Identification of novel hub genes associated with gastric cancer using integrated bioinformatics analysis.

{"sci_version": "1.2", "schema": "https://corpus.bntrg.co.uk/sci/1.0/sci.schema.json", "id": "pmid:34126961", "kind": "science-record", "revision": 8, "content_hash": "sha256:875fbca223803b0ec55398b346b082a3123fdfd335b2baa9303e3cfc242dc85c", "created_at": "2026-11-01T15:41:38Z", "updated_at": "2026-11-01T22:46:51Z", "generator": {"name": "corpus-assay-engine", "run_id": "reading-sci-2026-11-01"}, "paper": {"state": "complete", "title": "Identification of novel hub genes associated with gastric cancer using integrated bioinformatics analysis.", "doi": "10.1186/s12885-021-08358-7", "pmid": "34126961", "authors": ["Xiao-Qing Lu", "Jia-Qian Zhang", "Sheng-Xiao Zhang", "Jun Qiao", "Meng-Ting Qiu", "Xiang-Rong Liu", "Xiao-Xia Chen", "Chong Gao", "Huan-Hu Zhang"], "journal": "BMC cancer", "year": 2021, "abstract": "BACKGROUND: Gastric cancer (GC) is one of the most common solid malignant tumors worldwide with a high-recurrence-rate. Identifying the molecular signatures and specific biomarkers of GC might provide novel clues for GC prognosis and targeted therapy.\nMETHODS: Gene expression profiles were obtained from the ArrayExpress and Gene Expression Omnibus database. Differentially expressed genes (DEGs) were picked out by R software. The hub genes were screened by cytohubba plugin. Their prognostic values were assessed by Kaplan-Meier survival analyses and the gene expression profiling interactive analysis (GEPIA). Finally, qRT-PCR in GC tissue samples was established to validate these DEGs.\nRESULTS: Total of 295 DEGs were identified between GC and their corresponding normal adjacent tissue samples in E-MTAB-1440, GSE79973, GSE19826, GSE13911, GSE27342, GSE33335 and GSE56807 datasets, including 117 up-regulated and 178 down-regulated genes. Among them, 7 vital upregulated genes (HMMR, SPP1, FN1, CCNB1, CXCL8, MAD2L1 and CCNA2) were selected. Most of them had a significantly worse prognosis except SPP1. Using qRT-PCR, we validated that their transcriptions in our GC tumor tissue were upregulated except SPP1 and FN1, which correlated with tumor relapse and predicts poorer prognosis in GC patients.\nCONCLUSIONS: We have identified 5 upregulated DEGs (HMMR, CCNB1, CXCL8, MAD2L1, and CCNA2) in GC patients with poor prognosis using integrated bioinformatical methods, which could be potential biomarkers and therapeutic targets for GC treatment.", "claims": [{"id": "claim-method", "statement": "Then the statistically significant DEGs was selected by Moderated T statistic approach with “limma [8]” and “oligo [9]” package of Bioconductor. The resulting P values were adjusted by the default Benjamini & Hochberg (BH) false discovery rate method.", "kind": "methodological", "target": null, "evidence": [{"asset": "source:pmid:34126961", "locator": "sections[5] \"Data processing of DEGs\" paragraph 2", "quote": "Then the statistically significant DEGs was selected by Moderated T statistic approach with “limma [8]” and “oligo [9]” package of Bioconductor."}, {"asset": "source:pmid:34126961", "locator": "sections[5] \"Data processing of DEGs\" paragraph 2", "quote": "The resulting P values were adjusted by the default Benjamini & Hochberg (BH) false discovery rate method."}], "state": "complete"}, {"id": "claim-data-access", "statement": "All data generated or analyzed during this study are included in this published article.", "kind": "methodological", "target": null, "evidence": [{"asset": "source:pmid:34126961", "locator": "sections[29] \"notes\" paragraph 1", "quote": "All data generated or analyzed during this study are included in this published article."