Identification of diagnostic genes and vital microRNAs involved in rheumatoid arthritis: based on data mining and experimental verification.

{"sci_version": "1.2", "schema": "https://corpus.bntrg.co.uk/sci/1.0/sci.schema.json", "id": "pmid:34040897", "kind": "science-record", "revision": 7, "content_hash": "sha256:7a56d6a80a274254040ba7674845c57817bdd47d3a21498e583979d6af6de4e9", "created_at": "2026-11-01T15:41:36Z", "updated_at": "2026-11-01T22:03:51Z", "generator": {"name": "corpus-assay-engine", "run_id": "reading-sci-2026-11-01"}, "paper": {"state": "complete", "title": "Identification of diagnostic genes and vital microRNAs involved in rheumatoid arthritis: based on data mining and experimental verification.", "doi": "10.7717/peerj.11427", "pmid": "34040897", "authors": ["Conglin Ren", "Mingshuang Li", "Yang Zheng", "Fengqing Wu", "Weibin Du", "Renfu Quan"], "journal": "PeerJ", "year": 2021, "abstract": "BACKGROUND: The pathogenesis of rheumatoid arthritis (RA) is complex. This study aimed to identify diagnostic biomarkers and transcriptional regulators that underlie RA based on bioinformatics analysis and experimental verification.\nMATERIAL AND METHODS: We applied weighted gene co-expression network analysis (WGCNA) to analyze dataset GSE55457 and obtained the key module most relevant to the RA phenotype. We then conducted gene function annotation, gene set enrichment analysis (GSEA) and immunocytes quantitative analysis (CIBERSORT). Moreover, the intersection of differentially expressed genes (DEGs) and genes within the key module were entered into the STRING database to construct an interaction network and to mine hub genes. We predicted microRNA (miRNA) using a web-based tool (miRDB). Finally, hub genes and vital miRNAs were validated with independent GEO datasets, RT-qPCR and Western blot.\nRESULTS: A total of 367 DEGs were characterized by differential expression analysis. The WGCNA method divided genes into 14 modules, and we focused on the turquoise module containing 845 genes. Gene function annotation and GSEA suggested that immune response and inflammatory signaling pathways are the molecular mechanisms behind RA. Nine hub genes were screened from the network and seven vital regulators were obtained using miRNA prediction. CIBERSORT analysis identified five cell types enriched in RA samples, which were closely related to the expression of hub genes. Through ROC curve and RT-qPCR validation, we confirmed five genes that were specific for RA, including CCL25, CXCL9, CXCL10, CXCL11, and CXCL13. Moreover, we selected a representative gene (CXCL10) for Western blot validation. Vital miRNAs verification showed that only the differences in has-miR-573 and has-miR-34a were statistically significant.\nCONCLUSION: Our study reveals diagnostic genes and vital microRNAs highly related to RA, which could help improve our understanding of the molecular mechanisms underlying the disorder and provide theoretical support for the future exploration of innovative therapeutic approaches.", "claims": [{"id": "claim-data-access", "statement": "The R codes and raw data are available in the Supplemental Files.", "kind": "methodological", "target": null, "evidence": [{"asset": "source:pmid:34040897", "locator": "sections[31] \"Data Availability\" paragraph 2", "quote": "The R codes and raw data are available in the Supplemental Files."