The Potential Genes Mediate the Pathogenicity of Allogeneic CD4+T Cell in aGVHD Mouse Model.

{"sci_version": "1.2", "schema": "https://corpus.bntrg.co.uk/sci/1.0/sci.schema.json", "id": "pmid:34036106", "kind": "science-record", "revision": 8, "content_hash": "sha256:ee054fc29d620096b74823e24c4c1eb2ac251ab62b42a92559d03b9622b2b71b", "created_at": "2026-11-01T15:41:36Z", "updated_at": "2026-11-01T22:46:45Z", "generator": {"name": "corpus-assay-engine", "run_id": "reading-sci-2026-11-01"}, "paper": {"state": "complete", "title": "The Potential Genes Mediate the Pathogenicity of Allogeneic CD4+T Cell in aGVHD Mouse Model.", "doi": "10.1155/2021/9958745", "pmid": "34036106", "authors": ["Zhengyu Yu", "Chenchen Qin", "Min Cao", "Xiaoya He", "Hanyun Ren", "Huihui Liu"], "journal": "BioMed research international", "year": 2021, "abstract": "Acute graft-versus-host disease (aGVHD) remains a significant and severe complication of allogeneic hematopoietic stem cell transplantation (allo-HSCT). Due to the occurrence of aGVHD, allo-HSCT significantly increases the mortality rate compared with autologous hematopoietic stem cell transplantation (auto-HSCT). In this study, auto-HSCT and allo-HSCT aGVHD mouse models were built to detect the difference in CD4+ lymphocyte in different tissues based on ribonucleic acid sequencing (RNA-Seq) analysis. Clustering analysis, functional annotation, and pathway enrichment analysis were performed on differentially expressed genes (DEGs). The protein-protein interaction (PPI) network was used to find hub genes. CD4+T cells were activated by MLR and cytokine stimulation. Cells were sorted out by a flow cell sorter. The selected genes were verified by qRT-PCR, histology, and immunofluorescence staining. The GSE126518 GEO dataset was used to verify the hub genes. Enrichment analysis revealed four immune-related pathways that play an important role in aGVHD, including immunoregulatory interactions between a lymphoid and a nonlymphoid cell, chemokine receptors binding chemokines, cytokine and cytokine receptor interaction, and the chemokine signaling pathway. At the same time, with the PPI network, 11 novel hub genes that were most likely to participate in immunoregulation in aGVHD were identified, which were further validated by qRT-PCR and the GSE126518 dataset. Besides, the protein expression level of Cxcl7 was consistent with the sequencing results. In summary, this study revealed that immunoregulation-related DEGs and pathways played a vital role in the onset of aGVHD. These findings may provide some new clues for probing the pathogenesis and treatment of aGVHD.", "claims": [{"id": "claim-data-access", "statement": "All the data of this study are openly available upon request.", "kind": "methodological", "target": null, "evidence": [{"asset": "source:pmid:34036106", "locator": "sections[29] \"Data Availability\" paragraph 2", "quote": "All the data of this study are openly available upon request."}], "state": "complete"}], "gaps": []}, "experiment": {"state": "partial", "objective": null, "steps": [{"id": "read_published_estimate", "order": 1, "name": "Read the published estimate from the source", "kind": "other", "state": "complete", "blocked_on": null, "description": "The claim, method and evidence span published with the source article.", "duration_hours": null, "parameters": {}, "inputs": ["source:pmid:34036106"], "outputs": ["the published estimate and its evidence"], "instruments": [], "reagents": []}, {"id": "obtain_source_data", "order": 2, "name": "Obtain the source data from the named repository", "kind": "data-preparation", "state": "complete", "blocked_on": null, "description": "The GEO series accession resolves and its sample accessions are listed. This lane did not download the dataset or read its licence.", "duration_hours": null, "parameters": {}, "inputs": ["data:geo:GSE126518"], "outputs": ["the