The mechanisms of celastrol in treating papillary thyroid carcinoma based on network pharmacology and experiment verification.

{"sci_version": "1.2", "schema": "https://corpus.bntrg.co.uk/sci/1.0/sci.schema.json", "id": "pmid:34164500", "kind": "science-record", "revision": 8, "content_hash": "sha256:7ef529ed3638cc7d5be20b07e4cd39d3f2a67cce966acddf77eaf93e2074ee52", "created_at": "2026-11-01T15:41:39Z", "updated_at": "2026-11-01T22:04:01Z", "generator": {"name": "corpus-assay-engine", "run_id": "reading-sci-2026-11-01"}, "paper": {"state": "complete", "title": "The mechanisms of celastrol in treating papillary thyroid carcinoma based on network pharmacology and experiment verification.", "doi": "10.21037/atm-21-1854", "pmid": "34164500", "authors": ["Jiaoyu Yi", "Mengran Tian", "Linfei Hu", "Ning Kang", "Weike Ma", "Jingtai Zhi", "Xiangqian Zheng", "Xianhui Ruan", "Ming Gao"], "journal": "Annals of translational medicine", "year": 2021, "abstract": "BACKGROUND: Celastrol, a triterpene present in the traditional Chinese medicine (TCM) Triptergium wilfordii, has been demonstrated to have remarkable anticancer activity. However, its specific mechanism on papillary thyroid carcinoma (PTC) remains to be elucidated.\nMETHODS: Potential targets of celastrol were screened from public databases. Through the Gene Expression Omnibus (GEO) online database, we obtained the bioinformatics analysis profile of PTC, GSE33630, and analyzed the differentially expressed genes (DEGs). Then, a protein-protein interaction (PPI) network was constructed by utilizing the STRING database. Furthermore, Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) analysis were conducted. Finally, drug interactions between hub genes and celastrol were verified by molecular docking.\nRESULTS: Four core nodes (MMP9, JUN, ICAM1, and VCAM1) were discerned via constructing a PPI network of 47 common targets. Through functional enrichment analysis, it was confirmed that the above target genes were basically enriched in the interleukin-17 (IL-17), nuclear factor kappa-B (NF-κB), and tumor necrosis factor (TNF) signaling pathways, which are involved in the inflammatory microenvironment to inhibit the development and progression of tumors. Molecular docking results demonstrated that celastrol has a strong binding efficiency with the 4 key proteins.\nCONCLUSIONS: In this research, it was demonstrated that celastrol can regulate a variety of proteins and signaling pathways against PTC, providing a theoretical basis for future clinical applications.", "claims": [{"id": "claim-method", "statement": "Student’s t-test was performed to compare differences.", "kind": "methodological", "target": null, "evidence": [{"asset": "source:pmid:34164500", "locator": "sections[11] \"Statistical analysis\" paragraph 2", "quote": "Student’s t-test was performed to compare differences."}], "state": "complete"}, {"id": "claim-data-access", "statement": "Based on the GPL570-55999 Print_1437 platform, the dataset of gene expression in PTC and normal thyroid tissue, GSE33630, was downloaded from the Gene Expression Omnibus (GEO) online database.", "kind": "methodological", "target": null, "evidence": [{"asset": "source:pmid:34164500", "locator": "sections[3] \"Screening the differentially expressed genes (DEGs) in PTC\" paragraph 2", "quote": "Based on the GPL570-55999 Print_1437 platform, the dataset of gene expression in PTC and normal thyroid tissue, GSE33630, was downloaded from the Gene Expression Omnibus (GEO) online database."}], "state": "complete"}], "gaps": []}, "experiment": {"state": "complete", "objective": null, "steps": [{"id": "read_published_estimate", "order": 1, "name": "Read the published estimate from the source", "kind": "other", "state": "complete", "blocked_on": null, "description": "The claim, method and evidence span published with the source article.", "duration_hours": null, "parameters": {}, "inputs": ["source:pmid:34164500"], "outputs": ["the published estimate and its evidence"], "instruments": [], "reagents": []}, {"id": "obtain_source_data", "order": 2, "name": "Obtain the source data from the named repository", "kind": "data-preparation", "state": "complete", "blocked_on": null, "description": "The GEO series accession resolves and its sample accessions are listed. This lane did not download the dataset or read its