Bioinformatics Analysis Identifies Potential Ferroptosis Key Genes in the Pathogenesis of Intracerebral Hemorrhage.

{"sci_version": "1.2", "schema": "https://corpus.bntrg.co.uk/sci/1.0/sci.schema.json", "id": "pmid:34163322", "kind": "science-record", "revision": 7, "content_hash": "sha256:7e5efb7ecd663df215e153684f87b435ae33faa2a8c3185133d7ceea633ada00", "created_at": "2026-11-01T15:41:39Z", "updated_at": "2026-11-01T22:04:01Z", "generator": {"name": "corpus-assay-engine", "run_id": "reading-sci-2026-11-01"}, "paper": {"state": "complete", "title": "Bioinformatics Analysis Identifies Potential Ferroptosis Key Genes in the Pathogenesis of Intracerebral Hemorrhage.", "doi": "10.3389/fnins.2021.661663", "pmid": "34163322", "authors": ["Tongye Liu", "Xinhe Li", "Yiteng Cui", "Pingping Meng", "Guanghui Zeng", "Yuyang Wang", "Qiang Wang"], "journal": "Frontiers in neuroscience", "year": 2021, "abstract": "Intracerebral hemorrhage (ICH) is a dangerous neurological disease. The mechanism of ferroptosis in ICH remains unclear. Using bioinformatics analysis, we aimed to identify the key molecules involved in ferroptosis and provide treatment targets for ICH to further explore the mechanism of ferroptosis in ICH. GSE24265 was downloaded from the Gene Expression Omnibus (GEO) dataset and intersected with ferroptosis genes. A total of 45 differentially expressed genes (DEGs) were selected, most of which were involved in the TNF signaling pathway and oxidative stress response. Key modules constructed by the protein-protein interaction (PPI) network analysis and screening of genes related to the TNF signaling pathway led to the confirmation of the following genes of interest: MAPK1, MAPK8, TNFAIP3, ATF4, and SLC2A1. Moreover, MAPK1 was one of the key genes related to TNF signaling and oxidative stress, and it may play an important role in ferroptosis after cerebral hemorrhage. The MAPK1-related molecules included hsa-miR-15b-5P, hsa-miR-93-5P, miR-20b-5p, SNHG16, XIST, AC084219.4, RP11-379K17.11, CTC-444N24.11, GS1-358P8.4, CTB-89H12.4, RP4-773N10.5, and FGD5-AS1. We also generated a hemorrhage rat model, which was used to conduct exercise intervention in ICH rats, and qRT-PCR was used to assess the expression levels of our genes of interest. The mRNA levels after cerebral hemorrhage showed that MAPK1, ATF4, SLC2A1, and TNFAIP3 were upregulated, whereas MAPK8 was downregulated. Treadmill training increased the expression of anti-inflammatory molecules TNFAIP3 and SLC2A1 and reduced the expression of MAPK1, ATF4, and MAPK8, indicating that treadmill training may be utilized as antioxidant therapy to decrease neuronal ferroptosis. The results of this study indicated that the MAPK1-related mRNA-miRNA-lncRNA interaction chain could be potentially employed as a biomarker of the inception and progression of ferroptosis after cerebral hemorrhage.", "claims": [{"id": "claim-method", "statement": "T test was employed to determine p-values and adjusted p-values in the differential gene expression (DGE) analysis.", "kind": "methodological", "target": null, "evidence": [{"asset": "source:pmid:34163322", "locator": "sections[7] \"Differential Expression Analysis\" paragraph 2", "quote": "T test was employed to determine p-values and adjusted p-values in the differential gene expression (DGE) analysis."}], "state": "complete"}, {"id": "claim-data-access", "statement": "Publicly available datasets were analyzed in this study. This data can be found here: FerrDb (http://www.zhounan.org/ferrdb/) and https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE24265.", "kind": "methodological", "target": null, "evidence": [{"asset": "source:pmid:34163322", "locator": "sections[22] \"Data Availability Statement\" paragraph 2", "quote": "Publicly available datasets were analyzed in this study. This data can be found here: FerrDb (http://www.zhounan.org/ferrdb/) and https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE24265."