}], "state": "complete"}], "gaps": []}, "experiment": {"state": "complete", "objective": null, "steps": [{"id": "read_published_estimate", "order": 1, "name": "Read the published estimate from the source", "kind": "other", "state": "complete", "blocked_on": null, "description": "The claim, method and evidence span published with the source article.", "duration_hours": null, "parameters": {}, "inputs": ["source:pmid:34126961"], "outputs": ["the published estimate and its evidence"], "instruments": [], "reagents": []}, {"id": "obtain_source_data", "order": 2, "name": "Obtain the source data from the named repository", "kind": "data-preparation", "state": "complete", "blocked_on": null, "description": "The GEO series accession resolves and its sample accessions are listed. This lane did not download the dataset or read its licence.", "duration_hours": null, "parameters": {}, "inputs": ["data:geo:E-MTAB-1440"], "outputs": ["the source data with its repository provenance"], "instruments": [], "reagents": []}, {"id": "run_analysis", "order": 3, "name": "Run the published analysis", "kind": "analysis", "state": "complete", "blocked_on": null, "description": "Apply the paper's statistical method to the resolved series and compare the result with the published target.", "duration_hours": null, "parameters": {"fdr_threshold": "with Benjamini–Hochberg false discovery rate adjustment"}, "inputs": ["data:geo:E-MTAB-1440"], "outputs": ["the replicated result and its comparison"], "instruments": [], "reagents": []}], "materials": [], "instruments": [], "reagents": [], "conditions": {}, "gaps": []}, "data": {"state": "partial", "assets": [{"id": "source:pmid:34126961", "role": "manuscript", "format": "xml", "media_type": "application/xml", "uri": "https://doi.org/10.1186/s12885-021-08358-7", "sha256": "sha256:526275db2cd052e64eba467a35b1c65f9231ee20e24dda3abb21f3797de827a4", "bytes": 38335, "access": "open", "state": "resolved", "reader": null, "reader_status": "reader_required", "identifier": "10.1186/s12885-021-08358-7", "version": null, "note": "Full article fetched from PMC; the checksum covers the rendered section body, not the original XML bytes.", "structure": {"pmcid": "PMC8201699", "source": "europe_pmc_fulltext", "coverage": "whole_body_without_references", "text_hash_scope": "rendered_section_body"}}, {"id": "data:geo:E-MTAB-1440", "role": "raw", "format": "geo-series", "media_type": "application/vnd.ncbi.geo-series+json", "uri": "https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=E-MTAB-1440", "sha256": null, "bytes": null, "access": "open", "state": "resolved", "reader": null, "reader_status": "reader_required", "identifier": "E-MTAB-1440", "version": null, "note": "All data generated or analyzed during this study are included in this published article.", "structure": {"repository": "GEO", "access_route": "GEO accession URL", "access_statement_verbatim": "All data generated or analyzed during this study are included in this published article.", "access_statement_kind": "data_availability_statement", "sample_accessions": [], "sample_count": null, "group_sizes": null, "group_sizes_basis": null, "platform": null, "taxon": null, "title": null, "resolution_checked_at": "2026-10-31T18:35:08Z", "resolution_check": "identifier_resolution_only_no_download_no_licence_read", "downloaded": false, "licence_read": false}}, {"id": "data:geo:GSE13911", "role": "raw", "format": "geo-series", "media_type": "application/vnd.ncbi.geo-series+json", "uri": "https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE13911", "sha256": null, "bytes": null, "access": "open", "state": "resolved", "reader": null, "reader_status": "reader_required", "identifier": "GSE13911", "version": null, "note": "All data generated or analyzed during this study are included in this published article.", "structure": {"repository": "GEO", "access_route": "GEO accession URL", "access_statement_verbatim": "All data generated or analyzed during this study are included in this published article.", "access_statement_kind": "data_availability_statement", "sample_accessions": ["GSM350411", "GSM350412", "GSM350413", "GSM350414", "GSM350415", "GSM350416", "GSM350417", "GSM350418", "GSM350419", "GSM350420", "GSM350421", "GSM350422", "GSM350423", "GSM350424", "GSM350425", "GSM350426", "GSM350427", "GSM350428", "GSM350429", "GSM350430", "GSM350431", "GSM350432", "GSM350433", "GSM350434", "GSM350435", "GSM350436", "GSM350437", "GSM350438", "GSM350439", "GSM350440", "GSM350441", "GSM350442", "GSM350443", "GSM350444", "GSM350445", "GSM350446", "GSM350447", "GSM350448", "GSM350449", "GSM350450", "GSM350451", "GSM350452", "GSM350453", "GSM350454", "GSM350455", "GSM350456", "GSM350457", "GSM350458", "GSM350459", "GSM350460", "GSM350461", "GSM350462", "GSM350463", "GSM350464", "GSM350465", "GSM350466", "GSM350467", "GSM350468", "GSM350469", "GSM350470", "GSM350471", "GSM350472", "GSM350473", "GSM350474", "GSM350475", "GSM350476", "GSM350477", "GSM350478", "GSM350479"], "sample_count": 