Identification of fibroblast activation-related genes in two acute kidney injury models.

{"sci_version": "1.2", "schema": "https://corpus.bntrg.co.uk/sci/1.0/sci.schema.json", "id": "pmid:33777519", "kind": "science-record", "revision": 7, "content_hash": "sha256:6fad6f77a0f0942ed0ac29063ddc6bfad8f8e46f0c069b22e65500f382160dcb", "created_at": "2026-11-01T15:41:30Z", "updated_at": "2026-11-01T22:03:25Z", "generator": {"name": "corpus-assay-engine", "run_id": "reading-sci-2026-11-01"}, "paper": {"state": "complete", "title": "Identification of fibroblast activation-related genes in two acute kidney injury models.", "doi": "10.7717/peerj.10926", "pmid": "33777519", "authors": ["Weiming Deng", "Xiangling Wei", "Zhanwen Dong", "Jinhua Zhang", "Zhengyu Huang", "Ning Na"], "journal": "PeerJ", "year": 2021, "abstract": "BACKGROUND: Ischemia-reperfusion injury and drug-induced nephrotoxicity are the two most common reasons for acute kidney injury (AKI). However, little attention has been paid to early activation of fibroblasts in the progression of AKI to chronic kidney disease (CKD). The present study aimed to identify related genes and pathways on fibroblast activation in two mouse models of AKI: ischemia-reperfusion injury (IRI) model and folic acid (FA)-induced injury model.\nMETHODS: The microarray expression profiles of GSE62732 and GSE121190 were downloaded from the GEO database, and the differentially expressed genes (DEGs) was analyzed using the Limma package of R software. Principal component analysis (PCA) was also performed using R. The functional information of gene products was annotated by Gene Ontology (GO) and DAVID online database, and the pathway analysis was carried out by using the Kyoto Encyclopedia of Genes and Genomes pathway (KEGG) database. Protein-protein interactions (PPI) network was constructed by STRING and Cytoscape. Furthermore, in the Hypoxia/Reoxygenation (H/R) model, the morphological changes of cells were observed under microscope and the expression of the hub genes in NRK-49F cells were validated by qRT-PCR assays.\nRESULTS: A total of 457 DEGs were identified. Among these, 215 DEGs were upregulated and 242 DEGs were downregulated in the acute injured samples compared with uninjured samples. The GO enrichment analysis indicated that these DEGs were mainly involved in transport, the oxidation-reduction process, the metabolic process, metal ion binding, hydrolase activity, and oxidoreductase activity. The KEGG analysis revealed that these DEGs were significantly enriched in the PI3K-Akt signaling pathway, protein digestion and absorption pathway, and focal adhesion pathway. The hub genes including Hnf4α, Pck1 and Timp1 were validated by the qRT-PCR assay in NRK-49F cells in the H/R model.\nCONCLUSIONS: Hnf4α, Pck1 and Timp-1 may play a pivotal role in the early activation of fibroblasts, providing novel therapeutic strategies for early prediction and treatment of renal fibrosis.", "claims": [{"id": "claim-method", "statement": "The differences of cell count in captured pictures and the qRT-PCR results were analyzed by Student’s t-test.", "kind": "methodological", "target": null, "evidence": [{"asset": "source:pmid:33777519", "locator": "sections[10] \"Statistical analysis\" paragraph 2", "quote": "The differences of cell count in captured pictures and the qRT-PCR results were analyzed by Student’s t-test."}], "state": "complete"}, {"id": "claim-data-access", "statement": "Data are available at NCBI GEO: GSE62732, GSE121190.", "kind": "methodological", "target": null, "evidence": [{"asset": "source:pmid:33777519", "locator": "sections[25] \"Data Availability\" paragraph 2", "quote": "Data are available at NCBI GEO: GSE62732, GSE121190."