}], "state": "complete"}], "gaps": []}, "experiment": {"state": "complete", "objective": null, "steps": [{"id": "read_published_estimate", "order": 1, "name": "Read the published estimate from the source", "kind": "other", "state": "complete", "blocked_on": null, "description": "The claim, method and evidence span published with the source article.", "duration_hours": null, "parameters": {}, "inputs": ["source:pmid:34163322"], "outputs": ["the published estimate and its evidence"], "instruments": [], "reagents": []}, {"id": "obtain_source_data", "order": 2, "name": "Obtain the source data from the named repository", "kind": "data-preparation", "state": "complete", "blocked_on": null, "description": "The GEO series accession resolves and its sample accessions are listed. This lane did not download the dataset or read its licence.", "duration_hours": null, "parameters": {}, "inputs": ["data:geo:GSE24265"], "outputs": ["the source data with its repository provenance"], "instruments": [], "reagents": []}, {"id": "run_analysis", "order": 3, "name": "Run the published analysis", "kind": "analysis", "state": "complete", "blocked_on": null, "description": "Apply the paper's statistical method to the resolved series and compare the result with the published target.", "duration_hours": null, "parameters": {}, "inputs": ["data:geo:GSE24265"], "outputs": ["the replicated result and its comparison"], "instruments": [], "reagents": []}], "materials": [], "instruments": [], "reagents": [], "conditions": {}, "gaps": []}, "data": {"state": "partial", "assets": [{"id": "source:pmid:34163322", "role": "manuscript", "format": "xml", "media_type": "application/xml", "uri": "https://doi.org/10.3389/fnins.2021.661663", "sha256": "sha256:552df5fe45f26d83e6601fa30f5698eb88cdb7a2d44f5c52134e6fc2714062fe", "bytes": 46707, "access": "open", "state": "resolved", "reader": null, "reader_status": "reader_required", "identifier": "10.3389/fnins.2021.661663", "version": null, "note": "Full article fetched from PMC; the checksum covers the rendered section body, not the original XML bytes.", "structure": {"pmcid": "PMC8215678", "source": "europe_pmc_fulltext", "coverage": "whole_body", "text_hash_scope": "rendered_section_body"}}, {"id": "data:geo:GSE24265", "role": "raw", "format": "geo-series", "media_type": "application/vnd.ncbi.geo-series+json", "uri": "https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE24265", "sha256": null, "bytes": null, "access": "open", "state": "resolved", "reader": null, "reader_status": "reader_required", "identifier": "GSE24265", "version": null, "note": "Publicly available datasets were analyzed in this study. This data can be found here: FerrDb (http://www.zhounan.org/ferrdb/) and https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE24265.", "structure": {"repository": "GEO", "access_route": "GEO accession URL", "access_statement_verbatim": "Publicly available datasets were analyzed in this study. This data can be found here: FerrDb (http://www.zhounan.org/ferrdb/) and https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE24265.", "access_statement_kind": "data_availability_statement", "sample_accessions": ["GSM596842", "GSM596843", "GSM596844", "GSM596845", "GSM596846", "GSM596847", "GSM596848", "GSM596849", "GSM596850", "GSM596851", "GSM596852"], "sample_count": 11, "group_sizes": null, "group_sizes_basis": null, "platform": "570", "taxon": "Homo sapiens", "title": "Expression data from human brain samples", "resolution_checked_at": "2026-11-01T15:39:54Z", "resolution_check": "identifier_resolution_only_no_download_no_licence_read", "downloaded": false, "licence_read": false}}, {"id": "asset:table:pmid:34163322:1", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:23107f559efeaee3c262a2c6b0ff22be678c3915efffb54978f6afe801128a8c", "bytes": 605, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[12]/table-wrap[1]#T1", "version": null, "note": "Specific primers used for quantitative real-time PCR.", "structure": {"pmcid": "PMC8215678", "section_index": 12, "section_title": "qRT-PCR Analysis", "row_count": 7, "column_count": 3}, "table": {"label": "TABLE 1", "caption": "Specific primers used for quantitative real-time PCR.", "rows": [["Gene", "Forward (5′–3′)", "Reverse (5′–3′)"], ["MAPK1", "CCTTGACCAGCTGAATCACATC", "TCAGCGTTTGGGAACAACCT"], ["MAPK8", "GCTGGTGATAGATGCGTCCAA", "TCCTCTATTGTGTGCTCCCTTTC"], ["SLC2A1", "CAGCTGCCCTGGATGTCCTA", "GAAGCCAGCCACAGCAACA"], ["TNFAIP3", "CATCCTCAGAAGACCCATCATTG", "CCAAGGACGATGGGATATCTGT"], ["ATF4", "AGGTGGCCAAGCACTTCAAA", "GGTCCATTTTCTCCAACATCCA"], ["GAPDH", "CAGCCGCATCTTCTTGTGC", "GGTAACCAGGCGTCCGATA"]], "row_count": 7, "column_count": 3, "numeric_cells": 2, "header_rows": 1, "locator": "section[12]/table-wrap[1]#T1"}}, {"id": "asset:table:pmid:34163322:2", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:a69f02a02e55a11f7483bb84572db98f3f2e022b0556bc918b1bf85f7f307a39", "bytes": 3384, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[15]/table-wrap[1]#T2", "version": null, "note": "Ferroptosis differentially expressed genes of intracerebral hemorrhage.", "structure": {"pmcid": "PMC8215678", "section_index": 15, "section_title": "Ferroptosis DEGs", "row_count": 45, "column_count": 5}, "table": {"label": "TABLE 2", "caption": "Ferroptosis differentially expressed genes of intracerebral hemorrhage.", "rows": [["Gene symbol", "P-value", "Fold change", "Gene title", "ID"], ["Upregulated genes"], ["CD44", "0.0121", "1.87", "CD44 molecule (Indian blood group)", "204490_s_at"], ["HSPB1", "0.00249", "1.52", "Heat shock protein family B (small) member 1", "201841_s_at"], ["BID", "0.0351", "1.01", "BH3 interacting domain death agonist", "211725_s_at"], ["PANX1", "0.0292", "1.04", "Pannexin 1", "204715_at"], ["ACSL3", "0.00585", "1.19", "Acyl-CoA synthetase long-chain family member 3", "201662_s_at"], ["SQSTM1", "0.0343", "1.9", "Sequestosome 1", "244804_at"], ["ATF3", "0.00167", "1.07", "Activating transcription factor 3", "1554980_a_at"], ["PLIN2", "0.00476", "3.12", "Perilipin 2", "209122_at"], ["CRYAB", "0.0327", "1.42", "Crystallin alpha B", "209283_at"], ["SLC2A3", "2E-05", "2.35", "Solute carrier family 2 member 3", "216236_s_at"], ["NCF2", "0.00424", "2.54", "Neutrophil cytosolic factor 2", "209949_at"], ["NRAS", "0.0211", "1.36", "Neuroblastoma RAS viral oncogene homolog", "202647_s_at"], ["FTL", "0.00021", "1.38", "Ferritin light chain", "213187_x_at"], ["SCD", "0.0245", "1.14", "Stearoyl-CoA desaturase", "211162_x_at"], ["STAT3", "0.00035", "1.37", "Signal transducer and activator of transcription 3", "208992_s_at"], ["CAPG", "0.0134", "1.23", "Capping actin protein, gelsolin-like", "201850_at"], ["PTGS2", "0.0326", "1.9", "Prostaglandin-endoperoxide synthase 2", "1554997_a_at"], ["DUSP1", "0.0222", "1.4", "Dual specificity phosphatase 1", "201041_s_at"], ["GCH1", "0.00934", "1.98", "GTP cyclohydrolase 1", "204224_s_at"], ["GABPB1", "0.0046", "1.43", "GA binding protein transcription factor beta subunit 1", "206173_x_at"], ["VEGFA", "0.004", "1.53", "Vascular endothelial growth factor A", "210513_s_at"], ["ATF4", "0.00232", "1.14", "Activating transcription factor 4", "200779_at"], ["TNFAIP3", "0.00036", "3.04", "TNF alpha induced protein 3", "202644_s_at"], ["IL6", "0.00848", "2.58", "Interleukin 6", "205207_at"], ["SLC2A1", "0.00126", "1.11", "Solute carrier family 2 member 1", "201250_s_at"], ["HMOX1", "0.00117", "2.21", "Heme oxygenase 1", "203665_at"], ["DDIT4", "0.0336", "1.29", "DNA damage inducible transcript 4", "202887_s_at"], ["MAPK1", "0.00438", "1.38", "Mitogen-activated protein kinase 1", "1552263_at"], ["CXCL2", "0.00445", "3.99", "C-X-C motif chemokine ligand 2", "209774_x_at"], ["DDIT3", "0.00075", "1.45", "DNA damage inducible transcript 