source data with its repository provenance"], "instruments": [], "reagents": []}, {"id": "run_analysis", "order": 3, "name": "Run the published analysis", "kind": "analysis", "state": "blocked", "blocked_on": "method:student_t", "description": "Apply the paper's statistical method to the resolved series and compare the result with the published target.", "duration_hours": null, "parameters": {}, "inputs": ["data:geo:GSE126518"], "outputs": ["the replicated result and its comparison"], "instruments": [], "reagents": []}], "materials": [], "instruments": [], "reagents": [], "conditions": {}, "gaps": ["step:run_analysis blocked on method:student_t"]}, "data": {"state": "partial", "assets": [{"id": "source:pmid:34036106", "role": "manuscript", "format": "xml", "media_type": "application/xml", "uri": "https://doi.org/10.1155/2021/9958745", "sha256": "sha256:eb3447e2cb8d578a0a551447f3838693cd4557d16600688f597cb2869ae698dd", "bytes": 51173, "access": "open", "state": "resolved", "reader": null, "reader_status": "reader_required", "identifier": "10.1155/2021/9958745", "version": null, "note": "Full article fetched from PMC; the checksum covers the rendered section body, not the original XML bytes.", "structure": {"pmcid": "PMC8121574", "source": "europe_pmc_fulltext", "coverage": "whole_body", "text_hash_scope": "rendered_section_body"}}, {"id": "data:geo:GSE126518", "role": "raw", "format": "geo-series", "media_type": "application/vnd.ncbi.geo-series+json", "uri": "https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE126518", "sha256": null, "bytes": null, "access": "open", "state": "resolved", "reader": null, "reader_status": "reader_required", "identifier": "GSE126518", "version": null, "note": "All the data of this study are openly available upon request.", "structure": {"repository": "GEO", "access_route": "GEO accession URL", "access_statement_verbatim": "All the data of this study are openly available upon request.", "access_statement_kind": "data_availability_statement", "sample_accessions": ["GSM3602920", "GSM3602921", "GSM3602922", "GSM3602923", "GSM3602924", "GSM3602925", "GSM3602926", "GSM3602927", "GSM3602928", "GSM3602929", "GSM3602930", "GSM3602931"], "sample_count": 12, "group_sizes": null, "group_sizes_basis": null, "platform": "17021", "taxon": "Mus musculus", "title": "Early Notch signals induce a pathogenic molecular signature during priming of alloantigen-specific conventional CD4+ T cells in graft-versus-host disease", "resolution_checked_at": "2026-11-01T15:39:54Z", "resolution_check": "identifier_resolution_only_no_download_no_licence_read", "downloaded": false, "licence_read": false}}, {"id": "asset:table:pmid:34036106:1", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:f70f5e0e8c23a278428a980d58c79b22775858847f8eeeeed890c7d8cb4b947a", "bytes": 1040, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[12]/table-wrap[1]#tab1", "version": null, "note": "Primers for 11 candidate immunoregulatory genes and Gapdh.", "structure": {"pmcid": "PMC8121574", "section_index": 12, "section_title": "2.10. Validation of Gene Expression by qRT-PCR", "row_count": 13, "column_count": 4}, "table": {"label": "Table 1", "caption": "Primers for 11 candidate immunoregulatory genes and Gapdh.", "rows": [["Gene", "Forward primer (5′ → 3′)", "Reverse primer (5′ → 3′)", "Product length"], ["Cxcl7", "CTCACGTTGTTCCCTCCTGG", "TGGGTCCATGCCATCAGATT", "192"], ["S1pr3", "TCAACACTCTTCCCGCAGTC", "CCCGGAGAGTGTCATTTCCC", "192"], ["Npy", "TAACAAGCGAATGGGGCTGT", "TGATGTAGTGTCGCAGAGCG", "61"], ["Hebp1", "CCTGTCTACTCACGCGCTTA", "GGAGACATCTTCCTTGCCCC", "180"], ["Rgs1", "TGCCAACCAGACAGGTCAAA", "TTCACAGCATCTGAATGCACAA", "171"], ["Fpr2", "TTCATGGGCCAGGACTTTCG", "CACAGACTTCATGGGGCCTT", "155"], ["Cxcl16", "GGGCTTTGGACCCTTGTCTC", "GATCCAAAGTACCCTGCGGT", "152"], ["Ccl9", "CAGGCCGGGCATCATCTTTA", "AGTAGCTGGCAGTTCACACC", "165"], ["Cxcl3", "CTGCACCCAGACAGAAGTCAT", "CCGTTGGGATGGATCGCTTT", "198"], ["Plg", "TCCGTGGGTTGGATGTTCAG", "ATTGTCCGGTCAGCAACCAT", "163"], ["Kng1", "TCCCGACTGTGAAATGCCAA", "CCCAGTGTCATATGGTGGGG", "164"], ["Gapdh", "CTCATGACCACAGTCCATGC", "CACATTGGGGGTAGGAACAC", "201"]], "row_count": 