69, "group_sizes": null, "group_sizes_basis": null, "platform": "570", "taxon": "Homo sapiens", "title": "Expression data from primary gastric tumors (MSI and MSS) and adjacent normal samples", "resolution_checked_at": "2026-11-01T15:39:54Z", "resolution_check": "identifier_resolution_only_no_download_no_licence_read", "downloaded": false, "licence_read": false}}, {"id": "data:geo:GSE19826", "role": "raw", "format": "geo-series", "media_type": "application/vnd.ncbi.geo-series+json", "uri": "https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE19826", "sha256": null, "bytes": null, "access": "open", "state": "resolved", "reader": null, "reader_status": "reader_required", "identifier": "GSE19826", "version": null, "note": "All data generated or analyzed during this study are included in this published article.", "structure": {"repository": "GEO", "access_route": "GEO accession URL", "access_statement_verbatim": "All data generated or analyzed during this study are included in this published article.", "access_statement_kind": "data_availability_statement", "sample_accessions": ["GSM495051", "GSM495052", "GSM495053", "GSM495054", "GSM495055", "GSM495056", "GSM495057", "GSM495058", "GSM495059", "GSM495060", "GSM495061", "GSM495062", "GSM495063", "GSM495064", "GSM495065", "GSM495066", "GSM495067", "GSM495068", "GSM495069", "GSM495070", "GSM495071", "GSM495072", "GSM495073", "GSM495074", "GSM495075", "GSM495076", "GSM495077"], "sample_count": 27, "group_sizes": null, "group_sizes_basis": null, "platform": "570", "taxon": "Homo sapiens", "title": "Expression data from gastric cancer", "resolution_checked_at": "2026-11-01T15:39:54Z", "resolution_check": "identifier_resolution_only_no_download_no_licence_read", "downloaded": false, "licence_read": false}}, {"id": "data:geo:GSE27342", "role": "raw", "format": "geo-series", "media_type": "application/vnd.ncbi.geo-series+json", "uri": "https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE27342", "sha256": null, "bytes": null, "access": "open", "state": "resolved", "reader": null, "reader_status": "reader_required", "identifier": "GSE27342", "version": null, "note": "All data generated or analyzed during this study are included in this published article.", "structure": {"repository": "GEO", "access_route": "GEO accession URL", "access_statement_verbatim": "All data generated or analyzed during this study are included in this published article.", "access_statement_kind": "data_availability_statement", "sample_accessions": ["GSM675890", "GSM675891", "GSM675892", "GSM675893", "GSM675894", "GSM675895", "GSM675896", "GSM675897", "GSM675898", "GSM675899", "GSM675900", "GSM675901", "GSM675902", "GSM675903", "GSM675904", "GSM675905", "GSM675906", "GSM675907", "GSM675908", "GSM675909", "GSM675910", "GSM675911", "GSM675912", "GSM675913", "GSM675914", "GSM675915", "GSM675916", "GSM675917", "GSM675918", "GSM675919", "GSM675920", "GSM675921", "GSM675922", "GSM675923", "GSM675924", "GSM675925", "GSM675926", "GSM675927", "GSM675928", "GSM675929", "GSM675930", "GSM675931", "GSM675932", "GSM675933", "GSM675934", "GSM675935", "GSM675936", "GSM675937", "GSM675938", "GSM675939", "GSM675940", "GSM675941", "GSM675942", "GSM675943", "GSM675944", "GSM675945", "GSM675946", "GSM675947", "GSM675948", "GSM675949", "GSM675950", "GSM675951", "GSM675952", "GSM675953", "GSM675954", "GSM675955", "GSM675956", "GSM675957", "GSM675958", "GSM675959", "GSM675960", "GSM675961", "GSM675962", "GSM675963", "GSM675964", "GSM675965", "GSM675966", "GSM675967", "GSM675968", "GSM675969", "GSM675970", "GSM675971", "GSM675972", "GSM675973", "GSM675974", "GSM675975", "GSM675976", "GSM675977", "GSM675978", "GSM675979", "GSM675980", "GSM675981", "GSM675982", "GSM675983", "GSM675984", "GSM675985", "GSM675986", "GSM675987", "GSM675988", "GSM675989", "GSM675990", "GSM675991", "GSM675992", "GSM675993", "GSM675994", "GSM675995", "GSM675996", "GSM