}], "state": "complete"}], "gaps": []}, "experiment": {"state": "partial", "objective": null, "steps": [{"id": "read_published_estimate", "order": 1, "name": "Read the published estimate from the source", "kind": "other", "state": "complete", "blocked_on": null, "description": "The claim, method and evidence span published with the source article.", "duration_hours": null, "parameters": {}, "inputs": ["source:pmid:33777519"], "outputs": ["the published estimate and its evidence"], "instruments": [], "reagents": []}, {"id": "obtain_source_data", "order": 2, "name": "Obtain the source data from the named repository", "kind": "data-preparation", "state": "complete", "blocked_on": null, "description": "The GEO series accession resolves and its sample accessions are listed. This lane did not download the dataset or read its licence.", "duration_hours": null, "parameters": {}, "inputs": ["data:geo:GSE121190"], "outputs": ["the source data with its repository provenance"], "instruments": [], "reagents": []}, {"id": "run_analysis", "order": 3, "name": "Run the published analysis", "kind": "analysis", "state": "blocked", "blocked_on": "method:student_t", "description": "Apply the paper's statistical method to the resolved series and compare the result with the published target.", "duration_hours": null, "parameters": {}, "inputs": ["data:geo:GSE121190"], "outputs": ["the replicated result and its comparison"], "instruments": [], "reagents": []}], "materials": [], "instruments": [], "reagents": [], "conditions": {}, "gaps": ["step:run_analysis blocked on method:student_t"]}, "data": {"state": "partial", "assets": [{"id": "source:pmid:33777519", "role": "manuscript", "format": "xml", "media_type": "application/xml", "uri": "https://doi.org/10.7717/peerj.10926", "sha256": "sha256:bf0d4c6440f15408d566025445d1587b47c7ce9992a06da6e2d00ada1275b2fc", "bytes": 45139, "access": "open", "state": "resolved", "reader": null, "reader_status": "reader_required", "identifier": "10.7717/peerj.10926", "version": null, "note": "Full article fetched from PMC; the checksum covers the rendered section body, not the original XML bytes.", "structure": {"pmcid": "PMC7982076", "source": "europe_pmc_fulltext", "coverage": "whole_body", "text_hash_scope": "rendered_section_body"}}, {"id": "data:geo:GSE121190", "role": "raw", "format": "geo-series", "media_type": "application/vnd.ncbi.geo-series+json", "uri": "https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE121190", "sha256": null, "bytes": null, "access": "open", "state": "resolved", "reader": null, "reader_status": "reader_required", "identifier": "GSE121190", "version": null, "note": "Data are available at NCBI GEO: GSE62732, GSE121190.", "structure": {"repository": "GEO", "access_route": "GEO accession URL", "access_statement_verbatim": "Data are available at NCBI GEO: GSE62732, GSE121190.", "access_statement_kind": "data_availability_statement", "sample_accessions": ["GSM3427561", "GSM3427562", "GSM3427563", "GSM3427564", "GSM3427565", "GSM3427566", "GSM3427567", "GSM3427568", "GSM3427569", "GSM3427570", "GSM3427571", "GSM3427572", "GSM3427573", "GSM3427574", "GSM3427575"], "sample_count": 15, "group_sizes": null, "group_sizes_basis": null, "platform": "11180", "taxon": "Mus musculus", "title": "Expression Profiling of Fibroblasts in Chronic and Acute Disease