Potential prognostic markers and significant lncRNA-mRNA co-expression pairs in laryngeal squamous cell carcinoma.

{"sci_version": "1.2", "schema": "https://corpus.bntrg.co.uk/sci/1.0/sci.schema.json", "id": "pmid:34131588", "kind": "science-record", "revision": 7, "content_hash": "sha256:caee9b6568685da15d1b4c08c4133dce5811fa440e80661c928d725e6db65d84", "created_at": "2026-11-01T15:41:39Z", "updated_at": "2026-11-01T22:03:58Z", "generator": {"name": "corpus-assay-engine", "run_id": "reading-sci-2026-11-01"}, "paper": {"state": "complete", "title": "Potential prognostic markers and significant lncRNA-mRNA co-expression pairs in laryngeal squamous cell carcinoma.", "doi": "10.1515/biol-2021-0052", "pmid": "34131588", "authors": ["Junguo Wang", "Dingding Liu", "Yajun Gu", "Han Zhou", "Hui Li", "Xiaohui Shen", "Xiaoyun Qian"], "journal": "Open life sciences", "year": 2021, "abstract": "lncRNA-mRNA co-expression pairs and prognostic markers related to the development of laryngeal squamous cell carcinoma (LSCC) were investigated. The lncRNA and mRNA expression data of LSCC in GSE84957 and RNA-seq data of 112 LSCC samples from TCGA database were used. Differentially expressed genes (DEGs) and lncRNAs (DE-lncRNAs) between LSCC and para-cancer tissues were identified. Co-expression analysis of DEGs and DE-lncRNA was conducted. Protein-protein interaction network for co-expressed DEGs of top 25 DE-lncRNA was constructed, followed by survival analysis for key nodes in co-expression network. Finally, expressions of several DE-lncRNAs and DEGs were verified using qRT-PCR. The lncRNA-mRNA network showed that ANKRD20A5P, C21orf15, CYP4F35P, LOC_I2_011146, XLOC_006053, XLOC_I2_003881, and LOC100506027 were highlighted in network. Some DEGs, including FUT7, PADI1, PPL, ARHGAP40, MUC21, and CEACAM1, were co-expressed with above lncRNAs. Survival analysis showed that PLOD1, GLT25D1, and KIF22 were significantly associated with prognosis. qRT-PCR results showed that the expressions of MUC21, CEACAM1, FUT7, PADI1, PPL, ARHGAP40, ANKRD20A5P, C21orf15, CYP4F35P, XLOC_I2_003881, LOC_I2_011146, and XLOC_006053 were downregulated, whereas the expression of LOC100506027 was upregulated in LSCC tissues. PLOD1, GLT25D1, and KIF22 may be potential prognostic markers in the development of LSCC. C21orf15-MUC21/CEACAM1/FUT7/PADI1/PPL/ARHGAP40 are potential lncRNA-mRNA pairs that play significant roles in the development of LSCC.", "claims": [{"id": "claim-data-access", "statement": "Data availability statement: The datasets generated during and/or analyzed during the current study are available from the corresponding author on reasonable request.", "kind": "methodological", "target": null, "evidence": [{"asset": "source:pmid:34131588", "locator": "sections[23] \"fn-group\" paragraph 1", "quote": "Data availability statement: The datasets generated during and/or analyzed during the current study are available from the corresponding author on reasonable request."}], "state": "complete"}], "gaps": []}, "experiment": {"state": "complete", "objective": null, "steps": [{"id": "read_published_estimate", "order": 1, "name": "Read the published estimate from the source", "kind": "other", "state": "complete", "blocked_on": null, "description": "The claim, method and evidence span published with the source article.", "duration_hours": null, "parameters": {}, "inputs": ["source:pmid:34131588"], "outputs": ["the published estimate and its evidence"], "instruments": [], "reagents": []}, {"id": "obtain_source_data", "order": 2, "name": "Obtain the source data from the named repository", "kind": "data-preparation", "state": "complete", "blocked_on": null, "description": "The GEO series accession resolves and its sample accessions are listed. This lane did not download the dataset or read its licence.", "duration_hours": null, "parameters": {}, "inputs": ["data:geo:GSE84957"], "outputs": ["the source data with its repository