}], "state": "complete"}], "gaps": []}, "experiment": {"state": "complete", "objective": null, "steps": [{"id": "read_published_estimate", "order": 1, "name": "Read the published estimate from the source", "kind": "other", "state": "complete", "blocked_on": null, "description": "The claim, method and evidence span published with the source article.", "duration_hours": null, "parameters": {}, "inputs": ["source:pmid:34040897"], "outputs": ["the published estimate and its evidence"], "instruments": [], "reagents": []}, {"id": "obtain_source_data", "order": 2, "name": "Obtain the source data from the named repository", "kind": "data-preparation", "state": "complete", "blocked_on": null, "description": "The GEO series accession resolves and its sample accessions are listed. This lane did not download the dataset or read its licence.", "duration_hours": null, "parameters": {}, "inputs": ["data:geo:GSE12021"], "outputs": ["the source data with its repository provenance"], "instruments": [], "reagents": []}, {"id": "run_analysis", "order": 3, "name": "Run the published analysis", "kind": "analysis", "state": "complete", "blocked_on": null, "description": "Apply the paper's statistical method to the resolved series and compare the result with the published target.", "duration_hours": null, "parameters": {}, "inputs": ["data:geo:GSE12021"], "outputs": ["the replicated result and its comparison"], "instruments": [], "reagents": []}], "materials": [], "instruments": [], "reagents": [], "conditions": {}, "gaps": []}, "data": {"state": "partial", "assets": [{"id": "source:pmid:34040897", "role": "manuscript", "format": "xml", "media_type": "application/xml", "uri": "https://doi.org/10.7717/peerj.11427", "sha256": "sha256:6b442ee759a18aad7b2618454fbb397e811eceef4a73eb1750c874ff56a99cc8", "bytes": 54307, "access": "open", "state": "resolved", "reader": null, "reader_status": "reader_required", "identifier": "10.7717/peerj.11427", "version": null, "note": "Full article fetched from PMC; the checksum covers the rendered section body, not the original XML bytes.", "structure": {"pmcid": "PMC8127958", "source": "europe_pmc_fulltext", "coverage": "whole_body", "text_hash_scope": "rendered_section_body"}}, {"id": "data:geo:GSE12021", "role": "raw", "format": "geo-series", "media_type": "application/vnd.ncbi.geo-series+json", "uri": "https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE12021", "sha256": null, "bytes": null, "access": "open", "state": "resolved", "reader": null, "reader_status": "reader_required", "identifier": "GSE12021", "version": null, "note": "The R codes and raw data are available in the Supplemental Files.", "structure": {"repository": "GEO", "access_route": "GEO accession URL", "access_statement_verbatim": "The R codes and raw data are available in the Supplemental Files.", "access_statement_kind": "data_availability_statement", "sample_accessions": ["GSM302859", "GSM302864", "GSM302866", "GSM302870", "GSM302872", "GSM302874", "GSM302876", "GSM302878", "GSM302880", "GSM302881", "GSM302882", "GSM302895", "GSM302896", "GSM302897", "GSM302900", "GSM302905", "GSM302924", "GSM302926", "GSM302927", "GSM302929", "GSM302930", "GSM302932", "GSM302933", "GSM302934", "GSM302943", "GSM302944", "GSM303326", "GSM303339", "GSM303341", "GSM303355", "GSM303356", "GSM303357", "GSM303358", "GSM303359", "GSM303360", "GSM303361", "GSM303362", "GSM303363", "GSM303364", "GSM303365", "GSM303366", "GSM303367", "GSM303368", "GSM303369", "GSM303370", "GSM303377", "GSM303520", "GSM303521", "GSM303522", "GSM303523", "GSM303524", "GSM303525", "GSM303530", "GSM303531", "GSM303532", "GSM303533", "GSM303534"], "sample_count": 57, "group_sizes": null, "group_sizes_basis": null, "platform": "96;97", "taxon": "Homo