Circular RNA_0000629 Suppresses Bladder Cancer Progression Mediating MicroRNA-1290/CDC73.

{"sci_version": "1.2", "schema": "https://corpus.bntrg.co.uk/sci/1.0/sci.schema.json", "id": "pmid:33790645", "kind": "science-record", "revision": 8, "content_hash": "sha256:f8426ae31f5ec427dfd773b9ecf1f621add0e96281d6ec4d98966e3ab9a03a1f", "created_at": "2026-11-01T15:41:31Z", "updated_at": "2026-11-01T22:46:25Z", "generator": {"name": "corpus-assay-engine", "run_id": "reading-sci-2026-11-01"}, "paper": {"state": "complete", "title": "Circular RNA_0000629 Suppresses Bladder Cancer Progression Mediating MicroRNA-1290/CDC73.", "doi": "10.2147/CMAR.S292863", "pmid": "33790645", "authors": ["Jiansong Wang", "Jianjun Luo", "Xuecheng Wu", "Zhiyong Gao"], "journal": "Cancer management and research", "year": 2021, "abstract": "BACKGROUND: Recent studies showed circular RNAs (circRNAs) played regulatory roles in bladder cancer (BC). However, the relevance of circ_0000629, a newly identified circRNA, has not been determined yet. We aimed to characterize the function of circ_0000629 in BC and the relevant mechanism.\nMETHODS: First, we downloaded circRNA-related microarrays GSE147985 and GSE92675 from the GEO database, followed by a validation in our clinically obtained samples. We then overexpressed circ_0000629 in T24 and SW780 cells and evaluated the effects of circ_0000629 on BC cell proliferatory, apoptotic, and metastatic abilities. We further detected the subcellular localization of circ_0000629 in T24 and SW780 cells by the fractionation and export assay and FISH experiments. Integrated microarray analyses and bioinformatics website prediction were utilized to screen out the downstream microRNA (miRNA)/mRNA. The effects of miR-1290 and CDC73 on BC cell growth and metastasis was verified by functional rescue experiments. In addition, mice xenografts were built to measure the effect of circ_0000629 on tumor growth in vivo.\nRESULTS: Circ_0000629 and CDC73 were reduced, and miR-1290 was significantly overexpressed in BC tissues and cells. Moreover, circ_0000629 significantly inhibited the development and metastasis of BC cells, but further overexpression of miR-1290 or knockdown of CDC73 attenuated the inhibitory effect of circ_0000629 on BC cells. Circ_0000629 localized in the cytoplasm and regulated CDC73 expression by sponging miR-1290. Further, overexpressed circ_0000629 reduced the BC tumor growth in vivo.\nCONCLUSION: Circ_0000629 promotes the expression of CDC73 by competitively binding to miR-1290, thereby inhibiting the growth and metastasis of BC cells.", "claims": [{"id": "claim-method", "statement": "Date are mean ± SD, n = 3. **p < 0.01 (two-way ANOVA and Tukey’s multiple comparison test).", "kind": "methodological", "target": null, "evidence": [{"asset": "source:pmid:33790645", "locator": "sections[22] \"Overexpression of CircRNA_0000629 Inhibits Aggressiveness of BC Cells in vitro\" paragraph 2", "quote": "Date are mean ± SD, n = 3. **p < 0.01 (two-way ANOVA and Tukey’s multiple comparison test)."}], "state": "complete"}, {"id": "claim-data-access", "statement": "All the data generated or analyzed during this study are included in this published article.", "kind": "methodological", "target": null, "evidence": [{"asset": "source:pmid:33790645", "locator": "sections[31] \"Data Sharing Statement\" paragraph 2", "quote": "All the data generated or analyzed during this study are included in this published article."}], "state": "complete"}], "gaps": []}, "experiment": {"state": "partial", "objective": null, "steps": [{"id": "read_published_estimate", "order": 1, "name": "Read the published estimate from the source", "kind": "other", "state": "complete", "blocked_on": null, "description": "The claim, method and evidence span published with the source article.", "duration_hours": null, "parameters": {}, "inputs": ["source:pmid:33790645"], "outputs": ["the published estimate and its evidence"], "instruments": [], "reagents": []}, {"id": "obtain_source_data", "order": 2, "name": "Obtain the source data from the named repository", "kind": "data-preparation", "state": "blocked", "blocked_on": "data:accession_absent", "description": "The GEO series accession resolves and its sample accessions are listed. This lane did not download the dataset or read its licence.", "duration_hours": null, "parameters": {}, "inputs": [], "outputs": ["the source data with its repository