Identification and validation of key non-coding RNAs and mRNAs using co-expression network analysis in pre-eclampsia.

{"sci_version": "1.2", "schema": "https://corpus.bntrg.co.uk/sci/1.0/sci.schema.json", "id": "pmid:33832098", "kind": "science-record", "revision": 9, "content_hash": "sha256:6024ca5d9708a0a2ac771b71ceed3951011f9ec54537cbf948230c0746675d83", "created_at": "2026-11-01T15:41:31Z", "updated_at": "2026-11-01T22:46:29Z", "generator": {"name": "corpus-assay-engine", "run_id": "reading-sci-2026-11-01"}, "paper": {"state": "complete", "title": "Identification and validation of key non-coding RNAs and mRNAs using co-expression network analysis in pre-eclampsia.", "doi": "10.1097/MD.0000000000025294", "pmid": "33832098", "authors": ["Jing He", "Kang Liu", "Xiaohong Hou", "Jieqiang Lu"], "journal": "Medicine", "year": 2021, "abstract": "ABSTRACT: Pre-eclampsia (PE) is a common complication of pregnancy, associated with maternal and fetal morbidity and mortality. In this study, we aimed to explore important long non-coding RNAs (lncRNAs) and their possible mechanisms in PE.GSE60438 expression profile including 25 PE samples and 23 normal samples were obtained from gene expression omnibus (GEO) database. After normalization with betaqn package in R, differentially expressed lncRNAs (DElncRNAs) and mRNAs (DEmRNAs) were identified using the limma package. Gene Ontology (GO) and Kyoto encyclopedia of genes and genomes (KEGG) pathway were analyzed using DAVID 6.7 and GSEA 3.0. LncRNAs-mRNAs coexpression was implemented using weighted gene co-expression network analysis (WGCNA). MicroRNAs linked with these DElncRNAs and DEmRNAs were predicted and a competitive endogenous RNA (ceRNA) network was built.A total of 53 DElncRNAs and 301 DEmRNAs were identified between control and PE samples. These DEmRNAs were enriched into pathways such as protein digestion and absorption, osteoclast differentiation. WGCNA constructed a lncRNA-mRNA coexpression network, among which SUMO1P3, NACAP1, NCF1C, ANXA2P1, GTF2IP1, NAPSB, OR7E37P were hub genes. ceRNA network was constructed together with microRNAs (miRNAs), and functional analysis indicated cellular membrane and sugar binding were involved in PE progression. Five lncRNAsANXA2P1, GTF2IP1, NACAP1, NCF1C and OR7E37P were successfully validated in our clinical specimens.The DElncRNAs, including ANXA2P1, GTF2IP1, NACAP1, NCF1C and OR7E37P might play important roles in PE. However, the exact mechanism of these lncRNAs in prediction and diagnosis of PE should be further explored.", "claims": [{"id": "claim-method", "statement": "Further, differential gene expression analysis was implemented using the limma package (version 3.10.3) in R. The resulting P value was adjusted using Benjamini & Hochberg method.", "kind": "methodological", "target": null, "evidence": [{"asset": "source:pmid:33832098", "locator": "sections[4] \"Identification of DEGs\" paragraph 2", "quote": "Further, differential gene expression analysis was implemented using the limma package (version 3.10.3) in R. The resulting P value was adjusted using Benjamini & Hochberg method."}], "state": "complete"}, {"id": "claim-data-access", "statement": "The raw data of expression profile of GSE60438 based on platforms of GPL6884 and GPL10558 were obtained from the gene expression omnibus (GEO) database (https://www.ncbi.nlm.nih.gov/geo/). This dataset included genome-wide transcriptome sequencing data on 65 normotensive and 60 PE patients and was contributed by Yong et al.[14] The sequencing data based on the platform of GPL6884, which included 48 samples from 25 PE samples and 23 normal samples, were extracted for further analysis.", "kind": "methodological", "target": null, "evidence": [{"asset": "source:pmid:33832098", "locator": "sections[3] \"Data source\" paragraph 2", "quote": "The raw data of expression profile of GSE60438 based on platforms of GPL6884 and GPL10558 were obtained from the gene expression omnibus (GEO) database (https://www.ncbi.nlm.nih.gov/geo/). This dataset included genome-wide transcriptome sequencing data on 65 normotensive and 60 PE patients and was contributed by Yong et al.