13, "column_count": 4, "numeric_cells": 15, "header_rows": 1, "locator": "section[12]/table-wrap[1]#tab1"}}, {"id": "asset:table:pmid:34036106:2", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:3b8939455f76b6d79f1c6f49bba848a92f6e3c3d2879a2f41c6803bc9f61c49b", "bytes": 855, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[22]/table-wrap[1]#tab2", "version": null, "note": "The top 10 up- and downregulated hub genes identified in CD4+T cells from each organ.", "structure": {"pmcid": "PMC8121574", "section_index": 22, "section_title": "3.4. Potential Immunoregulatory Genes in DEGs", "row_count": 7, "column_count": 3}, "table": {"label": "Table 2", "caption": "The top 10 up- and downregulated hub genes identified in CD4+T cells from each organ.", "rows": [["Group", "Hub gene"], ["Allospleen vs. autospleen", "Upregulated", "Cxcr2, Ccr1, Ccl5, Rgs1, Cxcl10, Cxcr5, Cxcr6, Cxcl2, Cxcl9, and Fpr2"], ["Downregulated", "Ccr7, Cxcl7, Ccr6, Ccr4, Sstr2, Penk, S1pr3, Npy, Hebp1, and Flt3"], ["Alloliver vs. autospleen", "Upregulated", "Kng1, Plg, Rdh7, Cps1, Serpinc1, Apof, Uox, Fga, Apoc3, and Hpx"], ["Downregulated", "Ccr7, Cxcr4, Ccr3, Ccr4, Htr1b, Ccr6, Cxcl7, S1pr3, Npy, and Ptger3"], ["Allolung vs. autospleen", "Upregulated", "C3, Cxcl16, Ccl9, Ccr1, Cxcr2, Cxcl5, Cxcl3, Cxcl1, Ccr8, and Cxcl10"], ["Downregulated", "Ccnb1, Cdc20, Aurkb, Aurka, Plk1, Bub1b, Mcm2, Cdc6, Mcm5, and Cdk1"]], "row_count": 7, "column_count": 3, "numeric_cells": 3, "header_rows": 1, "locator": "section[22]/table-wrap[1]#tab2"}}], "gaps": ["asset:data:geo:GSE126518 not downloaded", "asset:data:geo:GSE126518 licence not read"]}, "analysis": {"state": "partial", "methods": [{"id": "method-1", "family": "group_comparison", "specific": "student_t_test", "label": "Group comparison", "dsl_operations": [], "missing_operations": ["student_t"], "expressible": false, "parameters": {}, "data_shapes": ["two_or_more_groups_continuous"], "evidence": {"score": 1.0, "band": "reordered", "quote": "\"DEGs were calculated and identified by the DESeq2 R package [26].\" \"For other comparisons in this study, differences between groups were calculated by Student's t-test and ANOVA.\""}}, {"id": "method-2", "family": "group_comparison", "specific": "anova", "label": "Group comparison", "dsl_operations": ["group_summary", "welch_t", "bootstrap_mean_difference", "group_comparison_anova"], "missing_operations": [], "expressible": true, "parameters": {}, "data_shapes": ["two_or_more_groups_continuous"], "evidence": {"score": 0.8, "band": "high", "quote": "ANOVA"}}, {"id": "method-3", "family": "principal_component_analysis", "specific": "pca", "label": "Principal component analysis", "dsl_operations": ["pca_fit"], "missing_operations": [], "expressible": true, "parameters": {}, "data_shapes": ["wide_numeric_matrix"], "evidence": {"score": 0.8, "band": "high", "quote": "Principal component analysis"}}, {"id": "method-4", "family": "differential_expression", "specific": "deseq2", "label": "Differential expression analysis", "dsl_operations": ["normalise_counts", "differential_expression_fit", "fdr_bh"], "missing_operations": [], "expressible": true, "parameters": {}, "data_shapes": ["count_matrix_with_condition"], "evidence": {"score": 0.8, "band": "high", "quote": "DESeq2"}}, {"id": "method-5", "family": "correlation_analysis", "specific": "pearson", "label": "Correlation analysis", "dsl_operations": ["pearson_r"], "missing_operations": [], "expressible": true, "parameters": {}, "data_shapes": ["paired_numeric_columns"], "evidence": {"score": 0.8, "band": "high", "quote": "Pearson