3", "209383_at"], ["HSPA5", "0.0063", "1.7", "Heat shock protein family A (Hsp70) member 5", "211936_at"], ["CAV1", "0.00487", "1.47", "Caveolin 1", "203065_s_at"], ["CEBPG", "0.00961", "1.15", "CCAAT/enhancer binding protein gamma", "204203_at"], ["AKR1C1", "0.0001", "1.07", "Aldo-keto reductase family 1 member C1", "216594_x_at"], ["RPL8", "0.00027", "1.28", "Ribosomal protein L8", "200936_at"], ["SESN2", "0.0388", "1.04", "Sestrin 2", "223195_s_at"], ["SAT1", "0.00078", "2.18", "Spermidine/spermine N1-acetyltransferase 1", "213988_s_at"], ["Downregulated genes"], ["STMN1", "0.00754", "−1.43", "Stathmin 1", "1552803_a_at"], ["PRKAA2", "0.0093", "−1.31", "Protein kinase AMP-activated catalytic subunit alpha 2", "227892_at"], ["SLC2A12", "0.0111", "−1.48", "Solute carrier family 2 member 12", "244353_s_at"], ["MAPK8", "0.046", "−1.07", "Mitogen-activated protein kinase 8", "229664_at"], ["KLHL24", "0.0104", "−1.41", "Kelch-like family member 24", "226158_at"]], "row_count": 45, "column_count": 5, "numeric_cells": 162, "header_rows": 1, "locator": "section[15]/table-wrap[1]#T2"}}, {"id": "asset:table:pmid:34163322:3", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:72779885e59cd811a8442ec2d0d5539a21085652736c81a2ceed51331fafb4c4", "bytes": 573, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[15]/table-wrap[2]#T3", "version": null, "note": "The ferroptosis differentially expressed genes were divided into ferroptosis driver, suppressor, and marker.", "structure": {"pmcid": "PMC8215678", "section_index": 15, "section_title": "Ferroptosis DEGs", "row_count": 2, "column_count": 3}, "table": {"label": "TABLE 3", "caption": "The ferroptosis differentially expressed genes were divided into ferroptosis driver, suppressor, and marker.", "rows": [["Suppressor", "Driver", "Marker"], ["AKR1C2, GCH1, AKR1C1, PLIN2, SCD, CD44, CAV1, STAT3, ACSL3, HMOX1, ATF4, SESN2, SQSTM1, HSPA5, HSPB1", "TNFAIP3, HMOX1, ATF4, MAPK1, MAPK8, PRKAA2, ATF3, BID, NRAS", "NCF2, PTGS2, IL6, CXCL2, SLC2A1, DUSP1, VEGFA, CEBPG, KLHL24, DDIT3, DDIT4, GABPB1, SLC2A12, STMN1, SLC2A14, SLC2A3"]], "row_count": 2, "column_count": 3, "numeric_cells": 2, "header_rows": 1, "locator": "section[15]/table-wrap[2]#T3"}}, {"id": "asset:table:pmid:34163322:4", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:79d89cd181e617f7722aeefdd7f7c69b260ff58494fac8da4e746d4b24cc47e3", "bytes": 501, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[17]/table-wrap[1]#T4", "version": null, "note": "Molecular complex detection was used to process the data downloaded from the STRING to further mining gene clusters.", "structure": {"pmcid": "PMC8215678", "section_index": 17, "section_title": "Protein–Protein Interaction Network Analysis of Ferroptosis DEGs", "row_count": 3, "column_count": 5}, "table": {"label": "TABLE 4", "caption": "Molecular complex detection was used to process the data downloaded from the STRING to further mining gene clusters.", "rows": [["Cluster", "Score (density * # of nodes)", "Nodes", "Edges", "Node IDs"], ["1", "10", "13", "120", "CD44, CAV1, ATF4, IL6, HMOX1, DUSP1, STAT3, MAPK1, MAPK8, DDIT3, ATF3, HSPA5, HSPB1"], ["2", "3.5", "5", "14", "TNFAIP3, PTGS2, CXCL2, SLC2A1, VEGFA"]], "row_count": 3, "column_count": 5, "numeric_cells": 9, "header_rows": 1, "locator": "section[17]/table-wrap[1]#T4"}}, {"id": "asset:table:pmid:34163322:5", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:4e45c5f5221672218f39609ce846a55e432aae37a3a1af40122a930c1c0580ca", "bytes": 525, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[18]/table-wrap[1]#T5", "version": null, "note": "miRNAs and its target genes.", "structure": {"pmcid": "PMC8215678", "section_index": 18, "section_title": "Further MiRNA Interaction and Mining", "row_count": 10, "column_count": 3}, "table": {"label": "TABLE 5", "caption": "miRNAs and its target genes.", "rows": [["miRNA", "Genes targeted by miRNA", "Gene