[14] The sequencing data based on the platform of GPL6884, which included 48 samples from 25 PE samples and 23 normal samples, were extracted for further analysis."}], "state": "complete"}], "gaps": []}, "experiment": {"state": "complete", "objective": null, "steps": [{"id": "read_published_estimate", "order": 1, "name": "Read the published estimate from the source", "kind": "other", "state": "complete", "blocked_on": null, "description": "The claim, method and evidence span published with the source article.", "duration_hours": null, "parameters": {}, "inputs": ["source:pmid:33832098"], "outputs": ["the published estimate and its evidence"], "instruments": [], "reagents": []}, {"id": "obtain_source_data", "order": 2, "name": "Obtain the source data from the named repository", "kind": "data-preparation", "state": "complete", "blocked_on": null, "description": "The GEO series accession resolves and its sample accessions are listed. This lane did not download the dataset or read its licence.", "duration_hours": null, "parameters": {}, "inputs": ["data:geo:GSE60438"], "outputs": ["the source data with its repository provenance"], "instruments": [], "reagents": []}, {"id": "run_analysis", "order": 3, "name": "Run the published analysis", "kind": "analysis", "state": "complete", "blocked_on": null, "description": "Apply the paper's statistical method to the resolved series and compare the result with the published target.", "duration_hours": null, "parameters": {}, "inputs": ["data:geo:GSE60438"], "outputs": ["the replicated result and its comparison"], "instruments": [], "reagents": []}], "materials": [], "instruments": [], "reagents": [], "conditions": {}, "gaps": []}, "data": {"state": "partial", "assets": [{"id": "source:pmid:33832098", "role": "manuscript", "format": "xml", "media_type": "application/xml", "uri": "https://doi.org/10.1097/MD.0000000000025294", "sha256": "sha256:26d71d0569ebede6bbb9f675be5a6af11d7c00352a5fd8383b09db92b125e956", "bytes": 33375, "access": "open", "state": "resolved", "reader": null, "reader_status": "reader_required", "identifier": "10.1097/MD.0000000000025294", "version": null, "note": "Full article fetched from PMC; the checksum covers the rendered section body, not the original XML bytes.", "structure": {"pmcid": "PMC8036074", "source": "europe_pmc_fulltext", "coverage": "whole_body", "text_hash_scope": "rendered_section_body"}}, {"id": "data:geo:GSE60438", "role": "raw", "format": "geo-series", "media_type": "application/vnd.ncbi.geo-series+json", "uri": "https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE60438", "sha256": null, "bytes": null, "access": "open", "state": "resolved", "reader": null, "reader_status": "reader_required", "identifier": "GSE60438", "version": null, "note": "The raw data of expression profile of GSE60438 based on platforms of GPL6884 and GPL10558 were obtained from the gene expression omnibus (GEO) database (https://www.ncbi.nlm.nih.gov/geo/). This dataset included genome-wide transcriptome sequencing data on 65 normotensive and 60 PE patients and was contributed by Yong et al.[14] The sequencing data based on the platform of GPL6884, which included 48 samples from 25 PE samples and 23 normal samples, were extracted for further analysis.", "structure": {"repository": "GEO", "access_route": "GEO accession URL", "access_statement_verbatim": "The raw data of expression profile of GSE60438 based on platforms of GPL6884 and GPL10558 were obtained from the gene expression omnibus (GEO) database (https://www.ncbi.nlm.nih.gov/geo/). This dataset included genome-wide transcriptome sequencing data on 65 normotensive and 60 PE patients and was contributed by Yong et al.