675997", "GSM675998", "GSM675999", "GSM676000", "GSM676001", "GSM676002", "GSM676003", "GSM676004", "GSM676005", "GSM676006", "GSM676007", "GSM676008", "GSM676009", "GSM676010", "GSM676011", "GSM676012", "GSM676013", "GSM676014", "GSM676015", "GSM676016", "GSM676017", "GSM676018", "GSM676019", "GSM676020", "GSM676021", "GSM676022", "GSM676023", "GSM676024", "GSM676025", "GSM676026", "GSM676027", "GSM676028", "GSM676029", "GSM676030", "GSM676031", "GSM676032", "GSM676033", "GSM676034", "GSM676035", "GSM676036", "GSM676037", "GSM676038", "GSM676039", "GSM676040", "GSM676041", "GSM676042", "GSM676043", "GSM676044", "GSM676045", "GSM676046", "GSM676047", "GSM676048", "GSM676049"], "sample_count": 160, "group_sizes": null, "group_sizes_basis": null, "platform": "5175", "taxon": "Homo sapiens", "title": "Transcriptome analysis on gastric cancer", "resolution_checked_at": "2026-11-01T15:39:54Z", "resolution_check": "identifier_resolution_only_no_download_no_licence_read", "downloaded": false, "licence_read": false}}, {"id": "data:geo:GSE33335", "role": "raw", "format": "geo-series", "media_type": "application/vnd.ncbi.geo-series+json", "uri": "https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE33335", "sha256": null, "bytes": null, "access": "open", "state": "resolved", "reader": null, "reader_status": "reader_required", "identifier": "GSE33335", "version": null, "note": "All data generated or analyzed during this study are included in this published article.", "structure": {"repository": "GEO", "access_route": "GEO accession URL", "access_statement_verbatim": "All data generated or analyzed during this study are included in this published article.", "access_statement_kind": "data_availability_statement", "sample_accessions": ["GSM824327", "GSM824328", "GSM824329", "GSM824330", "GSM824331", "GSM824332", "GSM824333", "GSM824334", "GSM824335", "GSM824336", "GSM824337", "GSM824338", "GSM824339", "GSM824340", "GSM824341", "GSM824342", "GSM824343", "GSM824344", "GSM824345", "GSM824346", "GSM824347", "GSM824348", "GSM824349", "GSM824350", "GSM824351", "GSM824352", "GSM824353", "GSM824354", "GSM824355", "GSM824356", "GSM824357", "GSM824358", "GSM824359", "GSM824360", "GSM824361", "GSM824362", "GSM824363", "GSM824364", "GSM824365", "GSM824366", "GSM824367", "GSM824368", "GSM824369", "GSM824370", "GSM824371", "GSM824372", "GSM824373", "GSM824374", "GSM824375", "GSM824376"], "sample_count": 50, "group_sizes": null, "group_sizes_basis": null, "platform": "5175", "taxon": "Homo sapiens", "title": "Expression data from gastric tissues: Cancer Samples vs. Matched Adjacent Noncancerous Samples", "resolution_checked_at": "2026-11-01T15:39:54Z", "resolution_check": "identifier_resolution_only_no_download_no_licence_read", "downloaded": false, "licence_read": false}}, {"id": "data:geo:GSE56807", "role": "raw", "format": "geo-series", "media_type": "application/vnd.ncbi.geo-series+json", "uri": "https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE56807", "sha256": null, "bytes": null, "access": "open", "state": "resolved", "reader": null, "reader_status": "reader_required", "identifier": "GSE56807", "version": null, "note": "All data generated or analyzed during this study are included in this published article.", "structure": {"repository": "GEO", "access_route": "GEO accession URL", "access_statement_verbatim": "All data generated or analyzed during this study are included in this published article.", "access_statement_kind": "data_availability_statement", "sample_accessions": ["GSM1369632", "GSM1369633", "GSM1369634", "GSM1369635", "GSM1369636", "GSM1369637", "GSM1369638", "GSM1369639", "GSM1369640", "GSM1369641"], "sample_count": 10, "group_sizes": null, "group_sizes_basis": null, "platform": "5175", "taxon": "Homo sapiens", "title": "Expression data from 5 paired of gastric cancer tissues and gastric normal tissues", "resolution_checked_at": "2026-11-01T15:39:54Z", "resolution_check": "identifier_resolution_only_no_download_no_licence_read", "downloaded": false, "licence_read": false}}, {"id": "data:geo:GSE79973", "role": "raw", "format": "geo-series", "media_type": "application/vnd.ncbi.geo-series+json", "uri": "https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE79973", "sha256": null, "bytes": null, "access": "open", "state": "resolved", "reader": null, "reader_status": "reader_required", "identifier": "GSE79973", "version": null, "note": "All