Models", "resolution_checked_at": "2026-11-01T15:39:54Z", "resolution_check": "identifier_resolution_only_no_download_no_licence_read", "downloaded": false, "licence_read": false}}, {"id": "data:geo:GSE62732", "role": "raw", "format": "geo-series", "media_type": "application/vnd.ncbi.geo-series+json", "uri": "https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE62732", "sha256": null, "bytes": null, "access": "open", "state": "resolved", "reader": null, "reader_status": "reader_required", "identifier": "GSE62732", "version": null, "note": "Data are available at NCBI GEO: GSE62732, GSE121190.", "structure": {"repository": "GEO", "access_route": "GEO accession URL", "access_statement_verbatim": "Data are available at NCBI GEO: GSE62732, GSE121190.", "access_statement_kind": "data_availability_statement", "sample_accessions": ["GSM1532545", "GSM1532546", "GSM1532547", "GSM1532548", "GSM1532549", "GSM1532550", "GSM1532551", "GSM1532552"], "sample_count": 8, "group_sizes": null, "group_sizes_basis": null, "platform": "1261", "taxon": "Mus musculus", "title": "Gene Expression Profiling of Fibroblasts in Actute Kidney Injury", "resolution_checked_at": "2026-11-01T15:39:55Z", "resolution_check": "identifier_resolution_only_no_download_no_licence_read", "downloaded": false, "licence_read": false}}, {"id": "asset:table:pmid:33777519:1", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:f52b1e318b5c4f63541d80d9081ae05aebd3c746f45492afacb05492a2eeb1ca", "bytes": 894, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[9]/table-wrap[1]#table-1", "version": null, "note": "Primers used for the study.", "structure": {"pmcid": "PMC7982076", "section_index": 9, "section_title": "Validation of hub genes by qRT-PCR", "row_count": 13, "column_count": 3}, "table": {"label": "Table 1", "caption": "Primers used for the study.", "rows": [["Gene", "Forward primer", "Reverse primer"], ["α-SMA", "CTATGAGCTGCCTGACGGG", "GCTGTTGTAGGTGGTCTCATGG"], ["Timp1", "GGTTCCCTGGCATAATCTGA", "ATGGCTGAACAGGGAAACAC"], ["Hgd", "GCCCCTACAATCTCTACGCT", "TTGTGGTTGATGTGGCCTTG"], ["Pipox", "CTCTCCAGACCCTTCGGATC", "GCATGGGAAAGCTTGTGACA"], ["Slc2a2", "AGTCACACCAGCACATACGA", "TGGCTTTGATCCTTCCGAGT"], ["Myc", "ATCCTGTCCGTTCAAGCAGA", "TGTTTCAACTGTTCTCGCCG"], ["Spp2", "AGGGACAGGTGAAGGATGTG", "TTCTTCGTCGGTGGGATCTT"], ["Vcan", "GGGAAGGTTTTGTGCCAGAG", "GGCTTTCCTGAGAGAGTGGT"], ["Hao2", "TGCTCTGAGAGAAGTGGTGG", "CATCAGTGCCAGTTCGAACC"], ["Hnf4α", "TACTTGGTCATGGTCAGTGT", "GACCCTGTGAGGGCATAAGG"], ["Pck1", "TGGGAACTCACTGCTTGGGA", "AGTTATGCCCAGGATCAGCAT"], ["β-actin", "CGCGAGTACAACCTTCTTGC", "CGTCATCCATGGCGAACTGG"]], "row_count": 13, "column_count": 3, "numeric_cells": 0, "header_rows": 1, "locator": "section[9]/table-wrap[1]#table-1"}}], "gaps": ["asset:data:geo:GSE121190 not downloaded", "asset:data:geo:GSE121190 licence not read", "asset:data:geo:GSE62732 not downloaded", "asset:data:geo:GSE62732 licence not read"]}, "analysis": {"state": "partial", "methods": [{"id": "method-1", "family": "group_comparison", "specific": "student_t_test", "label": "Group comparison", "dsl_operations": [], "missing_operations": ["student_t"], "expressible": false, "parameters": {}, "data_shapes": ["two_or_more_groups_continuous"], "evidence": {"score": 1.0, "band": "verbatim", "quote": "The differences of cell count in captured pictures and the qRT-PCR results were analyzed by Student’s t-test."