provenance"], "instruments": [], "reagents": []}, {"id": "run_analysis", "order": 3, "name": "Run the published analysis", "kind": "analysis", "state": "complete", "blocked_on": null, "description": "Apply the paper's statistical method to the resolved series and compare the result with the published target.", "duration_hours": null, "parameters": {}, "inputs": ["data:geo:GSE84957"], "outputs": ["the replicated result and its comparison"], "instruments": [], "reagents": []}], "materials": [], "instruments": [], "reagents": [], "conditions": {}, "gaps": []}, "data": {"state": "partial", "assets": [{"id": "source:pmid:34131588", "role": "manuscript", "format": "xml", "media_type": "application/xml", "uri": "https://doi.org/10.1515/biol-2021-0052", "sha256": "sha256:47f380ad891737133fe94ff487cfda54cc44920749296b9f3ba906c31d846b85", "bytes": 28599, "access": "open", "state": "resolved", "reader": null, "reader_status": "reader_required", "identifier": "10.1515/biol-2021-0052", "version": null, "note": "Full article fetched from PMC; the checksum covers the rendered section body, not the original XML bytes.", "structure": {"pmcid": "PMC8174121", "source": "europe_pmc_fulltext", "coverage": "whole_body_without_references", "text_hash_scope": "rendered_section_body"}}, {"id": "data:geo:GSE84957", "role": "raw", "format": "geo-series", "media_type": "application/vnd.ncbi.geo-series+json", "uri": "https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE84957", "sha256": null, "bytes": null, "access": "open", "state": "resolved", "reader": null, "reader_status": "reader_required", "identifier": "GSE84957", "version": null, "note": "Data availability statement: The datasets generated during and/or analyzed during the current study are available from the corresponding author on reasonable request.", "structure": {"repository": "GEO", "access_route": "GEO accession URL", "access_statement_verbatim": "Data availability statement: The datasets generated during and/or analyzed during the current study are available from the corresponding author on reasonable request.", "access_statement_kind": "data_availability_statement", "sample_accessions": ["GSM2254690", "GSM2254691", "GSM2254692", "GSM2254693", "GSM2254694", "GSM2254695", "GSM2254696", "GSM2254697", "GSM2254698", "GSM2254699", "GSM2254700", "GSM2254701", "GSM2254702", "GSM2254703", "GSM2254704", "GSM2254705", "GSM2254706", "GSM2254707"], "sample_count": 18, "group_sizes": null, "group_sizes_basis": null, "platform": "17843", "taxon": "Homo sapiens", "title": "Long Noncoding RNA and mRNA Expression Profile in Laryngeal Squamous Cell Carcinoma", "resolution_checked_at": "2026-11-01T15:39:55Z", "resolution_check": "identifier_resolution_only_no_download_no_licence_read", "downloaded": false, "licence_read": false}}, {"id": "asset:table:pmid:34131588:1", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:c2e16c343ad8482527b93e5402b3886134cbcf76c0ca3866a93c594750137ebe", "bytes": 1356, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[11]/table-wrap[1]#j_biol-2021-0052_tab_001", "version": null, "note": "The primer sequences of genes", "structure": {"pmcid": "PMC8174121", "section_index": 11, "section_title": "qRT-PCR analysis", "row_count": 29, "column_count": 2}, "table": {"label": "Table 1", "caption": "The primer sequences of genes", "rows": [["Gene names", "Primer sequences (5′–3′)"], ["CYP4F35P-hF", "TCCAGAGCAGGACAAAGAGG"], ["CYP4F35P-hR", "AACCACCAAACAGTCAGCAGT"], ["C21orf15-hF", "GCCGTGCCCTACAGACC"], ["C21orf15-hR", "CTTGATGCCTTAGACCTCCC"], ["ANKRD20A5P-hF", "ATGGAAGATCCTGCTGTGAA"], ["ANKRD20A5P-hR", "TCCTCTGAAGCCACTGGTAAG"], ["XLOC_006053-hF", "CAGCCTGACCATTCCCTT"], ["XLOC_006053-hR", "GCAGTCTGGTGGTTCTTATTCTA"], ["XLOC_l2_003881-hF", "TGCGTGGCTGCCTCTTA"], ["XLOC_l2_003881-hR", "GCATCACTCCTGGGTGTCTT"], ["XLOC_l2_011146-hF", "GTCTTCCTGAAGCCACACAGA"], ["XLOC_l2_011146-hR", "TCCTCCAGAGTCTCCCATTAAA"], ["LOC100506027-hF", "ACAGCGATACCAGGCAGAC"], ["LOC100506027-hR", "GCATTCGTGGCGATAAGG"], ["MUC21-hF", "GAATGCACACAACTTCCCATAGT"], ["MUC21-hR", "GGCTATCGAGGATACTGGTCTC"], ["CEACAM1-hF", "GATCCTATACCTGCCACGCC"], ["CEACAM1-hR", "CCTGTGACTGTGGTCTTGCT"], ["FUT7-hF", "CACCTGAGTGCCAACCGAA"], ["FUT7-hR", "CACCCAGTTGAAGATGCCTCG"], ["PADI1-hF", "TGCAGACATGGTCGTATCTGT"], ["PADI1-hR", "GCCCAGAGCTTGGTCTTCC"], ["PPL-hF", "CCGGAGCATCTCTAACAAGGA"], ["PPL-hR", "GCATCCGCCTCTAGCACAT"], ["ARHGAP40-hF", "AGCCTTCAACATGGACTCTGC"], ["ARHGAP40-hR", "TTTGGGGACGGTAAACTTCGG"], ["GAPDH-hF", "TGACAACTTTGGTATCGTGGAAGG"], ["GAPDH-hR", "AGGCAGGGATGATGTTCTGGAGAG"]], "row_count": 29, "column_count": 2, "numeric_cells": 19, "header_rows": 1, "locator": "section[11]/table-wrap[1]#j_biol-2021-0052_tab_001"}}, {"id": "asset:table:pmid:34131588:2", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:6328c9241250e4ced2f33cd1832bd5dbde4091bb14a066c8ddfe07a674f4750d", "bytes": 1157, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[24]/table-wrap[1]#j_biol-2021-0052_tab_002", "version": null, "note": "The characteristics of the patients from Gulou hospital", "structure": {"pmcid": "PMC8174121", "section_index": 24, "section_title": "app-group", "row_count": 6, "column_count": 10}, "table": {"label": "Table A1", "caption": "The characteristics of the patients from Gulou hospital", "rows": [["Patients", "Diagnosis", "Surgery", "Age (years)", "Sex", "Smoking", "Drinking", "Tumor size", "TNM stage", "Lymph node metastasis"], ["P1", "LSCC, dyspnea", "Total laryngectomy and bilateral neck dissection", "45", "Male", "Yes, smoking for 30 years", "Yes", "3.5 cm × 2 cm × 1 cm", "IVA (T4aN2bcM0)", "N2b"], ["P2", "LSCC, dyspnea", "Total laryngectomy and bilateral neck dissection", "63", "Male", "Yes, smoking for 40 years", "No", "3 cm × 2.5 cm × 1 cm", "IVA (T4aN2bcM0)", "N1"], ["P3", "LSCC", "Total laryngectomy and bilateral neck dissection", "79", "Male", "Yes, smoking for 60 years", "No", "3 cm × 2 cm × 0.6 cm", "IVA (T4aN2bcM0)", "N0"], ["P4", "LSCC", "Total laryngectomy and left neck dissection", "64", "Male", "Yes, smoking for 30 years", "Yes", "3.5 cm × 3 cm × 1.5 cm", "IVA (T4aN2bcM0)", "N0"], ["P5", "LSCC", "Total laryngectomy and right neck dissection", "70", "Male", "Yes, smoking for 50 years", "Yes", "2.5 cm × 1.4 cm × 1 cm", "III (T3N0cM0)", "N0"]], "row_count": 6, "column_count": 10, "numeric_cells": 15, "header_rows": 1, "locator": "section[24]/table-wrap[1]#j_biol-2021-0052_tab_002"}}], "gaps": ["asset:data:geo:GSE84957 not downloaded", "asset:data:geo:GSE84957 licence not read"]}, "analysis": {"state": "complete", "methods": [{"id": "method-1", "family": "correlation_analysis", "specific": "pearson", "label": "Correlation analysis", "dsl_operations": ["pearson_r"], "missing_operations": [], "expressible": true, "parameters": {}, "data_shapes": ["paired_numeric_columns"], "evidence": {"score": 0.8, "band": "high", "quote": "pearson correlation"}}, {"id": "method-2", "family": "network_analysis", "specific": "ppi_network", "label": "Network / pathway analysis", "dsl_operations": ["build_graph", "centrality_scores", "pathway_enrich"], "missing_operations": [], "expressible": true, "parameters": {}, "data_shapes": ["edge_list"], "evidence": {"score": 0.7, "band": "medium", "quote": "Protein-protein interaction"}}], "targets": [], "gaps": []}, "capability": {"state": "complete", "requirements": [{"capability_id": "capability:computational_analysis", "label": "Computational analysis platform", "assay_families": ["meta_analysis", "machine_learning", "survival_analysis", "statistical_regression", "pca", "molecular_docking", "network_analysis", "differential_expression", "gwas"], "availability_state": "owned", "tier_unlocked": "R1", "candidate": "Automated Assays Laravel application and simulated adapters"}], "gaps": []}, "readiness": {"state": "complete", "tier": "R1", "blocking_axis": "none", "blocked_on": "nothing:replicable_now", "axes": {"method": {"tier": "R1", "expressible": true, "required_operations": ["pearson_r"], "missing_operations": [], "basis": "The paper names the method it used and the corpus's method extractor maps it onto the DSL catalogue: pearson."