data generated or analyzed during this study are included in this published article.", "structure": {"repository": "GEO", "access_route": "GEO accession URL", "access_statement_verbatim": "All data generated or analyzed during this study are included in this published article.", "access_statement_kind": "data_availability_statement", "sample_accessions": ["GSM2109532", "GSM2109533", "GSM2109534", "GSM2109535", "GSM2109536", "GSM2109537", "GSM2109538", "GSM2109539", "GSM2109540", "GSM2109541", "GSM2109542", "GSM2109543", "GSM2109544", "GSM2109545", "GSM2109546", "GSM2109547", "GSM2109548", "GSM2109549", "GSM2109550", "GSM2109551"], "sample_count": 20, "group_sizes": null, "group_sizes_basis": null, "platform": "570", "taxon": "Homo sapiens", "title": "Expression data from gastric cancer and paried normal tissues", "resolution_checked_at": "2026-11-01T15:39:55Z", "resolution_check": "identifier_resolution_only_no_download_no_licence_read", "downloaded": false, "licence_read": false}}, {"id": "asset:table:pmid:34126961:1", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:fafcef4df465a40adfb23443cee1dcc799392d81a87fbe37470fe96c63328a96", "bytes": 691, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[10]/table-wrap[1]#Tab1", "version": null, "note": "Primer sequences of PCR", "structure": {"pmcid": "PMC8201699", "section_index": 10, "section_title": "Validation of selected DEGs’ transcription in fresh GC tissue specimens using quantitative real-time PCR", "row_count": 9, "column_count": 3}, "table": {"label": "Table 1", "caption": "Primer sequences of PCR", "rows": [["gene", "Forward primer(5–3)", "Reverse primer(5–3)"], ["HMMR", "GCTAAGCAAGAAGGCATGGA", "CCACTTGATCTGAAGCACAAC"], ["SPP1", "GCCGAGGTGATAGTGTGGTT", "AACGGGGATGGCCTTGTATG"], ["FN1", "AATAGATGCAACGATCAGGACA", "GCAGGTTTCCTCGATTATCCTT"], ["CCNB1", "GACTTTGCTTTTGTGACTGACA", "CCCAGACCAAAGTTTAAAGCTC"], ["CXCL8", "AACTGAGAGTGATTGAGAGTGG", "ATGAATTCTCAGCCCTCTTCAA"], ["MAD2L1", "ACGGTGACATTTCTGCCACT", "TGGTCCCGACTCTTCCCATT"], ["CCNA2", "AGAAACAGCCAGACATCACTAA", "TTCAAACTTTGAGGCTAACAGC"], ["GAPDH", "ACAGTCAGCCGCATCTTCTT", "ACGACCAAATCCGTTGACTC"]], "row_count": 9, "column_count": 3, "numeric_cells": 2, "header_rows": 1, "locator": "section[10]/table-wrap[1]#Tab1"}}, {"id": "asset:table:pmid:34126961:2", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:ac153d28342e87083d5d90f42ae7c976f83262e1f5e87f63fb86d9374ed59615", "bytes": 1614, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[15]/table-wrap[1]#Tab2", "version": null, "note": "Details of seven selected genes", "structure": {"pmcid": "PMC8201699", "section_index": 15, "section_title": "Identification of the selected genes", "row_count": 8, "column_count": 4}, "table": {"label": "Table 2", "caption": "Details of seven selected genes", "rows": [["N", "Gene symbol", "Full name", "Function"], ["1", "HMMR", "hyaluronan mediated motility receptor", "the driver of tumor progression, plays a important role in the modulation of motor activities and the maintenance of genome stability."], ["2", "SPP1", "secreted phosphoprotein 1", "The protein encoded by this gene is involved in the attachment of osteoclasts to the mineralized bone matrix"], ["3", "FN1", "fibronectin 1", "Fibronectin 1 (FN1) is involved in cell adhesion and migration processes including embryogenesis, wound healing, blood coagulation, host defense, metastasis, and implicated in various biochemical processes."], ["4", "CCNB1", "cyclin B1", "an important regulator in cell cycle machinery, is a monitoring protein in mitosis and expressed primarily in G2/M phase which is critical for controlling the cell cycle at the G2/M (mitosis) transition"], ["5", "CXCL8", "C-X-C motif chemokine ligand 8", "a chemokine that acts as an important multifunctional cytokine to modulate tumour proliferation, invasion and migration in an autocrine or paracrine manner."], ["6", "MAD2L1", "mitotic arrest deficient 2 like 1", "a component of the mitotic spindle assembly checkpoint that