provenance"], "instruments": [], "reagents": []}, {"id": "run_analysis", "order": 3, "name": "Run the published analysis", "kind": "analysis", "state": "complete", "blocked_on": null, "description": "Apply the paper's statistical method to the resolved series and compare the result with the published target.", "duration_hours": null, "parameters": {}, "inputs": [], "outputs": ["the replicated result and its comparison"], "instruments": [], "reagents": []}], "materials": [], "instruments": [], "reagents": [], "conditions": {}, "gaps": ["step:obtain_source_data blocked on data:accession_absent"]}, "data": {"state": "partial", "assets": [{"id": "source:pmid:33790645", "role": "manuscript", "format": "xml", "media_type": "application/xml", "uri": "https://doi.org/10.2147/CMAR.S292863", "sha256": "sha256:d11ddfdc3e694c0f2487fda3b9d1c47afc53edcb6c2d56e90d6c9c02dc036185", "bytes": 38840, "access": "open", "state": "resolved", "reader": null, "reader_status": "reader_required", "identifier": "10.2147/CMAR.S292863", "version": null, "note": "Full article fetched from PMC; the checksum covers the rendered section body, not the original XML bytes.", "structure": {"pmcid": "PMC7997432", "source": "europe_pmc_fulltext", "coverage": "whole_body_without_references", "text_hash_scope": "rendered_section_body"}}, {"id": "asset:table:pmid:33790645:1", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:ed0114a7b0ae9a0f960d730f5bfe41c77b0fa1a9b4a850831d9a04fff7166a47", "bytes": 502, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[5]/table-wrap[1]#t0001", "version": null, "note": "Primers", "structure": {"pmcid": "PMC7997432", "section_index": 5, "section_title": "Real-Time Quantitative PCR (RT-qPCR)", "row_count": 6, "column_count": 3}, "table": {"label": "Table 1", "caption": "Primers", "rows": [["Targets", "Forward (5ʹ-3ʹ)", "Reverse (5ʹ-3ʹ)"], ["Circ_0000629", "CAGTTGATGTCCTCTGCCAGTG", "AGAGCACCTCTGTGGCATTCTC"], ["CDC73", "GAGAGAGTATGGAGGACACGAAC", "ATTTGGGGCAGGTCGCTGTTCA"], ["GAPDH", "GTCTCCTCTGACTTCAACAGCG", "ACCACCCTGTTGCTGTAGCCAA"], ["miR-1290", "TGGATTTTTGGATCAGGG", "GAACATGTCTGCGTATCTC"], ["U6", "CTCGCTTCGGCAGCACAT", "TTTGCGTGTCATCCTTGCG"]], "row_count": 6, "column_count": 3, "numeric_cells": 5, "header_rows": 1, "locator": "section[5]/table-wrap[1]#t0001"}}], "gaps": []}, "analysis": {"state": "complete", "methods": [{"id": "method-1", "family": "group_comparison", "specific": "anova", "label": "Group comparison", "dsl_operations": ["group_summary", "welch_t", "bootstrap_mean_difference", "group_comparison_anova"], "missing_operations": [], "expressible": true, "parameters": {}, "data_shapes": ["two_or_more_groups_continuous"], "evidence": {"score": 1.0, "band": "verbatim", "quote": "Date are mean ± SD, n = 3. **p < 0.01 (two-way ANOVA and Tukey’s multiple comparison test)."}}], "targets": [], "gaps": []}, "capability": {"state": "complete", "requirements": [{"capability_id": "capability:computational_analysis", "label": "Computational analysis platform", "assay_families": ["meta_analysis", "machine_learning", "survival_analysis", "statistical_regression", "pca", "molecular_docking", "network_analysis", "differential_expression", "gwas"], "availability_state": "owned", "tier_unlocked": "R1", "candidate": "Automated Assays Laravel application and simulated adapters"}], "gaps": []}, "readiness": {"state": "blocked", "tier": "R4", "blocking_axis": "data", "blocked_on": "data:accession_absent", "axes": {"method": {"tier": "R1", "expressible": true, "required_operations": ["group_summary", "welch_t", "bootstrap_mean_difference", "group_comparison_anova"], "missing_operations": [], "basis": "The paper names the method it used and the corpus's method extractor maps it onto the DSL catalogue: anova."}, "capability": {"tier": "R1", "capability_id": "capability:computational_analysis", "availability_state": "owned", "basis": "The computational analysis is owned. The physical bench the paper used is not, so a physical validation cannot be run here."}, "data": {"tier": "R4", "reachable": false, "accessions": [], "resolved_accessions": [], "statements": ["All the data generated or analyzed during this study are included in this published article."], "basis": "The paper names no accession to its source data, so the data has to come from the authors."