[14] The sequencing data based on the platform of GPL6884, which included 48 samples from 25 PE samples and 23 normal samples, were extracted for further analysis.", "access_statement_kind": "repository_route_statement", "sample_accessions": ["GSM1480043", "GSM1480044", "GSM1480045", "GSM1480046", "GSM1480047", "GSM1480048", "GSM1480049", "GSM1480050", "GSM1480051", "GSM1480052", "GSM1480053", "GSM1480054", "GSM1480055", "GSM1480056", "GSM1480057", "GSM1480058", "GSM1480059", "GSM1480060", "GSM1480061", "GSM1480062", "GSM1480063", "GSM1480064", "GSM1480065", "GSM1480066", "GSM1480067", "GSM1480068", "GSM1480069", "GSM1480070", "GSM1480071", "GSM1480072", "GSM1480073", "GSM1480074", "GSM1480075", "GSM1480076", "GSM1480077", "GSM1480078", "GSM1480079", "GSM1480080", "GSM1480081", "GSM1480082", "GSM1480083", "GSM1480084", "GSM1480085", "GSM1480086", "GSM1480087", "GSM1480088", "GSM1480089", "GSM1480090", "GSM1480091", "GSM1480092", "GSM1480093", "GSM1480094", "GSM1480095", "GSM1480096", "GSM1480097", "GSM1480098", "GSM1480099", "GSM1480100", "GSM1480101", "GSM1480102", "GSM1480103", "GSM1480104", "GSM1480105", "GSM1480106", "GSM1480107", "GSM1480108", "GSM1480109", "GSM1480110", "GSM1480111", "GSM1480112", "GSM1480113", "GSM1480114", "GSM1480115", "GSM1480116", "GSM1480117", "GSM1480118", "GSM1480119", "GSM1480120", "GSM1480121", "GSM1480122", "GSM1480123", "GSM1480124", "GSM1480125", "GSM1480126", "GSM1480127", "GSM1480128", "GSM1480129", "GSM1480130", "GSM1480131", "GSM1480132", "GSM1480133", "GSM1480134", "GSM1480135", "GSM1480136", "GSM1480137", "GSM1480138", "GSM1480139", "GSM1480140", "GSM1480141", "GSM1480142", "GSM1480143", "GSM1480144", "GSM1480145", "GSM1480146", "GSM1480147", "GSM1480148", "GSM1480149", "GSM1480150", "GSM1480151", "GSM1480152", "GSM1480153", "GSM1480154", "GSM1480155", "GSM1480156", "GSM1480157", "GSM1480158", "GSM1480159", "GSM1480160", "GSM1480161", "GSM1480162", "GSM1480163", "GSM1480164", "GSM1480165", "GSM1480166", "GSM1480167"], "sample_count": 125, "group_sizes": null, "group_sizes_basis": null, "platform": "6884;10558", "taxon": "Homo sapiens", "title": "Transcriptome profiling of deciduas from pre-eclamptic and normotensive pregnancies", "resolution_checked_at": "2026-11-01T15:39:55Z", "resolution_check": "identifier_resolution_only_no_download_no_licence_read", "downloaded": false, "licence_read": false}}, {"id": "asset:table:pmid:33832098:1", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:f768834ce00cce01e6d9fa115b081bee2decf5507cc5bfd938f7cb227ea81793", "bytes": 667, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[14]/table-wrap[1]#T3", "version": null, "note": "The enriched GO term from ceRNA network.", "structure": {"pmcid": "PMC8036074", "section_index": 7, "section_title": "Construction and functional annotation of ceRNA network", "row_count": 9, "column_count": 4}, "table": {"label": "Table 3", "caption": "The enriched GO term from ceRNA network.", "rows": [["Category", "ID", "Description", "P value"], ["CC", "GO:0031224", "intrinsic to membrane", ".00153"], ["CC", "GO:0031226", "intrinsic to plasma membrane", ".006676"], ["CC", "GO:0005887", "integral to plasma membrane", ".026502"], ["CC", "GO:0031225", "anchored to membrane", ".041611"], ["CC", "GO:0016021", "integral to membrane", ".046561"], ["CC", "GO:0044421", "extracellular region part", ".049485"], ["MF", "GO:0005529", "sugar binding", ".002708"], ["MF", "GO:0030246", "carbohydrate binding", ".014083"]], "row_count": 9, "column_count": 4, "numeric_cells": 16, "header_rows": 1, "locator": "section[14]/table-wrap[1]#T3"}}, {"id": "asset:table:pmid:33832098:2", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:26ecaac12a32064c806840afa91397eaef39da5bfe703c936f8ceac5a58a1c47", "bytes": 944, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[8]/table-wrap[1]#T1", "version": null, "note": "The sequences of primers for qRT-PCR.", "structure": {"pmcid": "PMC8036074", "section_index": 8, "section_title": "Validation of hub