sapiens", "title": "Identification of inter-individual and gene-specific variances in mRNA expression profiles in the RA SM", "resolution_checked_at": "2026-11-01T15:39:54Z", "resolution_check": "identifier_resolution_only_no_download_no_licence_read", "downloaded": false, "licence_read": false}}, {"id": "data:geo:GSE37425", "role": "raw", "format": "geo-series", "media_type": "application/vnd.ncbi.geo-series+json", "uri": "https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE37425", "sha256": null, "bytes": null, "access": "open", "state": "resolved", "reader": null, "reader_status": "reader_required", "identifier": "GSE37425", "version": null, "note": "The R codes and raw data are available in the Supplemental Files.", "structure": {"repository": "GEO", "access_route": "GEO accession URL", "access_statement_verbatim": "The R codes and raw data are available in the Supplemental Files.", "access_statement_kind": "data_availability_statement", "sample_accessions": ["GSM918942", "GSM918943", "GSM918944", "GSM918945", "GSM918946", "GSM918947", "GSM918948", "GSM918949"], "sample_count": 8, "group_sizes": null, "group_sizes_basis": null, "platform": "15467", "taxon": "Homo sapiens", "title": "miRNAs expression in synovial tissues of rheumatoid arthritis (RA) individuals", "resolution_checked_at": "2026-11-01T15:39:54Z", "resolution_check": "identifier_resolution_only_no_download_no_licence_read", "downloaded": false, "licence_read": false}}, {"id": "data:geo:GSE55457", "role": "raw", "format": "geo-series", "media_type": "application/vnd.ncbi.geo-series+json", "uri": "https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE55457", "sha256": null, "bytes": null, "access": "open", "state": "resolved", "reader": null, "reader_status": "reader_required", "identifier": "GSE55457", "version": null, "note": "The R codes and raw data are available in the Supplemental Files.", "structure": {"repository": "GEO", "access_route": "GEO accession URL", "access_statement_verbatim": "The R codes and raw data are available in the Supplemental Files.", "access_statement_kind": "data_availability_statement", "sample_accessions": ["GSM1337304", "GSM1337305", "GSM1337306", "GSM1337307", "GSM1337308", "GSM1337309", "GSM1337310", "GSM1337311", "GSM1337312", "GSM1337313", "GSM1337314", "GSM1337315", "GSM1337316", "GSM1337317", "GSM1337318", "GSM1337319", "GSM1337320", "GSM1337321", "GSM1337322", "GSM1337323", "GSM1337324", "GSM1337325", "GSM1337326", "GSM1337327", "GSM1337328", "GSM1337329", "GSM1337330", "GSM1337331", "GSM1337332", "GSM1337333", "GSM1337334", "GSM1337335", "GSM1337336"], "sample_count": 33, "group_sizes": null, "group_sizes_basis": null, "platform": "96", "taxon": "Homo sapiens", "title": "Identification of rheumatoid arthritis and osteoarthritis patients by transcriptome-based rule set generation [Jena]", "resolution_checked_at": "2026-11-01T15:39:54Z", "resolution_check": "identifier_resolution_only_no_download_no_licence_read", "downloaded": false, "licence_read": false}}, {"id": "asset:table:pmid:34040897:1", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:1c7a465419c9996debf35b00a0f15623833285b3e6a317017bf1745964ffd8fc", "bytes": 922, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[10]/table-wrap[1]#table-1", "version": null, "note": "RT-qPCR primers used in this study.", "structure": {"pmcid": "PMC8127958", "section_index": 10, "section_title": "Validating hub genes and miRNAs with RT-qPCR", "row_count": 10, "column_count": 2}, "table": {"label": "Table 1", "caption": "RT-qPCR primers used in this