}}, "can_run": {"dsl_operations": ["group_summary", "welch_t", "bootstrap_mean_difference", "group_comparison_anova"], "assets": ["source:pmid:33790645", "asset:table:pmid:33790645:1"], "steps": ["run_analysis"]}, "must_build": {"dsl_operations": [], "converters": [], "readers": [], "capabilities": [], "data_gaps": ["data:geo:None"]}, "gaps": ["data:accession_absent"]}, "review": {"state": "partial", "machine_critique": {"kind": "extraction_review", "reader": {"model": "MiniMax-M3.1-Flash", "provider": "minimax", "provider_family": "minimax", "read_at": "2026-10-31T19:29:57Z", "independence": "single_reader"}, "evidence_check": {"method": "verbatim", "availability": "verbatim"}, "calls": 3, "usage": {"prompt_tokens": 31157, "completion_tokens": 1513, "cached_tokens": 784}}, "human_critique": null, "stages": [{"id": "extraction", "state": "complete", "reader": "MiniMax-M3.1-Flash", "provider": "minimax"}], "gaps": ["review.independent_reader", "review.machine_critique", "review.human_critique"]}, "execution": {"state": "absent", "status": "not_run", "mode": null, "runs": [], "gaps": ["execution.not_run"]}, "provenance": {"entities": [{"id": "pmid:33790645", "type": "paper", "label": "pmid:33790645"}, {"id": "source:pmid:33790645", "type": "manuscript", "label": "PMID 33790645 full text"}, {"id": "data:geo:None", "type": "dataset", "label": "GEO None"}], "activities": [{"id": "activity-reading-sci-2026-11-01", "type": "classification", "used": [{"id": "pmid:33790645", "type": "paper", "label": "pmid:33790645"}, {"id": "source:pmid:33790645", "type": "manuscript", "label": "PMID 33790645 full text"}, {"id": "data:geo:None", "type": "dataset", "label": "GEO None"}], "agent": "agent:corpus-assay-engine"}, {"id": "activity-read-33790645", "type": "extraction", "used": ["source:pmid:33790645"], "agent": "agent:minimax-reader"}, {"id": "activity-resolve-None", "type": "accession_resolution", "used": ["data:geo:None"], "agent": "agent:corpus-assay-engine"}], "agents": [{"id": "agent:corpus-assay-engine", "type": "software", "label": "Corpus assay engine"}, {"id": "agent:minimax-reader", "type": "software", "label": "MiniMax literature reader"}], "source_run_id": "reading-sci-2026-11-01", "dsl_catalogue_fingerprint": "343fb30756ba6ec3", "capability_table_fingerprint": "2cb3e42f047d2ecf", "snapshot_id": "ba34b49490d9bfaf"}, "lineage": {"parent_id": "pmid:33790645", "parent_hash": "sha256:9e797ec0b824c11179ca0bf2e3132c59172211e88ef0f18bdcb876880e2a02ba", "fork_of": null, "generation": 7}, "gaps": ["execution.not_run", "review.human_critique", "review.independent_reader", "review.machine_critique", "step:obtain_source_data blocked on data:accession_absent"], "assays": [{"role": "data_generation", "definition_id": "microarray", "definition_version": "99e1195c7d6f", "definition_digest": null, "required_operations": [], "support_state": "partial", "source_hashes": {"assay_lexicon": "99e1195c7d6f"}, "confidence": 0.93, "evidence": ["xport assay and FISH experiments. Integrated microarray analyses and bioinformatics website predicti"], "order_basis": "paper_text_order:824", "id": "assay:1"}, {"role": "data_generation", "definition_id": "animal_model", "definition_version": "99e1195c7d6f", "definition_digest": null, "required_operations": [], "support_state": "partial", "source_hashes": {"assay_lexicon": "99e1195c7d6f"}, "confidence": 0.99, "evidence": ["e the effect of circ_0000629 on tumor growth in vivo. RESULTS: Circ_0000629 and CDC73 were reduce", "sed circ_0000629 reduced the BC tumor growth in vivo. CONCLUSION: Circ_0000629 promotes the expre"], "order_basis": "paper_text_order:1156", "id": "assay:2"}, {"role": "data_generation", "definition_id": "transfection", "definition_version": "99e1195c7d6f", "definition_digest": null, "required_operations": [], "support_state": "partial", "source_hashes": {"assay_lexicon": "99e1195c7d6f"}, "confidence": 0.85, "evidence": ["s, but further overexpression of miR-1290 or knockdown of CDC73 attenuated the inhibitory effect of"], "order_basis": "paper_text_order:1414", "id": "assay:3"}, {"role": "analysis", "definition_id": "group_comparison", "definition_version": "f2132e96ae6c7a4e", "definition_digest": null, "required_operations": ["group_summary", "welch_t", "bootstrap_mean_difference", "group_comparison_anova"], "support_state": "supported", "source_hashes": {"dsl_catalogue": "f2132e96ae6c7a4e"}, "confidence": 1.0, "evidence": ["Date are mean ± SD, n = 3. **p < 0.01 (two-way ANOVA and Tukey’s multiple comparison test)."], "order_basis": "consumes_earlier_output", "id": "assay:4"}]}