}, "capability": {"tier": "R1", "capability_id": "capability:computational_analysis", "availability_state": "owned", "basis": "The computational analysis is owned. The physical bench the paper used is not, so a physical validation cannot be run here."}, "data": {"tier": "R1", "reachable": true, "accessions": ["GSE84957"], "resolved_accessions": ["GSE84957"], "statements": ["Data availability statement: The datasets generated during and/or analyzed during the current study are available from the corresponding author on reasonable request."], "basis": "The paper names GSE84957 in Gene Expression Omnibus (GEO) and the accession resolves in the repository. No dataset was downloaded and no licence was read."}}, "can_run": {"dsl_operations": ["pearson_r"], "assets": ["source:pmid:34131588", "data:geo:GSE84957", "asset:table:pmid:34131588:1", "asset:table:pmid:34131588:2"], "steps": ["run_analysis"]}, "must_build": {"dsl_operations": [], "converters": [], "readers": [], "capabilities": [], "data_gaps": ["data:geo:GSE84957"]}, "gaps": []}, "review": {"state": "partial", "machine_critique": {"kind": "extraction_review", "reader": {"model": "MiniMax-M3.1-Flash", "provider": "minimax", "provider_family": "minimax", "read_at": "2026-10-31T19:37:31Z", "independence": "single_reader"}, "evidence_check": {"method": null, "availability": "verbatim"}, "calls": 3, "usage": {"prompt_tokens": 24369, "completion_tokens": 1821, "cached_tokens": 520}}, "human_critique": null, "stages": [{"id": "extraction", "state": "complete", "reader": "MiniMax-M3.1-Flash", "provider": "minimax"}], "gaps": ["review.independent_reader", "review.machine_critique", "review.human_critique"]}, "execution": {"state": "absent", "status": "not_run", "mode": null, "runs": [], "gaps": ["execution.not_run"]}, "provenance": {"entities": [{"id": "pmid:34131588", "type": "paper", "label": "pmid:34131588"}, {"id": "source:pmid:34131588", "type": "manuscript", "label": "PMID 34131588 full text"}, {"id": "data:geo:GSE84957", "type": "dataset", "label": "GEO GSE84957"}], "activities": [{"id": "activity-reading-sci-2026-11-01", "type": "classification", "used": [{"id": "pmid:34131588", "type": "paper", "label": "pmid:34131588"}, {"id": "source:pmid:34131588", "type": "manuscript", "label": "PMID 34131588 full text"}, {"id": "data:geo:GSE84957", "type": "dataset", "label": "GEO GSE84957"}], "agent": "agent:corpus-assay-engine"}, {"id": "activity-read-34131588", "type": "extraction", "used": ["source:pmid:34131588"], "agent": "agent:minimax-reader"}, {"id": "activity-resolve-GSE84957", "type": "accession_resolution", "used": ["data:geo:GSE84957"], "agent": "agent:corpus-assay-engine"}], "agents": [{"id": "agent:corpus-assay-engine", "type": "software", "label": "Corpus assay engine"}, {"id": "agent:minimax-reader", "type": "software", "label": "MiniMax literature reader"}], "source_run_id": "reading-sci-2026-11-01", "dsl_catalogue_fingerprint": "343fb30756ba6ec3", "capability_table_fingerprint": "2cb3e42f047d2ecf", "snapshot_id": "ba34b49490d9bfaf"}, "lineage": {"parent_id": "pmid:34131588", "parent_hash": "sha256:f7541c1870fd33c8cc1f2e6356067ec0135094507193af2cb1e8864ba684404b", "fork_of": null, "generation": 6}, "gaps": ["asset:data:geo:GSE84957 licence not read", "asset:data:geo:GSE84957 not downloaded", "execution.not_run", "review.human_critique", "review.independent_reader", "review.machine_critique"], "assays": [{"role": "analysis", "definition_id": "correlation_analysis", "definition_version": "f2132e96ae6c7a4e", "definition_digest": null, "required_operations": ["pearson_r"], "support_state": "supported", "source_hashes": {"dsl_catalogue": "f2132e96ae6c7a4e"}, "confidence": 0.8, "evidence": ["pearson correlation"], "order_basis": "analysis_only", "id": "assay:1"}]}