lncRNAs in the ceRNA network by qRT-PCR", "row_count": 17, "column_count": 3}, "table": {"label": "Table 1", "caption": "The sequences of primers for qRT-PCR.", "rows": [["Gene", "Direction", "Sequence (5–3)"], ["SUMO1P3", "Forward", "ACTGGCACCCCATCTCTTTG"], ["SUMO1P3", "Reverse", "CATCAGGGCCAATTCGCAAG"], ["NACAP1", "Forward", "GCTGAGACAGGGTCTGGAAC"], ["NACAP1", "Reverse", "CTGGACTTGTGCGGTTACCT"], ["NCF1C", "Forward", "CAGTCATGGGGGACACCTTC"], ["NCF1C", "Reverse", "TCCTGCCATTTCACCAGGAA"], ["ANXA2P1", "Forward", "AATGGGCATGGGGACTCAAG"], ["ANXA2P1", "Reverse", "ATGGGGAGCACCATTTCTGG"], ["GTF2IP1", "Forward", "CGAAAGTTGAAAAAGCTGTCGC"], ["GTF2IP1", "Reverse", "ATGCCATCAACCACCACACA"], ["NAPSB", "Forward", "TCATCCAGTTTGCTCAGGGT"], ["NAPSB", "Reverse", "TCGAAGACGGTCACATACGC"], ["OR7E37P", "Forward", "ACAATGCTGGGTGTTGGTTTAC"], ["OR7E37P", "Reverse", "TTCTGTGGGTCTGTAGAGATTG"], ["GAPDH", "Forward", "TGACAACTTTGGTATCGTGGAAGG"], ["GAPDH", "Reverse", "AGGCAGGGATGATGTTCTGGAGAG"]], "row_count": 17, "column_count": 3, "numeric_cells": 3, "header_rows": 1, "locator": "section[8]/table-wrap[1]#T1"}}, {"id": "asset:table:pmid:33832098:3", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:32547ded412a1d8616836062a7682d9b70cee9ff0135aefb2cd7c729f1dad0f6", "bytes": 703, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[13]/table-wrap[1]#T2", "version": null, "note": "The correlation between clinical phenotype and WGCNA modules.", "structure": {"pmcid": "PMC8036074", "section_index": 13, "section_title": "WGCNA analysis of DEGs", "row_count": 7, "column_count": 6}, "table": {"label": "Table 2", "caption": "The correlation between clinical phenotype and WGCNA modules.", "rows": [["", "module", "disease", "age", "gestational age (weeks)", "infant weight (g)"], ["cor", "MEbrown", "0.4495985", "−0.163577", "−0.3600296", "−0.3853923"], ["", "MEturquoise", "−0.398738", "0.0218055", "0.3558121", "0.5037802"], ["", "MEblue", "−0.555048", "0.1298954", "0.4023702", "0.3802591"], ["P value", "MEbrown", "1.35E–03", "0.2665997", "0.011953145", "6.83E–03"], ["", "MEturquoise", "5.00E–03", "0.8830466", "0.013065607", "2.62E–04"], ["", "MEblue", "4.23E–05", "0.3788831", "0.004580631", "7.68E–03"]], "row_count": 7, "column_count": 6, "numeric_cells": 24, "header_rows": 1, "locator": "section[13]/table-wrap[1]#T2"}}, {"id": "asset:table:pmid:33832098:4", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:f768834ce00cce01e6d9fa115b081bee2decf5507cc5bfd938f7cb227ea81793", "bytes": 667, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[14]/table-wrap[1]#T3", "version": null, "note": "The enriched GO term from ceRNA network.", "structure": {"pmcid": "PMC8036074", "section_index": 14, "section_title": "Construction and functional annotation of ceRNA network", "row_count": 9, "column_count": 4}, "table": {"label": "Table 3", "caption": "The enriched GO term from ceRNA network.", "rows": [["Category", "ID", "Description", "P value"], ["CC", "GO:0031224", "intrinsic to membrane", ".00153"], ["CC", "GO:0031226", "intrinsic to plasma membrane", ".006676"], ["CC", "GO:0005887", "integral to plasma membrane", ".026502"], ["CC", "GO:0031225", "anchored to membrane", ".041611"], ["CC", "GO:0016021", "integral to membrane", ".046561"], ["CC", "GO:0044421", "extracellular region part", ".049485"], ["MF", "GO:0005529", "sugar binding", ".002708"], ["MF", "GO:0030246", "carbohydrate binding", ".014083"]], "row_count": 9, "column_count": 4, "numeric_cells": 16, "header_rows": 1, "locator": "section[14]/table-wrap[1]#T3"}}, {"id": "asset:table:pmid:33832098:5", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:26ecaac12a32064c806840afa91397eaef39da5bfe703c936f8ceac5a58a1c47", "bytes": 944, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[8]/table-wrap[1]#T1", "version": null, "note": "The sequences of primers for qRT-PCR.", "structure": {"pmcid": "PMC8036074", "section_index": 15, "section_title": "Validation of hub lncRNAs in