study.", "rows": [["Gene symbol", "Sequence (5′ to 3′)"], ["CCL25", "forward: TATTCTACCTCCCCAAGAGACA reverse: GATGGGATTGCTAAACTTGGAC"], ["CXCL10", "forward: CTCTCTCTAGAACTGTACGCTG reverse: ATTCAGACATCTCTTCTCACCC"], ["CCL5", "forward: CAGCAGTCGTCCACAGGTCAAG reverse: TTTCTTCTCTGGGTTGGCACACAC"], ["CXCL9", "forward: AAGACCTTAAACAATTTGCCCC reverse: TGCTGAATCTGGGTTTAGACAT"], ["CXCL13", "forward: CAAGGTGTTCTGGAGGTCTATT reverse: TGAATTCGATCAATGAAGCGTC"], ["CXCL11", "forward: GCTGTGATATTGTGTGCTACAG reverse: TTGGGTACATTATGGAGGCTTT"], ["GAPDH", "forward: CGGACCAATACGACCAAATCCG reverse: AGCCACATCGCTCAGACACC"], ["miR-34a-5p", "forward: TCTGTCTCTCTTGGCAGTGTCTTA reverse: AATGGTTGTTCTCCACTCTCTCTC"], ["U6", "forward: CAGCACATATACTAAAATTGGAACG reverse: ACGAATTTGCGTGTCATCC"]], "row_count": 10, "column_count": 2, "numeric_cells": 6, "header_rows": 1, "locator": "section[10]/table-wrap[1]#table-1"}}, {"id": "asset:table:pmid:34040897:2", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:edf673b712b0de278de0ac70513491201974bf0ff26b5966e3cc01fa984b19ae", "bytes": 558, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[17]/table-wrap[1]#table-2", "version": null, "note": "Detailed information of each cluster.", "structure": {"pmcid": "PMC8127958", "section_index": 17, "section_title": "Constructing PPI network to find hub genes", "row_count": 6, "column_count": 5}, "table": {"label": "Table 2", "caption": "Detailed information of each cluster.", "rows": [["Cluster", "Score", "Nodes", "Edges", "Node IDs"], ["1", "9.000", "9", "36", "CCL25, CCL5, CXCL10, CXCL11, CXCL13, CXCL9, CXCR6, GPR18, PNOC"], ["2", "6.286", "8", "22", "BLNK, CD19, CD72, CD79A, CD79B, IGLL5, ITK, PLCG2"], ["3", "4.400", "6", "11", "CD8A, MAP4K1, CD247, TRAT1, CD3D, GZMA"], ["4", "4.000", "4", "6", "BIRC3, PSMB10, PSMB9, TNFSF11"], ["5", "3.000", "3", "3", "CD2, CD48, CD52"]], "row_count": 6, "column_count": 5, "numeric_cells": 25, "header_rows": 1, "locator": "section[17]/table-wrap[1]#table-2"}}, {"id": "asset:table:pmid:34040897:3", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:ce2f4b69cfa354abb1461e0826986d3050638c0c99588934751f7fa90c96dd48", "bytes": 480, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[19]/table-wrap[1]#table-3", "version": null, "note": "Vital miRNAs and its target genes.", "structure": {"pmcid": "PMC8127958", "section_index": 19, "section_title": "Predicting miRNAs that regulate nine hub genes", "row_count": 8, "column_count": 3}, "table": {"label": "Table 3", "caption": "Vital miRNAs and its target genes.", "rows": [["miRNA", "Target genes", "Count"], ["hsa-miR-297", "CXCL9, CXCL10", "2"], ["hsa-miR-573", "CXCL9, GPR18", "2"], ["hsa-miR-203a-3p", "GPR18, PNOC", "2"], ["hsa-miR-449b-5p", "PNOC, CXCL10", "2"], ["hsa-miR-34c-5p", "PNOC, CXCL10", "2"], ["hsa-miR-449a", "PNOC, CXCL10", "2"], ["hsa-miR-34a-5p", "PNOC, CXCL10", "2"]], "row_count": 8, "column_count": 3, "numeric_cells": 21, "header_rows": 1, "locator": "section[19]/table-wrap[1]#table-3"}}], "gaps": ["asset:data:geo:GSE12021 not downloaded", "asset:data:geo:GSE12021 licence not read", "asset:data:geo:GSE37425 not downloaded", "asset:data:geo:GSE37425 licence not read", "asset:data:geo:GSE55457 not downloaded", "asset:data:geo:GSE55457 licence not read"]}, "analysis": {"state": "partial", "methods": [{"id": "method-1", "family": "diagnostic_evaluation", "specific": "roc", "label": "Diagnostic test evaluation", "dsl_operations": ["confusion_counts", "roc_curve", "sensitivity_specificity", "solve_confusion_matrix", "classification_metrics", "published_precision_envelope"], "missing_operations": [], "expressible": true, "parameters": {}, "data_shapes": ["reference_standard_and_test"], "evidence": {"score": 