prevents the onset of anaphase until all chromosomes are properly aligned at the metaphase plate"], ["7", "CCNA2", "cyclin A2", "The protein encoded by this gene belongs to the highly conserved cyclin family, whose members function as regulators of the cell cycle."]], "row_count": 8, "column_count": 4, "numeric_cells": 12, "header_rows": 1, "locator": "section[15]/table-wrap[1]#Tab2"}}, {"id": "asset:table:pmid:34126961:3", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:417fba7045466501ae80dad9a3e487634cf2c7c1b6a6f729c9391b54a3a4a073", "bytes": 3090, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[18]/table-wrap[1]#Tab3", "version": null, "note": "Analysis of 7 selected genes by GO and KEGG pathway enrichment. FDR, false discovery rate. GO, gene ontology; BP, biological process, CC, cellular component; MF, molecular function; KEGG, Kyoto Encyclopedia of Genes and Genomes; DEMs, differentially expressed miRNAs", "structure": {"pmcid": "PMC8201699", "section_index": 18, "section_title": "Analysis of 7 selected genes via gene ontology and pathway enrichment", "row_count": 22, "column_count": 7}, "table": {"label": "Table 3", "caption": "Analysis of 7 selected genes by GO and KEGG pathway enrichment. FDR, false discovery rate. GO, gene ontology; BP, biological process, CC, cellular component; MF, molecular function; KEGG, Kyoto Encyclopedia of Genes and Genomes; DEMs, differentially expressed miRNAs", "rows": [["Category", "Term", "Count", "%", "PValue", "Genes", "FDR"], ["GOTERM_BP_DIRECT", "GO:0048146 ~ positive regulation of fibroblast proliferation", "3", "0.263", "1.51E-04", "CCNB1, CCNA2, FN1", "0.174735"], ["GOTERM_BP_DIRECT", "GO:0051301 ~ cell division", "3", "0.263", "0.006147477", "CCNB1, MAD2L1, CCNA2", "6.892135"], ["GOTERM_BP_DIRECT", "GO:0051436 ~ negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle", "2", "0.175", "0.025106263", "CCNB1, MAD2L1", "25.50655"], ["GOTERM_BP_DIRECT", "GO:0051437 ~ positive regulation of ubiquitin-protein ligase activity involved in regulation of mitotic cell cycle transition", "2", "0.175", "0.026854324", "CCNB1, MAD2L1", "27.03882"], ["GOTERM_BP_DIRECT", "GO:0022617 ~ extracellular matrix disassembly", "2", "0.175", "0.026854324", "SPP1, FN1", "27.03882"], ["GOTERM_BP_DIRECT", "GO:0031145 ~ anaphase-promoting complex-dependent catabolic process", "2", "0.175", "0.027901906", "CCNB1, MAD2L1", "27.94322"], ["GOTERM_BP_DIRECT", "GO:0071456 ~ cellular response to hypoxia", "2", "0.175", "0.033820471", "CCNB1, CCNA2", "32.86331"], ["GOTERM_BP_DIRECT", "GO:0000086 ~ G2/M transition of mitotic cell cycle", "2", "0.175", "0.047971221", "CCNB1, HMMR", "43.40814"], ["GOTERM_BP_DIRECT", "GO:0042787 ~ protein ubiquitination involved in ubiquitin-dependent protein catabolic process", "2", "0.175", "0.053446406", "CCNB1, MAD2L1", "47.06463"], ["GOTERM_BP_DIRECT", "GO:0030198 ~ extracellular matrix organization", "2", "0.175", "0.068031098", "SPP1, FN1", "55.77698"], ["GOTERM_BP_DIRECT", "GO:0001525 ~ angiogenesis", "2", "0.175", "0.077092848", "CXCL8, FN1", "60.50819"], ["GOTERM_CC_DIRECT", "GO:0000922 ~ spindle pole", "2", "0.175", "0.035359174", "CCNB1, MAD2L1", "26.96429"], ["GOTERM_CC_DIRECT", "GO:0005615 ~ extracellular space", "3", "0.263", "0.067058677", "CXCL8, SPP1, FN1", "45.44016"], ["GOTERM_CC_DIRECT", "GO:0005576 ~ extracellular region", "3", "0.263", "0.092078284", "CXCL8, SPP1, FN1", "56.9647"], ["GOTERM_MF_DIRECT", "GO:0005515 ~ protein binding", "7", "0.613", "0.019847501", "CCNB1, MAD2L1, CXCL8, CCNA2, SPP1, FN1, HMMR", "13.51086"], ["KEGG_PATHWAY", "hsa04512:ECM-receptor interaction", "3", "0.263", "0.002294922", "SPP1, FN1, HMMR", "2.054976"], ["KEGG_PATHWAY", "hsa04914:Progesterone-mediated oocyte maturation", "3", "0.263", "0.002294922", "CCNB1, MAD2L1, CCNA2", "2.054976"], ["KEGG_PATHWAY", "hsa04110:Cell cycle", "3", "0.263", "0.004611117", "CCNB1, MAD2L1, CCNA2", "4.090835"], ["KEGG_PATHWAY", "hsa05146:Amoebiasis", "2", "0.175", "0.088997082", "CXCL8, FN1", "56.93087"], ["KEGG_PATHWAY", "hsa04620:Toll-like receptor signaling pathway", "2", "0.175", "0.088997082", "CXCL8, SPP1", "56.93087"], ["KEGG_PATHWAY", "hsa04114:Oocyte meiosis", "2", "0.175", "0.093026279", "CCNB1, MAD2L1", "58.62208"]], "row_count": 