count"], ["miR-15b-5p", "CD44, MAPK1", "2"], ["miR-20b-5p", "MAPK1, CAV1", "2"], ["miR-93-5p", "STAT3, MAPK1", "2"], ["miR-6754-5p", "CD44, STAT3", "2"], ["miR-6833-3p", "HSPA5, STAT3", "2"], ["miR-6845-3p", "MAPK1, HSPA5", "2"], ["miR-4692", "CAV1, MAPK1", "2"], ["miR-4796-3p", "MAPK1, CAV1", "2"], ["miR-5193", "HMOX1, CAV1", "2"]], "row_count": 10, "column_count": 3, "numeric_cells": 20, "header_rows": 1, "locator": "section[18]/table-wrap[1]#T5"}}], "gaps": ["asset:data:geo:GSE24265 not downloaded", "asset:data:geo:GSE24265 licence not read"]}, "analysis": {"state": "partial", "methods": [{"id": "method-1", "family": "group_comparison", "specific": "anova", "label": "Group comparison", "dsl_operations": ["group_summary", "welch_t", "bootstrap_mean_difference", "group_comparison_anova"], "missing_operations": [], "expressible": true, "parameters": {}, "data_shapes": ["two_or_more_groups_continuous"], "evidence": {"score": 0.8, "band": "high", "quote": "analysis of variance"}}, {"id": "method-2", "family": "network_analysis", "specific": "ppi_network", "label": "Network / pathway analysis", "dsl_operations": ["build_graph", "centrality_scores", "pathway_enrich"], "missing_operations": [], "expressible": true, "parameters": {}, "data_shapes": ["edge_list"], "evidence": {"score": 0.7, "band": "medium", "quote": "protein-protein interaction"}}, {"id": "method-3", "family": "network_analysis", "specific": "pathway_enrichment", "label": "Network / pathway analysis", "dsl_operations": ["pathway_enrich"], "missing_operations": [], "expressible": true, "parameters": {}, "data_shapes": ["edge_list"], "evidence": {"score": 0.8, "band": "high", "quote": "Pathway enrichment"}}, {"id": "method-4", "family": null, "specific": null, "label": "T test with false discovery rate (FDR) adjustment", "dsl_operations": [], "missing_operations": [], "expressible": null, "parameters": {}, "data_shapes": [], "evidence": {"score": 1.0, "band": "verbatim", "quote": "T test was employed to determine p-values and adjusted p-values in the differential gene expression (DGE) analysis."}}], "targets": [], "gaps": ["method.reader_named_unmapped"]}, "capability": {"state": "complete", "requirements": [{"capability_id": "capability:computational_analysis", "label": "Computational analysis platform", "assay_families": ["meta_analysis", "machine_learning", "survival_analysis", "statistical_regression", "pca", "molecular_docking", "network_analysis", "differential_expression", "gwas"], "availability_state": "owned", "tier_unlocked": "R1", "candidate": "Automated Assays Laravel application and simulated adapters"}], "gaps": []}, "readiness": {"state": "complete", "tier": "R1", "blocking_axis": "none", "blocked_on": "nothing:replicable_now", "axes": {"method": {"tier": "R1", "expressible": true, "required_operations": ["group_summary", "welch_t", "bootstrap_mean_difference", "group_comparison_anova"], "missing_operations": [], "basis": "The paper names the method it used and the corpus's method extractor maps it onto the DSL catalogue: anova."}, "capability": {"tier": "R1", "capability_id": "capability:computational_analysis", "availability_state": "owned", "basis": "The computational analysis is owned. The physical bench the paper used is not, so a physical validation cannot be run here."}, "data": {"tier": "R1", "reachable": true, "accessions": ["GSE24265"], "resolved_accessions": ["GSE24265"], "statements": ["Publicly available datasets were analyzed in this study. This data can be found here: FerrDb (http://www.zhounan.org/ferrdb/) and https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE24265."], "basis": "The paper names GSE24265 in Gene Expression Omnibus (GEO) and the accession resolves in the repository. No dataset was downloaded and no licence was read."