licence.", "duration_hours": null, "parameters": {}, "inputs": ["data:geo:GSE33630"], "outputs": ["the source data with its repository provenance"], "instruments": [], "reagents": []}, {"id": "run_analysis", "order": 3, "name": "Run the published analysis", "kind": "analysis", "state": "complete", "blocked_on": null, "description": "Apply the paper's statistical method to the resolved series and compare the result with the published target.", "duration_hours": null, "parameters": {}, "inputs": ["data:geo:GSE33630"], "outputs": ["the replicated result and its comparison"], "instruments": [], "reagents": []}], "materials": [], "instruments": [], "reagents": [], "conditions": {}, "gaps": []}, "data": {"state": "partial", "assets": [{"id": "source:pmid:34164500", "role": "manuscript", "format": "xml", "media_type": "application/xml", "uri": "https://doi.org/10.21037/atm-21-1854", "sha256": "sha256:36f56b74bbf488999f702cc41f9407e64473519c323dd35968d070ea0c6c03c1", "bytes": 29895, "access": "open", "state": "resolved", "reader": null, "reader_status": "reader_required", "identifier": "10.21037/atm-21-1854", "version": null, "note": "Full article fetched from PMC; the checksum covers the rendered section body, not the original XML bytes.", "structure": {"pmcid": "PMC8184492", "source": "europe_pmc_fulltext", "coverage": "whole_body", "text_hash_scope": "rendered_section_body"}}, {"id": "data:geo:GSE33630", "role": "raw", "format": "geo-series", "media_type": "application/vnd.ncbi.geo-series+json", "uri": "https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE33630", "sha256": null, "bytes": null, "access": "open", "state": "resolved", "reader": null, "reader_status": "reader_required", "identifier": "GSE33630", "version": null, "note": "Based on the GPL570-55999 Print_1437 platform, the dataset of gene expression in PTC and normal thyroid tissue, GSE33630, was downloaded from the Gene Expression Omnibus (GEO) online database.", "structure": {"repository": "GEO", "access_route": "GEO accession URL", "access_statement_verbatim": "Based on the GPL570-55999 Print_1437 platform, the dataset of gene expression in PTC and normal thyroid tissue, GSE33630, was downloaded from the Gene Expression Omnibus (GEO) online database.", "access_statement_kind": "repository_route_statement", "sample_accessions": ["GSM831749", "GSM831750", "GSM831751", "GSM831752", "GSM831753", "GSM831754", "GSM831755", "GSM831756", "GSM831757", "GSM831758", "GSM831759", "GSM831760", "GSM831761", "GSM831762", "GSM831763", "GSM831764", "GSM831765", "GSM831766", "GSM831767", "GSM831768", "GSM831769", "GSM831770", "GSM831771", "GSM831772", "GSM831773", "GSM831774", "GSM831775", "GSM831776", "GSM831777", "GSM831778", "GSM831779", "GSM831780", "GSM831781", "GSM831782", "GSM831783", "GSM831784", "GSM831785", "GSM831786", "GSM831787", "GSM831788", "GSM831789", "GSM831790", "GSM831791", "GSM831792", "GSM831793", "GSM831794", "GSM831795", "GSM831796", "GSM831797", "GSM831798", "GSM831799", "GSM831800", "GSM831801", "GSM831802", "GSM831803", "GSM831804", "GSM831805", "GSM831806", "GSM831807", "GSM831808", "GSM831809", "GSM831810", "GSM831811", "GSM831812", "GSM831813", "GSM831814", "GSM831815", "GSM831816", "GSM831817", "GSM831818", "GSM831819", "GSM831820", "GSM831821", "GSM831822", "GSM831823", "GSM831824", "GSM831825", "GSM831826", "GSM831827", "GSM831828", "GSM831829", "GSM831830", "GSM831831", "GSM831832", "GSM831833", "GSM831834", "GSM831835", "GSM831836", "GSM831837", "GSM831838", "GSM831839", "GSM831840", "GSM831841", "GSM831842", "GSM831843", "GSM831844", "GSM831845", "GSM831846", "GSM831847", "GSM831848", "GSM831849", "GSM831850", "GSM831851", "GSM831852", "GSM831853"], "sample_count": 105, "group_sizes": null, "group_sizes_basis": null, "platform": "570", "taxon": "Homo sapiens", "title": "Normal thyrocytes vs papillary vs anaplastic thyroid carcinomas", "resolution_checked_at": "2026-11-01T15:39:54Z", "resolution_check": "identifier_resolution_only_no_download_no_licence_read", "downloaded": false, "licence_read": false}}, {"id": "asset:table:pmid:34164500:1", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:71f41882a9583ebbaa5868ce13bca8ea61d9523dd426a5266ec6de267a1d45d5", "bytes": 426, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[9]/table-wrap[1]#t1", "version": null, "note": "The primers of RT-PCR assays", "structure": {"pmcid": "PMC8184492", "section_index": 9, "section_title": "Quantitative