correlation"}}, {"id": "method-6", "family": "network_analysis", "specific": "ppi_network", "label": "Network / pathway analysis", "dsl_operations": ["build_graph", "centrality_scores", "pathway_enrich"], "missing_operations": [], "expressible": true, "parameters": {}, "data_shapes": ["edge_list"], "evidence": {"score": 0.7, "band": "medium", "quote": "protein-protein interaction"}}, {"id": "method-7", "family": "network_analysis", "specific": "pathway_enrichment", "label": "Network / pathway analysis", "dsl_operations": ["pathway_enrich"], "missing_operations": [], "expressible": true, "parameters": {}, "data_shapes": ["edge_list"], "evidence": {"score": 0.7, "band": "medium", "quote": "pathway enrichment"}}, {"id": "method-8", "family": "sequence_alignment", "specific": "read_mapping", "label": "Sequence alignment / homology", "dsl_operations": ["sequence_align", "alignment_identity"], "missing_operations": [], "expressible": true, "parameters": {}, "data_shapes": ["sequence_records"], "evidence": {"score": 0.8, "band": "high", "quote": "Hisat2"}}], "targets": [], "gaps": ["method.student_t"]}, "capability": {"state": "complete", "requirements": [{"capability_id": "capability:computational_analysis", "label": "Computational analysis platform", "assay_families": ["meta_analysis", "machine_learning", "survival_analysis", "statistical_regression", "pca", "molecular_docking", "network_analysis", "differential_expression", "gwas"], "availability_state": "owned", "tier_unlocked": "R1", "candidate": "Automated Assays Laravel application and simulated adapters"}], "gaps": []}, "readiness": {"state": "complete", "tier": "R1", "blocking_axis": "none", "blocked_on": "nothing:replicable_now", "axes": {"method": {"tier": "R1", "expressible": false, "required_operations": [], "missing_operations": ["student_t"], "basis": "The paper names the method it used and the corpus's method extractor maps it onto the DSL catalogue: student_t_test."}, "capability": {"tier": "R1", "capability_id": "capability:computational_analysis", "availability_state": "owned", "basis": "The computational analysis is owned. The physical bench the paper used is not, so a physical validation cannot be run here."}, "data": {"tier": "R1", "reachable": true, "accessions": ["GSE126518"], "resolved_accessions": ["GSE126518"], "statements": ["All the data of this study are openly available upon request."], "basis": "The paper names GSE126518 in Gene Expression Omnibus (GEO) and the accession resolves in the repository. No dataset was downloaded and no licence was read."}}, "can_run": {"dsl_operations": [], "assets": ["source:pmid:34036106", "data:geo:GSE126518", "asset:table:pmid:34036106:1", "asset:table:pmid:34036106:2"], "steps": []}, "must_build": {"dsl_operations": [{"operation": "student_t", "unlocks_papers": null, "priority": null}], "converters": [], "readers": [], "capabilities": [], "data_gaps": ["data:geo:GSE126518"]}, "gaps": []}, "review": {"state": "partial", "machine_critique": {"kind": "extraction_review", "reader": {"model": "MiniMax-M3.1-Flash", "provider": "minimax", "provider_family": "minimax", "read_at": "2026-10-31T18:30:26Z", "independence": "single_reader"}, "evidence_check": {"method": "reordered", "availability": "verbatim"}, "calls": 3, "usage": {"prompt_tokens": 41710, "completion_tokens": 1240, "cached_tokens": 784}}, "human_critique": null, "stages": [{"id": "extraction", "state": "complete", "reader": "MiniMax-M3.1-Flash", "provider": "minimax"}], "gaps": ["review.independent_reader", "review.machine_critique", "review.human_critique"]}, "execution": {"state": "absent", "status": "not_run", "mode": null, "runs": [], "gaps": ["execution.not_run"]}, "provenance": {"entities": [{"id": "pmid:34036106", "type": "paper", "label": "pmid:34036106"}, {"id": "source:pmid:34036106", "type": "manuscript", "label": "PMID 34036106 full