the ceRNA network by qRT-PCR", "row_count": 17, "column_count": 3}, "table": {"label": "Table 1", "caption": "The sequences of primers for qRT-PCR.", "rows": [["Gene", "Direction", "Sequence (5–3)"], ["SUMO1P3", "Forward", "ACTGGCACCCCATCTCTTTG"], ["SUMO1P3", "Reverse", "CATCAGGGCCAATTCGCAAG"], ["NACAP1", "Forward", "GCTGAGACAGGGTCTGGAAC"], ["NACAP1", "Reverse", "CTGGACTTGTGCGGTTACCT"], ["NCF1C", "Forward", "CAGTCATGGGGGACACCTTC"], ["NCF1C", "Reverse", "TCCTGCCATTTCACCAGGAA"], ["ANXA2P1", "Forward", "AATGGGCATGGGGACTCAAG"], ["ANXA2P1", "Reverse", "ATGGGGAGCACCATTTCTGG"], ["GTF2IP1", "Forward", "CGAAAGTTGAAAAAGCTGTCGC"], ["GTF2IP1", "Reverse", "ATGCCATCAACCACCACACA"], ["NAPSB", "Forward", "TCATCCAGTTTGCTCAGGGT"], ["NAPSB", "Reverse", "TCGAAGACGGTCACATACGC"], ["OR7E37P", "Forward", "ACAATGCTGGGTGTTGGTTTAC"], ["OR7E37P", "Reverse", "TTCTGTGGGTCTGTAGAGATTG"], ["GAPDH", "Forward", "TGACAACTTTGGTATCGTGGAAGG"], ["GAPDH", "Reverse", "AGGCAGGGATGATGTTCTGGAGAG"]], "row_count": 17, "column_count": 3, "numeric_cells": 3, "header_rows": 1, "locator": "section[8]/table-wrap[1]#T1"}}], "gaps": ["asset:data:geo:GSE60438 not downloaded", "asset:data:geo:GSE60438 licence not read"]}, "analysis": {"state": "partial", "methods": [{"id": "method-1", "family": "differential_expression", "specific": "limma_voom", "label": "Differential expression analysis", "dsl_operations": ["normalise_counts", "differential_expression_fit", "fdr_bh"], "missing_operations": [], "expressible": true, "parameters": {}, "data_shapes": ["count_matrix_with_condition"], "evidence": {"score": 1.0, "band": "verbatim", "quote": "Further, differential gene expression analysis was implemented using the limma package (version 3.10.3) in R. The resulting P value was adjusted using Benjamini & Hochberg method."}}, {"id": "method-2", "family": "group_comparison", "specific": "student_t_test", "label": "Group comparison", "dsl_operations": [], "missing_operations": ["student_t"], "expressible": false, "parameters": {}, "data_shapes": ["two_or_more_groups_continuous"], "evidence": {"score": 0.8, "band": "high", "quote": "student's t test"}}, {"id": "method-3", "family": "clustering", "specific": "hierarchical", "label": "Clustering", "dsl_operations": ["hierarchical_cluster"], "missing_operations": [], "expressible": true, "parameters": {}, "data_shapes": ["feature_matrix"], "evidence": {"score": 0.8, "band": "high", "quote": "Hierarchical clustering"}}], "targets": [], "gaps": ["method.reader_differs_from_extractor"]}, "capability": {"state": "complete", "requirements": [{"capability_id": "capability:computational_analysis", "label": "Computational analysis platform", "assay_families": ["meta_analysis", "machine_learning", "survival_analysis", "statistical_regression", "pca", "molecular_docking", "network_analysis", "differential_expression", "gwas"], "availability_state": "owned", "tier_unlocked": "R1", "candidate": "Automated Assays Laravel application and simulated adapters"}], "gaps": []}, "readiness": {"state": "complete", "tier": "R1", "blocking_axis": "none", "blocked_on": "nothing:replicable_now", "axes": {"method": {"tier": "R1", "expressible": true, "required_operations": ["normalise_counts", "differential_expression_fit", "fdr_bh"], "missing_operations": [], "basis": "The paper names the method it used and the corpus's method extractor maps it onto the DSL catalogue: limma_voom."}, "capability": {"tier": "R1", "capability_id": "capability:computational_analysis", "availability_state": "owned", "basis": "The computational analysis is owned. The physical bench the paper used is not, so a physical validation cannot be run here."}, "data": {"tier": "R1", "reachable": true, "accessions": ["GSE60438"], "resolved_accessions": ["GSE60438"], "statements": ["The raw data of expression profile of GSE60438 based on platforms of GPL6884 and GPL10558 were obtained from the gene expression omnibus (GEO) database (https://www.ncbi.nlm.nih.gov/geo/). This dataset included genome-wide transcriptome sequencing data on 65 normotensive and 60 PE patients and was contributed by Yong et al.