real-time PCR (qRT-PCR)", "row_count": 5, "column_count": 3}, "table": {"label": "Table 1", "caption": "The primers of RT-PCR assays", "rows": [["", "Forward", "Reverse"], ["MMP9", "GGGACGCAGACATCGTCATC", "TCGTCATCGTCGAAATGGGC"], ["JUN", "AACAGGTGGCACAGCTTAAAC", "CAACTGCTGCGTTAGCATGAG"], ["ICAM1", "GTATGAACTGAGCAATGTGCAAG", "GTTCCACCCGTTCTGGAGTC"], ["VCAM1", "CAGTAAGGCAGGCTGTAAAAGA", "TGGAGCTGGTAGACCCTCG"]], "row_count": 5, "column_count": 3, "numeric_cells": 0, "header_rows": 1, "locator": "section[9]/table-wrap[1]#t1"}}, {"id": "asset:table:pmid:34164500:2", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:ffbb39207e50d0093bc5c2b8ee34198ebbbc707144d5034c09087943f86a25fc", "bytes": 396, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[15]/table-wrap[1]#t2", "version": null, "note": "Top 10 nodes in the network ranked by degree", "structure": {"pmcid": "PMC8184492", "section_index": 15, "section_title": "The PPI of candidate targets against PTC", "row_count": 11, "column_count": 3}, "table": {"label": "Table 2", "caption": "Top 10 nodes in the network ranked by degree", "rows": [["Rank", "Name", "Score"], ["1", "MMP9", "23"], ["2", "JUN", "14"], ["3", "ICAM1", "13"], ["4", "VCAM1", "12"], ["5", "HMOX1", "10"], ["6", "CASP1", "9"], ["7", "PLAU", "8"], ["8", "MMP1", "8"], ["9", "CTSS", "7"], ["10", "NOX4", "6"]], "row_count": 11, "column_count": 3, "numeric_cells": 20, "header_rows": 1, "locator": "section[15]/table-wrap[1]#t2"}}, {"id": "asset:table:pmid:34164500:3", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:be50c09a1c3f6c0a8adf680bd4db9b693c5b9ef151ba76bd24cf76df8fc8d838", "bytes": 319, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[17]/table-wrap[1]#t3", "version": null, "note": "Molecular docking scores of celastrol with the target proteins (kcal/mol)", "structure": {"pmcid": "PMC8184492", "section_index": 17, "section_title": "Hub proteins designation and molecular docking analysis", "row_count": 2, "column_count": 5}, "table": {"label": "Table 3", "caption": "Molecular docking scores of celastrol with the target proteins (kcal/mol)", "rows": [["Receptor ligand", "MMP9", "JUN", "ICAM1", "VCAM1"], ["Celastrol", "−9.3", "−9.9", "−7.0", "−7.6"]], "row_count": 2, "column_count": 5, "numeric_cells": 4, "header_rows": 1, "locator": "section[17]/table-wrap[1]#t3"}}], "gaps": ["asset:data:geo:GSE33630 not downloaded", "asset:data:geo:GSE33630 licence not read"]}, "analysis": {"state": "partial", "methods": [{"id": "method-1", "family": "network_analysis", "specific": "ppi_network", "label": "Network / pathway analysis", "dsl_operations": ["build_graph", "centrality_scores", "pathway_enrich"], "missing_operations": [], "expressible": true, "parameters": {}, "data_shapes": ["edge_list"], "evidence": {"score": 0.7, "band": "medium", "quote": "protein-protein interaction"}}, {"id": "method-2", "family": "network_analysis", "specific": "pathway_enrichment", "label": "Network / pathway analysis", "dsl_operations": ["pathway_enrich"], "missing_operations": [], "expressible": true, "parameters": {}, "data_shapes": ["edge_list"], "evidence": {"score": 0.8, "band": "high", "quote": "GO enrichment"}}, {"id": "method-3", "family": null, "specific": null, "label": "Student’s t-test", "dsl_operations": [], "missing_operations": [], "expressible": null, "parameters": {}, "data_shapes": [], "evidence": {"score": 1.0, "band": "verbatim", "quote": "Student’s t-test was performed to compare differences."}}], "targets": [], "gaps": ["method.reader_named_unmapped"]}, "capability": {"state": "complete", "requirements": [{"capability_id": "capability:computational_analysis", "label": "Computational analysis platform", "assay_families": ["meta_analysis", "machine_learning", "survival_analysis", "statistical_regression", "pca", "molecular_docking", "network_analysis", "differential_expression", "gwas"], "availability_state": "owned", "tier_unlocked": "R1", "candidate": "Automated Assays Laravel application and simulated adapters"}], "gaps": []}, "readiness": {"state": "complete", "tier": "R1", "blocking_axis": "none", "blocked_on": "nothing:replicable_now", "axes": {"method": {"tier": "R1", "expressible": true, "required_operations": ["build_graph", "centrality_scores", "pathway_enrich"], "missing_operations": [], "basis": "The paper names the method it used and the corpus's method extractor maps it onto the DSL catalogue: ppi_network."