": "assay:2"}, {"role": "analysis", "definition_id": "group_comparison", "definition_version": "f2132e96ae6c7a4e", "definition_digest": null, "required_operations": ["group_summary", "welch_t", "bootstrap_mean_difference", "group_comparison_anova"], "support_state": "supported", "source_hashes": {"dsl_catalogue": "f2132e96ae6c7a4e"}, "confidence": 1.0, "evidence": ["One-way analysis of variance was used for comparisons among three groups, and a P value <0.05 was considered statistically significant."], "order_basis": "consumes_earlier_output", "id": "assay:3"}]}