[14] The sequencing data based on the platform of GPL6884, which included 48 samples from 25 PE samples and 23 normal samples, were extracted for further analysis."], "basis": "The paper names GSE60438 in gene expression omnibus (GEO) database and the accession resolves in the repository. No dataset was downloaded and no licence was read."}}, "can_run": {"dsl_operations": ["normalise_counts", "differential_expression_fit", "fdr_bh"], "assets": ["source:pmid:33832098", "data:geo:GSE60438", "asset:table:pmid:33832098:1", "asset:table:pmid:33832098:2", "asset:table:pmid:33832098:3", "asset:table:pmid:33832098:4", "asset:table:pmid:33832098:5"], "steps": ["run_analysis"]}, "must_build": {"dsl_operations": [], "converters": [], "readers": [], "capabilities": [], "data_gaps": ["data:geo:GSE60438"]}, "gaps": []}, "review": {"state": "partial", "machine_critique": {"kind": "extraction_review", "reader": {"model": "MiniMax-M3.1-Flash", "provider": "minimax", "provider_family": "minimax", "read_at": "2026-10-31T19:30:45Z", "independence": "single_reader"}, "evidence_check": {"method": "verbatim", "availability": "absent"}, "calls": 3, "usage": {"prompt_tokens": 26846, "completion_tokens": 1300, "cached_tokens": 784}}, "human_critique": null, "stages": [{"id": "extraction", "state": "complete", "reader": "MiniMax-M3.1-Flash", "provider": "minimax"}], "gaps": ["review.independent_reader", "review.machine_critique", "review.human_critique"]}, "execution": {"state": "absent", "status": "not_run", "mode": null, "runs": [], "gaps": ["execution.not_run"]}, "provenance": {"entities": [{"id": "pmid:33832098", "type": "paper", "label": "pmid:33832098"}, {"id": "source:pmid:33832098", "type": "manuscript", "label": "PMID 33832098 full text"}, {"id": "data:geo:GSE60438", "type": "dataset", "label": "GEO GSE60438"}], "activities": [{"id": "activity-reading-sci-2026-11-01", "type": "classification", "used": [{"id": "pmid:33832098", "type": "paper", "label": "pmid:33832098"}, {"id": "source:pmid:33832098", "type": "manuscript", "label": "PMID 33832098 full text"}, {"id": "data:geo:GSE60438", "type": "dataset", "label": "GEO GSE60438"}], "agent": "agent:corpus-assay-engine"}, {"id": "activity-read-33832098", "type": "extraction", "used": ["source:pmid:33832098"], "agent": "agent:minimax-reader"}, {"id": "activity-resolve-GSE60438", "type": "accession_resolution", "used": ["data:geo:GSE60438"], "agent": "agent:corpus-assay-engine"}], "agents": [{"id": "agent:corpus-assay-engine", "type": "software", "label": "Corpus assay engine"}, {"id": "agent:minimax-reader", "type": "software", "label": "MiniMax literature reader"}], "source_run_id": "reading-sci-2026-11-01", "dsl_catalogue_fingerprint": "343fb30756ba6ec3", "capability_table_fingerprint": "2cb3e42f047d2ecf", "snapshot_id": "ba34b49490d9bfaf"}, "lineage": {"parent_id": "pmid:33832098", "parent_hash": "sha256:a433933bf70b77d3c187b8a59bfdabf9e0491f8e04679701ec9389efc5457291", "fork_of": null, "generation": 8}, "gaps": ["asset:data:geo:GSE60438 licence not read", "asset:data:geo:GSE60438 not downloaded", "execution.not_run", "method.reader_differs_from_extractor", "review.human_critique", "review.independent_reader", "review.machine_critique"], "assays": [{"role": "analysis", "definition_id": "differential_expression", "definition_version": "f2132e96ae6c7a4e", "definition_digest": null, "required_operations": ["normalise_counts", "differential_expression_fit", "fdr_bh"], "support_state": "supported", "source_hashes": {"dsl_catalogue": "f2132e96ae6c7a4e"}, "confidence": 1.0, "evidence": ["Further, differential gene expression analysis was implemented using the limma package (version 3.10.3) in R. The resulting P value was adjusted using Benjamini & Hochberg method."], "order_basis": "analysis_only", "id": "assay:1"}]}