}, "capability": {"tier": "R1", "capability_id": "capability:computational_analysis", "availability_state": "owned", "basis": "The computational analysis is owned. The physical bench the paper used is not, so a physical validation cannot be run here."}, "data": {"tier": "R1", "reachable": true, "accessions": ["GSE33630"], "resolved_accessions": ["GSE33630"], "statements": ["Based on the GPL570-55999 Print_1437 platform, the dataset of gene expression in PTC and normal thyroid tissue, GSE33630, was downloaded from the Gene Expression Omnibus (GEO) online database."], "basis": "The paper names GSE33630 in Gene Expression Omnibus (GEO) and the accession resolves in the repository. No dataset was downloaded and no licence was read."}}, "can_run": {"dsl_operations": ["build_graph", "centrality_scores", "pathway_enrich"], "assets": ["source:pmid:34164500", "data:geo:GSE33630", "asset:table:pmid:34164500:1", "asset:table:pmid:34164500:2", "asset:table:pmid:34164500:3"], "steps": ["run_analysis"]}, "must_build": {"dsl_operations": [], "converters": [], "readers": [], "capabilities": [], "data_gaps": ["data:geo:GSE33630"]}, "gaps": []}, "review": {"state": "partial", "machine_critique": {"kind": "extraction_review", "reader": {"model": "MiniMax-M3.1-Flash", "provider": "minimax", "provider_family": "minimax", "read_at": "2026-10-31T18:31:11Z", "independence": "single_reader"}, "evidence_check": {"method": "verbatim", "availability": null}, "calls": 3, "usage": {"prompt_tokens": 24823, "completion_tokens": 1138, "cached_tokens": 784}}, "human_critique": null, "stages": [{"id": "extraction", "state": "complete", "reader": "MiniMax-M3.1-Flash", "provider": "minimax"}], "gaps": ["review.independent_reader", "review.machine_critique", "review.human_critique"]}, "execution": {"state": "absent", "status": "not_run", "mode": null, "runs": [], "gaps": ["execution.not_run"]}, "provenance": {"entities": [{"id": "pmid:34164500", "type": "paper", "label": "pmid:34164500"}, {"id": "source:pmid:34164500", "type": "manuscript", "label": "PMID 34164500 full text"}, {"id": "data:geo:GSE33630", "type": "dataset", "label": "GEO GSE33630"}], "activities": [{"id": "activity-reading-sci-2026-11-01", "type": "classification", "used": [{"id": "pmid:34164500", "type": "paper", "label": "pmid:34164500"}, {"id": "source:pmid:34164500", "type": "manuscript", "label": "PMID 34164500 full text"}, {"id": "data:geo:GSE33630", "type": "dataset", "label": "GEO GSE33630"}], "agent": "agent:corpus-assay-engine"}, {"id": "activity-read-34164500", "type": "extraction", "used": ["source:pmid:34164500"], "agent": "agent:minimax-reader"}, {"id": "activity-resolve-GSE33630", "type": "accession_resolution", "used": ["data:geo:GSE33630"], "agent": "agent:corpus-assay-engine"}], "agents": [{"id": "agent:corpus-assay-engine", "type": "software", "label": "Corpus assay engine"}, {"id": "agent:minimax-reader", "type": "software", "label": "MiniMax literature reader"}], "source_run_id": "reading-sci-2026-11-01", "dsl_catalogue_fingerprint": "343fb30756ba6ec3", "capability_table_fingerprint": "2cb3e42f047d2ecf", "snapshot_id": "ba34b49490d9bfaf"}, "lineage": {"parent_id": "pmid:34164500", "parent_hash": "sha256:c32534bd91afe56888b6a5215b00e37120ca62a66316ddfcaef6a728c86bedaa", "fork_of": null, "generation": 7}, "gaps": ["asset:data:geo:GSE33630 licence not read", "asset:data:geo:GSE33630 not downloaded", "execution.not_run", "method.reader_named_unmapped", "review.human_critique", "review.independent_reader", "review.machine_critique"], "assays": [{"role": "data_generation", "definition_id": "cell_culture", "definition_version": "99e1195c7d6f", "definition_digest": null, "required_operations": [], "support_state": "partial", "source_hashes": {"assay_lexicon": "99e1195c7d6f"}, "confidence": 0.77, "evidence": ["k Biotech Co. (Guangzhou, China). Cells were cultured in RPMI 1640 (Gibco) supplemented with 10% feta"], "order_basis": "paper_text_order:2155", "id": "assay:1"}, {"role": "analysis", "definition_id": "network_analysis", "definition_version": "f2132e96ae6c7a4e", "definition_digest": null, "required_operations": ["build_graph", "centrality_scores", "pathway_enrich"], "support_state": "supported", "source_hashes": {"dsl_catalogue": "f2132e96ae6c7a4e"}, "confidence": 0.7, "evidence": ["protein-protein interaction"], "order_basis": "consumes_earlier_output", "id": "assay:2"}]}