0.7, "band": "medium", "quote": "ROC curve"}}, {"id": "method-2", "family": null, "specific": null, "label": "Weighted gene co-expression network analysis (WGCNA)", "dsl_operations": [], "missing_operations": [], "expressible": null, "parameters": {}, "data_shapes": [], "evidence": {"score": 1.0, "band": "reordered", "quote": "“We applied weighted gene co-expression network analysis (WGCNA) to analyze dataset GSE55457 and obtained the key module most relevant to the RA phenotype.”"}}], "targets": [], "gaps": ["method.reader_named_unmapped"]}, "capability": {"state": "complete", "requirements": [{"capability_id": "capability:computational_analysis", "label": "Computational analysis platform", "assay_families": ["meta_analysis", "machine_learning", "survival_analysis", "statistical_regression", "pca", "molecular_docking", "network_analysis", "differential_expression", "gwas"], "availability_state": "owned", "tier_unlocked": "R1", "candidate": "Automated Assays Laravel application and simulated adapters"}], "gaps": []}, "readiness": {"state": "complete", "tier": "R1", "blocking_axis": "none", "blocked_on": "nothing:replicable_now", "axes": {"method": {"tier": "R1", "expressible": true, "required_operations": ["confusion_counts", "roc_curve", "sensitivity_specificity", "solve_confusion_matrix", "classification_metrics", "published_precision_envelope"], "missing_operations": [], "basis": "The paper names the method it used and the corpus's method extractor maps it onto the DSL catalogue: roc."}, "capability": {"tier": "R1", "capability_id": "capability:computational_analysis", "availability_state": "owned", "basis": "The computational analysis is owned. The physical bench the paper used is not, so a physical validation cannot be run here."}, "data": {"tier": "R1", "reachable": true, "accessions": ["GSE55457", "GSE12021", "GSE37425"], "resolved_accessions": ["GSE55457", "GSE12021", "GSE37425"], "statements": ["The R codes and raw data are available in the Supplemental Files."], "basis": "The paper names GSE55457, GSE12021, GSE37425 in Gene Expression Omnibus (GEO) and the accession resolves in the repository. No dataset was downloaded and no licence was read."}}, "can_run": {"dsl_operations": ["confusion_counts", "roc_curve", "sensitivity_specificity", "solve_confusion_matrix", "classification_metrics", "published_precision_envelope"], "assets": ["source:pmid:34040897", "data:geo:GSE12021", "asset:table:pmid:34040897:1", "asset:table:pmid:34040897:2", "asset:table:pmid:34040897:3"], "steps": ["run_analysis"]}, "must_build": {"dsl_operations": [], "converters": [], "readers": [], "capabilities": [], "data_gaps": ["data:geo:GSE12021"]}, "gaps": []}, "review": {"state": "partial", "machine_critique": {"kind": "extraction_review", "reader": {"model": "MiniMax-M3.1-Flash", "provider": "minimax", "provider_family": "minimax", "read_at": "2026-10-31T18:30:24Z", "independence": "single_reader"}, "evidence_check": {"method": "reordered", "availability": "verbatim"}, "calls": 3, "usage": {"prompt_tokens": 44285, "completion_tokens": 2199, "cached_tokens": 784}}, "human_critique": null, "stages": [{"id": "extraction", "state": "complete", "reader": "MiniMax-M3.1-Flash", "provider": "minimax"}], "gaps": ["review.independent_reader", "review.machine_critique", "review.human_critique"]}, "execution": {"state": "absent", "status": "not_run", "mode": null, "runs": [], "gaps": ["execution.not_run"]}, "provenance": {"entities": [{"id": "pmid:34040897", "type": "paper", "label": "pmid:34040897"}, {"id": "source:pmid:34040897", "type": "manuscript", "label": "PMID 