22, "column_count": 7, "numeric_cells": 105, "header_rows": 1, "locator": "section[18]/table-wrap[1]#Tab3"}}], "gaps": ["asset:data:geo:E-MTAB-1440 not downloaded", "asset:data:geo:E-MTAB-1440 licence not read", "asset:data:geo:GSE13911 not downloaded", "asset:data:geo:GSE13911 licence not read", "asset:data:geo:GSE19826 not downloaded", "asset:data:geo:GSE19826 licence not read", "asset:data:geo:GSE27342 not downloaded", "asset:data:geo:GSE27342 licence not read", "asset:data:geo:GSE33335 not downloaded", "asset:data:geo:GSE33335 licence not read", "asset:data:geo:GSE56807 not downloaded", "asset:data:geo:GSE56807 licence not read", "asset:data:geo:GSE79973 not downloaded", "asset:data:geo:GSE79973 licence not read"]}, "analysis": {"state": "partial", "methods": [{"id": "method-1", "family": "differential_expression", "specific": "limma_voom", "label": "Differential expression analysis", "dsl_operations": ["normalise_counts", "differential_expression_fit", "fdr_bh"], "missing_operations": [], "expressible": true, "parameters": {"fdr_threshold": "with Benjamini–Hochberg false discovery rate adjustment"}, "data_shapes": ["count_matrix_with_condition"], "evidence": {"score": 1.0, "band": "reordered", "quote": "Then the statistically significant DEGs was selected by Moderated T statistic approach with “limma [8]” and “oligo [9]” package of Bioconductor. The resulting P values were adjusted by the default Benjamini & Hochberg (BH) false discovery rate method."}}, {"id": "method-2", "family": "survival_analysis", "specific": "kaplan_meier", "label": "Survival analysis", "dsl_operations": ["survival_km"], "missing_operations": [], "expressible": true, "parameters": {}, "data_shapes": ["time_to_event_with_censoring"], "evidence": {"score": 0.7, "band": "medium", "quote": "Kaplan-Meier"}}, {"id": "method-3", "family": "network_analysis", "specific": "pathway_enrichment", "label": "Network / pathway analysis", "dsl_operations": ["pathway_enrich"], "missing_operations": [], "expressible": true, "parameters": {}, "data_shapes": ["edge_list"], "evidence": {"score": 0.8, "band": "high", "quote": "pathway enrichment"}}], "targets": [], "gaps": ["method.reader_differs_from_extractor"]}, "capability": {"state": "complete", "requirements": [{"capability_id": "capability:computational_analysis", "label": "Computational analysis platform", "assay_families": ["meta_analysis", "machine_learning", "survival_analysis", "statistical_regression", "pca", "molecular_docking", "network_analysis", "differential_expression", "gwas"], "availability_state": "owned", "tier_unlocked": "R1", "candidate": "Automated Assays Laravel application and simulated adapters"}], "gaps": []}, "readiness": {"state": "complete", "tier": "R1", "blocking_axis": "none", "blocked_on": "nothing:replicable_now", "axes": {"method": {"tier": "R1", "expressible": true, "required_operations": ["normalise_counts", "differential_expression_fit", "fdr_bh"], "missing_operations": [], "basis": "The paper names the method it used and the corpus's method extractor maps it onto the DSL catalogue: limma_voom."}, "capability": {"tier": "R1", "capability_id": "capability:computational_analysis", "availability_state": "owned", "basis": "The computational analysis is owned. The physical bench the paper used is not, so a physical validation cannot be run here."}, "data": {"tier": "R1", "reachable": true, "accessions": ["E-MTAB-1440", "GSE79973", "GSE19826", "GSE13911", "GSE27342", "GSE33335", "GSE56807"], "resolved_accessions": ["E-MTAB-1440", "GSE79973", "GSE19826", "GSE13911", "GSE27342", "GSE33335", "GSE56807"], "statements": ["All data generated or analyzed during this study are included in this published article."], "basis": "The paper names E-MTAB-1440, GSE79973, GSE19826, GSE13911, GSE27342, GSE33335, GSE56807 in Arrayexpress and the accession resolves in the repository. No dataset was downloaded and no licence was read."