text"}, {"id": "data:geo:GSE126518", "type": "dataset", "label": "GEO GSE126518"}], "activities": [{"id": "activity-reading-sci-2026-11-01", "type": "classification", "used": [{"id": "pmid:34036106", "type": "paper", "label": "pmid:34036106"}, {"id": "source:pmid:34036106", "type": "manuscript", "label": "PMID 34036106 full text"}, {"id": "data:geo:GSE126518", "type": "dataset", "label": "GEO GSE126518"}], "agent": "agent:corpus-assay-engine"}, {"id": "activity-read-34036106", "type": "extraction", "used": ["source:pmid:34036106"], "agent": "agent:minimax-reader"}, {"id": "activity-resolve-GSE126518", "type": "accession_resolution", "used": ["data:geo:GSE126518"], "agent": "agent:corpus-assay-engine"}], "agents": [{"id": "agent:corpus-assay-engine", "type": "software", "label": "Corpus assay engine"}, {"id": "agent:minimax-reader", "type": "software", "label": "MiniMax literature reader"}], "source_run_id": "reading-sci-2026-11-01", "dsl_catalogue_fingerprint": "343fb30756ba6ec3", "capability_table_fingerprint": "2cb3e42f047d2ecf", "snapshot_id": "ba34b49490d9bfaf"}, "lineage": {"parent_id": "pmid:34036106", "parent_hash": "sha256:c2ae0fe861657c0b4b71d7f4966a4bb936af6ef1c43a784479bf21b50b52ea60", "fork_of": null, "generation": 7}, "gaps": ["asset:data:geo:GSE126518 licence not read", "asset:data:geo:GSE126518 not downloaded", "execution.not_run", "method.student_t", "review.human_critique", "review.independent_reader", "review.machine_critique", "step:run_analysis blocked on method:student_t"], "assays": [{"role": "data_generation", "definition_id": "animal_model", "definition_version": "99e1195c7d6f", "definition_digest": null, "required_operations": [], "support_state": "partial", "source_hashes": {"assay_lexicon": "99e1195c7d6f"}, "confidence": 0.99, "evidence": ["hogenicity of Allogeneic CD4+T Cell in aGVHD Mouse Model.", "In this study, auto-HSCT and allo-HSCT aGVHD mouse models were built to detect the difference i"], "order_basis": "paper_text_order:35", "id": "assay:1"}, {"role": "data_generation", "definition_id": "rna_seq", "definition_version": "99e1195c7d6f", "definition_digest": null, "required_operations": [], "support_state": "partial", "source_hashes": {"assay_lexicon": "99e1195c7d6f"}, "confidence": 0.99, "evidence": ["issues based on ribonucleic acid sequencing (RNA-Seq) analysis. Clustering analysis, functional a", "2. Materials and Methods 2.7. RNA-Seq Data Processing and Identification of DEGs c"], "order_basis": "paper_text_order:536", "id": "assay:2"}, {"role": "data_generation", "definition_id": "ihc", "definition_version": "99e1195c7d6f", "definition_digest": null, "required_operations": [], "support_state": "partial", "source_hashes": {"assay_lexicon": "99e1195c7d6f"}, "confidence": 0.93, "evidence": ["nes were verified by qRT-PCR, histology, and immunofluorescence staining. The GSE126518 GEO dataset was used"], "order_basis": "paper_text_order:927", "id": "assay:3"}, {"role": "data_generation", "definition_id": "amplicon_seq", "definition_version": "99e1195c7d6f", "definition_digest": null, "required_operations": [], "support_state": "partial", "source_hashes": {"assay_lexicon": "99e1195c7d6f"}, "confidence": 0.77, "evidence": ["q Data Processing and Identification of DEGs cDNA libraries of CD4+ T cells from the auto-HSCT and allo-"], "order_basis": "paper_text_order:1915", "id": "assay:4"}, {"role": "analysis", "definition_id": "group_comparison", "definition_version": "f2132e96ae6c7a4e", "definition_digest": null, "required_operations": [], "support_state": "partial", "source_hashes": {"dsl_catalogue": "f2132e96ae6c7a4e"}, "confidence": 1.0, "evidence": ["\"DEGs were calculated and identified by the DESeq2 R package [26].\" \"For other comparisons in this study, differences between groups were calculated by Student's t-test and ANOVA.\""], "order_basis": "consumes_earlier_output", "id": "assay:5"}]}