}}, {"id": "method-2", "family": "principal_component_analysis", "specific": "pca", "label": "Principal component analysis", "dsl_operations": ["pca_fit"], "missing_operations": [], "expressible": true, "parameters": {}, "data_shapes": ["wide_numeric_matrix"], "evidence": {"score": 0.7, "band": "medium", "quote": "Principal component analysis"}}, {"id": "method-3", "family": "differential_expression", "specific": "limma_voom", "label": "Differential expression analysis", "dsl_operations": ["normalise_counts", "differential_expression_fit", "fdr_bh"], "missing_operations": [], "expressible": true, "parameters": {}, "data_shapes": ["count_matrix_with_condition"], "evidence": {"score": 0.7, "band": "medium", "quote": "Limma"}}, {"id": "method-4", "family": "network_analysis", "specific": "ppi_network", "label": "Network / pathway analysis", "dsl_operations": ["build_graph", "centrality_scores", "pathway_enrich"], "missing_operations": [], "expressible": true, "parameters": {}, "data_shapes": ["edge_list"], "evidence": {"score": 0.7, "band": "medium", "quote": "PPI"}}, {"id": "method-5", "family": "network_analysis", "specific": "pathway_enrichment", "label": "Network / pathway analysis", "dsl_operations": ["pathway_enrich"], "missing_operations": [], "expressible": true, "parameters": {}, "data_shapes": ["edge_list"], "evidence": {"score": 0.7, "band": "medium", "quote": "GO enrichment"}}], "targets": [], "gaps": ["method.reader_differs_from_extractor", "method.student_t"]}, "capability": {"state": "complete", "requirements": [{"capability_id": "capability:computational_analysis", "label": "Computational analysis platform", "assay_families": ["meta_analysis", "machine_learning", "survival_analysis", "statistical_regression", "pca", "molecular_docking", "network_analysis", "differential_expression", "gwas"], "availability_state": "owned", "tier_unlocked": "R1", "candidate": "Automated Assays Laravel application and simulated adapters"}], "gaps": []}, "readiness": {"state": "complete", "tier": "R1", "blocking_axis": "none", "blocked_on": "nothing:replicable_now", "axes": {"method": {"tier": "R1", "expressible": false, "required_operations": [], "missing_operations": ["student_t"], "basis": "The paper names the method it used and the corpus's method extractor maps it onto the DSL catalogue: student_t_test."}, "capability": {"tier": "R1", "capability_id": "capability:computational_analysis", "availability_state": "owned", "basis": "The computational analysis is owned. The physical bench the paper used is not, so a physical validation cannot be run here."}, "data": {"tier": "R1", "reachable": true, "accessions": ["GSE62732", "GSE121190"], "resolved_accessions": ["GSE62732", "GSE121190"], "statements": ["Data are available at NCBI GEO: GSE62732, GSE121190."], "basis": "The paper names GSE62732, GSE121190 in NCBI Gene Expression Omnibus (GEO) and the accession resolves in the repository. No dataset was downloaded and no licence was read."}}, "can_run": {"dsl_operations": [], "assets": ["source:pmid:33777519", "data:geo:GSE121190", "asset:table:pmid:33777519:1"], "steps": []}, "must_build": {"dsl_operations": [{"operation": "student_t", "unlocks_papers": null, "priority": null}], "converters": [], "readers": [], "capabilities": [], "data_gaps": ["data:geo:GSE121190"]}, "gaps": []}, "review": {"state": "partial", "machine_critique": {"kind": "extraction_review", "reader": {"model": "MiniMax-M3.1-Flash", "provider": "minimax", "provider_family": "minimax", "read_at": "2026-10-31T18:28:32Z", "independence": "single_reader"}, "evidence_check": {"method": "verbatim", "availability": "verbatim"}, "calls": 3, "usage": {"prompt_tokens": 36778, "completion_tokens": 1351, "cached_tokens": 528}}, "human_critique": null, "stages": [{"id": "extraction", "state": "complete", "reader": "MiniMax-M3.1-Flash", "provider": "minimax"}], "gaps": ["review.independent_reader", "review.machine_critique", "review.human_critique"]}, "execution": {"state": "absent", "status": "not_run", "mode": null, "runs": [], "gaps": ["execution.not_run"]}, "provenance": {"entities": [{"id": "pmid:33777519", "type": "paper", "label": "pmid:33777519"}, {"id": "source:pmid:33777519", "type": "manuscript", "label": "PMID 