}}, "can_run": {"dsl_operations": ["normalise_counts", "differential_expression_fit", "fdr_bh"], "assets": ["source:pmid:34126961", "data:geo:E-MTAB-1440", "asset:table:pmid:34126961:1", "asset:table:pmid:34126961:2", "asset:table:pmid:34126961:3"], "steps": ["run_analysis"]}, "must_build": {"dsl_operations": [], "converters": [], "readers": [], "capabilities": [], "data_gaps": ["data:geo:E-MTAB-1440"]}, "gaps": []}, "review": {"state": "partial", "machine_critique": {"kind": "extraction_review", "reader": {"model": "MiniMax-M3.1-Flash", "provider": "minimax", "provider_family": "minimax", "read_at": "2026-10-31T18:31:03Z", "independence": "single_reader"}, "evidence_check": {"method": "reordered", "availability": "verbatim"}, "calls": 3, "usage": {"prompt_tokens": 29409, "completion_tokens": 2530, "cached_tokens": 776}}, "human_critique": null, "stages": [{"id": "extraction", "state": "complete", "reader": "MiniMax-M3.1-Flash", "provider": "minimax"}], "gaps": ["review.independent_reader", "review.machine_critique", "review.human_critique"]}, "execution": {"state": "absent", "status": "not_run", "mode": null, "runs": [], "gaps": ["execution.not_run"]}, "provenance": {"entities": [{"id": "pmid:34126961", "type": "paper", "label": "pmid:34126961"}, {"id": "source:pmid:34126961", "type": "manuscript", "label": "PMID 34126961 full text"}, {"id": "data:geo:E-MTAB-1440", "type": "dataset", "label": "GEO E-MTAB-1440"}], "activities": [{"id": "activity-reading-sci-2026-11-01", "type": "classification", "used": [{"id": "pmid:34126961", "type": "paper", "label": "pmid:34126961"}, {"id": "source:pmid:34126961", "type": "manuscript", "label": "PMID 34126961 full text"}, {"id": "data:geo:E-MTAB-1440", "type": "dataset", "label": "GEO E-MTAB-1440"}], "agent": "agent:corpus-assay-engine"}, {"id": "activity-read-34126961", "type": "extraction", "used": ["source:pmid:34126961"], "agent": "agent:minimax-reader"}, {"id": "activity-resolve-E-MTAB-1440", "type": "accession_resolution", "used": ["data:geo:E-MTAB-1440"], "agent": "agent:corpus-assay-engine"}], "agents": [{"id": "agent:corpus-assay-engine", "type": "software", "label": "Corpus assay engine"}, {"id": "agent:minimax-reader", "type": "software", "label": "MiniMax literature reader"}], "source_run_id": "reading-sci-2026-11-01", "dsl_catalogue_fingerprint": "343fb30756ba6ec3", "capability_table_fingerprint": "2cb3e42f047d2ecf", "snapshot_id": "ba34b49490d9bfaf"}, "lineage": {"parent_id": "pmid:34126961", "parent_hash": "sha256:4d8a86e20fdc2835ef0e1cb38a534b3fb2a8b5078fe843c188036b52e888dad4", "fork_of": null, "generation": 7}, "gaps": ["asset:data:geo:E-MTAB-1440 licence not read", "asset:data:geo:E-MTAB-1440 not downloaded", "asset:data:geo:GSE13911 licence not read", "asset:data:geo:GSE13911 not downloaded", "asset:data:geo:GSE19826 licence not read", "asset:data:geo:GSE19826 not downloaded", "asset:data:geo:GSE27342 licence not read", "asset:data:geo:GSE27342 not downloaded", "asset:data:geo:GSE33335 licence not read", "asset:data:geo:GSE33335 not downloaded", "asset:data:geo:GSE56807 licence not read", "asset:data:geo:GSE56807 not downloaded", "asset:data:geo:GSE79973 licence not read", "asset:data:geo:GSE79973 not downloaded", "execution.not_run", "method.reader_differs_from_extractor", "review.human_critique", "review.independent_reader", "review.machine_critique"], "assays": [{"role": "data_generation", "definition_id": "microarray", "definition_version": "99e1195c7d6f", "definition_digest": null, "required_operations": [], "support_state": "partial", "source_hashes": {"assay_lexicon": "99e1195c7d6f"}, "confidence": 0.93, "evidence": ["bioconductor.org/) in R (version 3.6.0). The microarray data were first preprocessed using the RMA ("], "order_basis": "paper_text_order:1836", "id": "assay:1"}, {"role": "analysis", "definition_id": "differential_expression", "definition_version": "f2132e96ae6c7a4e", "definition_digest": null, "required_operations": ["normalise_counts", "differential_expression_fit", "fdr_bh"], "support_state": "supported", "source_hashes": {"dsl_catalogue": "f2132e96ae6c7a4e"}, "confidence": 1.0, "evidence": ["Then the statistically significant DEGs was selected by Moderated T statistic approach with “limma [8]” and “oligo [9]” package of Bioconductor. The resulting P values were adjusted by the default Benjamini & Hochberg (BH) false discovery rate method."], "order_basis": "consumes_earlier_output", "id": "assay:2"}]}