34040897 full text"}, {"id": "data:geo:GSE12021", "type": "dataset", "label": "GEO GSE12021"}], "activities": [{"id": "activity-reading-sci-2026-11-01", "type": "classification", "used": [{"id": "pmid:34040897", "type": "paper", "label": "pmid:34040897"}, {"id": "source:pmid:34040897", "type": "manuscript", "label": "PMID 34040897 full text"}, {"id": "data:geo:GSE12021", "type": "dataset", "label": "GEO GSE12021"}], "agent": "agent:corpus-assay-engine"}, {"id": "activity-read-34040897", "type": "extraction", "used": ["source:pmid:34040897"], "agent": "agent:minimax-reader"}, {"id": "activity-resolve-GSE12021", "type": "accession_resolution", "used": ["data:geo:GSE12021"], "agent": "agent:corpus-assay-engine"}], "agents": [{"id": "agent:corpus-assay-engine", "type": "software", "label": "Corpus assay engine"}, {"id": "agent:minimax-reader", "type": "software", "label": "MiniMax literature reader"}], "source_run_id": "reading-sci-2026-11-01", "dsl_catalogue_fingerprint": "343fb30756ba6ec3", "capability_table_fingerprint": "2cb3e42f047d2ecf", "snapshot_id": "ba34b49490d9bfaf"}, "lineage": {"parent_id": "pmid:34040897", "parent_hash": "sha256:647eb893989d29d46c467833f57d25c08926edd7900cbfb3c57a85bdf6d8cdac", "fork_of": null, "generation": 6}, "gaps": ["asset:data:geo:GSE12021 licence not read", "asset:data:geo:GSE12021 not downloaded", "asset:data:geo:GSE37425 licence not read", "asset:data:geo:GSE37425 not downloaded", "asset:data:geo:GSE55457 licence not read", "asset:data:geo:GSE55457 not downloaded", "execution.not_run", "method.reader_named_unmapped", "review.human_critique", "review.independent_reader", "review.machine_critique"], "assays": [{"role": "data_generation", "definition_id": "qpcr", "definition_version": "99e1195c7d6f", "definition_digest": null, "required_operations": [], "support_state": "partial", "source_hashes": {"assay_lexicon": "99e1195c7d6f"}, "confidence": 0.99, "evidence": ["ere validated with independent GEO datasets, RT-qPCR and Western blot. RESULTS: A total of 367 DE", "pression of hub genes. Through ROC curve and RT-qPCR validation, we confirmed five genes that wer", "validated with independent GEO datasets, RT-qPCR and Western blot. RESULTS: A total of 367 DE", "ssion of hub genes. Through ROC curve and RT-qPCR validation, we confirmed five genes that wer"], "order_basis": "paper_text_order:978", "id": "assay:1"}, {"role": "data_generation", "definition_id": "western_blot", "definition_version": "99e1195c7d6f", "definition_digest": null, "required_operations": [], "support_state": "partial", "source_hashes": {"assay_lexicon": "99e1195c7d6f"}, "confidence": 0.99, "evidence": ["d with independent GEO datasets, RT-qPCR and Western blot. RESULTS: A total of 367 DEGs were character", "selected a representative gene (CXCL10) for Western blot validation. Vital miRNAs verification showed"], "order_basis": "paper_text_order:990", "id": "assay:2"}, {"role": "analysis", "definition_id": "diagnostic_evaluation", "definition_version": "f2132e96ae6c7a4e", "definition_digest": null, "required_operations": ["confusion_counts", "roc_curve", "sensitivity_specificity", "solve_confusion_matrix", "classification_metrics", "published_precision_envelope"], "support_state": "supported", "source_hashes": {"dsl_catalogue": "f2132e96ae6c7a4e"}, "confidence": 0.7, "evidence": ["ROC curve"], "order_basis": "consumes_earlier_output", "id": "assay:3"}]}