33777519 full text"}, {"id": "data:geo:GSE121190", "type": "dataset", "label": "GEO GSE121190"}], "activities": [{"id": "activity-reading-sci-2026-11-01", "type": "classification", "used": [{"id": "pmid:33777519", "type": "paper", "label": "pmid:33777519"}, {"id": "source:pmid:33777519", "type": "manuscript", "label": "PMID 33777519 full text"}, {"id": "data:geo:GSE121190", "type": "dataset", "label": "GEO GSE121190"}], "agent": "agent:corpus-assay-engine"}, {"id": "activity-read-33777519", "type": "extraction", "used": ["source:pmid:33777519"], "agent": "agent:minimax-reader"}, {"id": "activity-resolve-GSE121190", "type": "accession_resolution", "used": ["data:geo:GSE121190"], "agent": "agent:corpus-assay-engine"}], "agents": [{"id": "agent:corpus-assay-engine", "type": "software", "label": "Corpus assay engine"}, {"id": "agent:minimax-reader", "type": "software", "label": "MiniMax literature reader"}], "source_run_id": "reading-sci-2026-11-01", "dsl_catalogue_fingerprint": "343fb30756ba6ec3", "capability_table_fingerprint": "2cb3e42f047d2ecf", "snapshot_id": "ba34b49490d9bfaf"}, "lineage": {"parent_id": "pmid:33777519", "parent_hash": "sha256:7ce3c7f20e6fa01b51bddbc1056fdd02ee7e8322ea575146089531a417f1d978", "fork_of": null, "generation": 6}, "gaps": ["asset:data:geo:GSE121190 licence not read", "asset:data:geo:GSE121190 not downloaded", "asset:data:geo:GSE62732 licence not read", "asset:data:geo:GSE62732 not downloaded", "execution.not_run", "method.reader_differs_from_extractor", "method.student_t", "review.human_critique", "review.independent_reader", "review.machine_critique", "step:run_analysis blocked on method:student_t"], "assays": [{"role": "data_generation", "definition_id": "animal_model", "definition_version": "99e1195c7d6f", "definition_digest": null, "required_operations": [], "support_state": "partial", "source_hashes": {"assay_lexicon": "99e1195c7d6f"}, "confidence": 0.882, "evidence": ["and pathways on fibroblast activation in two mouse models of AKI: ischemia-reperfusion injury (", "tion-associated DEGs through the analysis of rat renal fibroblasts Every DEG analyzed with Cy"], "order_basis": "paper_text_order:408", "id": "assay:1"}, {"role": "data_generation", "definition_id": "microarray", "definition_version": "99e1195c7d6f", "definition_digest": null, "required_operations": [], "support_state": "partial", "source_hashes": {"assay_lexicon": "99e1195c7d6f"}, "confidence": 0.93, "evidence": ["acid (FA)-induced injury model. METHODS: The microarray expression profiles of GSE62732 and GSE12119"], "order_basis": "paper_text_order:524", "id": "assay:2"}, {"role": "data_generation", "definition_id": "cell_culture", "definition_version": "99e1195c7d6f", "definition_digest": null, "required_operations": [], "support_state": "partial", "source_hashes": {"assay_lexicon": "99e1195c7d6f"}, "confidence": 0.99, "evidence": ["5% air) for 6 h, while the control group was cultured in an ordinary cell incubator. Statistical anal", "5% air) for 6 h, while the control group was cultured in an ordinary cell incubator. Statistical a"], "order_basis": "paper_text_order:3390", "id": "assay:3"}, {"role": "analysis", "definition_id": "group_comparison", "definition_version": "f2132e96ae6c7a4e", "definition_digest": null, "required_operations": [], "support_state": "partial", "source_hashes": {"dsl_catalogue": "f2132e96ae6c7a4e"}, "confidence": 1.0, "evidence": ["The differences of cell count in captured pictures and the qRT-PCR results were analyzed by Student’s t-test."], "order_basis": "consumes_earlier_output", "id": "assay:4"}]}