}}, "can_run": {"dsl_operations": ["group_summary", "welch_t", "bootstrap_mean_difference", "group_comparison_anova"], "assets": ["source:pmid:34163322", "data:geo:GSE24265", "asset:table:pmid:34163322:1", "asset:table:pmid:34163322:2", "asset:table:pmid:34163322:3", "asset:table:pmid:34163322:4", "asset:table:pmid:34163322:5"], "steps": ["run_analysis"]}, "must_build": {"dsl_operations": [], "converters": [], "readers": [], "capabilities": [], "data_gaps": ["data:geo:GSE24265"]}, "gaps": []}, "review": {"state": "partial", "machine_critique": {"kind": "extraction_review", "reader": {"model": "MiniMax-M3.1-Flash", "provider": "minimax", "provider_family": "minimax", "read_at": "2026-10-31T18:31:29Z", "independence": "single_reader"}, "evidence_check": {"method": "verbatim", "availability": "verbatim"}, "calls": 3, "usage": {"prompt_tokens": 37883, "completion_tokens": 2089, "cached_tokens": 784}}, "human_critique": null, "stages": [{"id": "extraction", "state": "complete", "reader": "MiniMax-M3.1-Flash", "provider": "minimax"}], "gaps": ["review.independent_reader", "review.machine_critique", "review.human_critique"]}, "execution": {"state": "absent", "status": "not_run", "mode": null, "runs": [], "gaps": ["execution.not_run"]}, "provenance": {"entities": [{"id": "pmid:34163322", "type": "paper", "label": "pmid:34163322"}, {"id": "source:pmid:34163322", "type": "manuscript", "label": "PMID 34163322 full text"}, {"id": "data:geo:GSE24265", "type": "dataset", "label": "GEO GSE24265"}], "activities": [{"id": "activity-reading-sci-2026-11-01", "type": "classification", "used": [{"id": "pmid:34163322", "type": "paper", "label": "pmid:34163322"}, {"id": "source:pmid:34163322", "type": "manuscript", "label": "PMID 34163322 full text"}, {"id": "data:geo:GSE24265", "type": "dataset", "label": "GEO GSE24265"}], "agent": "agent:corpus-assay-engine"}, {"id": "activity-read-34163322", "type": "extraction", "used": ["source:pmid:34163322"], "agent": "agent:minimax-reader"}, {"id": "activity-resolve-GSE24265", "type": "accession_resolution", "used": ["data:geo:GSE24265"], "agent": "agent:corpus-assay-engine"}], "agents": [{"id": "agent:corpus-assay-engine", "type": "software", "label": "Corpus assay engine"}, {"id": "agent:minimax-reader", "type": "software", "label": "MiniMax literature reader"}], "source_run_id": "reading-sci-2026-11-01", "dsl_catalogue_fingerprint": "343fb30756ba6ec3", "capability_table_fingerprint": "2cb3e42f047d2ecf", "snapshot_id": "ba34b49490d9bfaf"}, "lineage": {"parent_id": "pmid:34163322", "parent_hash": "sha256:4dc244097dc709752db69d5c02ac20087c3667f6c259217aa1e7dc7c0a2ce978", "fork_of": null, "generation": 6}, "gaps": ["asset:data:geo:GSE24265 licence not read", "asset:data:geo:GSE24265 not downloaded", "execution.not_run", "method.reader_named_unmapped", "review.human_critique", "review.independent_reader", "review.machine_critique"], "assays": [{"role": "data_generation", "definition_id": "animal_model", "definition_version": "99e1195c7d6f", "definition_digest": null, "required_operations": [], "support_state": "partial", "source_hashes": {"assay_lexicon": "99e1195c7d6f"}, "confidence": 0.99, "evidence": ["and FGD5-AS1. We also generated a hemorrhage rat model, which was used to conduct exercise in", "used to conduct exercise intervention in ICH rats, and qRT-PCR was used to assess the expressi", "nd Methods Animals Adult male Sprague–Dawley rats (2 months old) were purchased from Qingdao P", "he following three groups: (1) sham (n = 7): rats that underwent surgery without ICH; (2) ICH"], "order_basis": "paper_text_order:1275", "id": "assay:1"}, {"role": "analysis", "definition_id": "group_comparison", "definition_version": "f2132e96ae6c7a4e", "definition_digest": null, "required_operations": ["group_summary", "welch_t", "bootstrap_mean_difference", "group_comparison_anova"], "support_state": "supported", "source_hashes": {"dsl_catalogue": "f2132e96ae6c7a4e"}, "confidence": 0.8, "evidence": ["analysis of variance"], "order_basis": "consumes_earlier_output", "id": "assay:2"}]}