HS3ST2 and Its Related Molecules as Potential Biomarkers for Predicting Lymph Node Metastasis in Patients with Colorectal Cancer.

{"sci_version": "1.2", "schema": "https://corpus.bntrg.co.uk/sci/1.0/sci.schema.json", "id": "pmid:34234457", "kind": "science-record", "revision": 8, "content_hash": "sha256:98a3ba6b4200b3866bf22d956010d13773d6df1b246d66d0e2218c2f061bf7fa", "created_at": "2026-11-01T15:41:42Z", "updated_at": "2026-11-01T22:47:02Z", "generator": {"name": "corpus-assay-engine", "run_id": "reading-sci-2026-11-01"}, "paper": {"state": "complete", "title": "HS3ST2 and Its Related Molecules as Potential Biomarkers for Predicting Lymph Node Metastasis in Patients with Colorectal Cancer.", "doi": "10.2147/OTT.S311038", "pmid": "34234457", "authors": ["Guangyu Gao", "Xinya Shi", "Jiaofeng Shen"], "journal": "OncoTargets and therapy", "year": 2021, "abstract": "BACKGROUND: Lymph node metastasis is a major cause of cancer-related death in patients with colorectal cancer (CRC), but current strategies are limited to predicting this clinical behavior. Our study aims to establish a lymph node metastasis prediction model based on miRNA and mRNA to improve the accuracy of prediction.\nMETHODS: GSE56350, GSE70574, and GSE95109 were downloaded from the Gene Expression Omnibus (GEO) database and 569 colorectal cancer statistics were also downloaded from The Cancer Genome Atlas (TCGA) database. Differentially expressed miRNAs were calculated by using R software. Besides, gene ontology and enriched pathway analysis of target mRNAs were analyzed by using FunRich. Furthermore, the mRNA-miRNA network was constructed using Cytoscape software. Gene expression level was also detected by performing qRT-PCR (quantitative real-time PCR) in colorectal cancer and lymph node tissues.\nRESULTS: In total, 5 differentially expressed miRNAs were selected, and 34 mRNAs were identified after filtering. The research of KEGG indicated that mRNAs are enriched in many cancer pathways. Differentially expressed miRNAs were most enriched in the cytoplasm, nucleoside, transcription factor activity, and RNA binding. KEGG pathway analysis of these target genes was mainly enriched in 5 pathways including fatty acid elongation, MAPK signaling pathway, autophagy, signaling pathways regulating pluripotency of stem cells, and Th17 cell differentiation. The results of qRT-PCR indicated that hsa-miR-100 and hsa-miR-99a were differentially expressed in lymph node metastatic colorectal cancer tissues and lymph node non-metastasis tissues which all target HS3ST2. Besides, we also found they have a significant difference in colorectal cancer tissues compared with normal tissues.\nCONCLUSION: By using microarray and bioinformatics analyses, differentially expressed miRNAs were identified and a complete gene network was constructed. To our knowledge, HS3ST2 and related molecules including hsa-miR-100 and hsa-miR-99a were firstly identified as potential biomarkers in the development of lymph node metastatic colorectal cancer.", "claims": [{"id": "claim-method", "statement": "R software was used to compare two groups of tissues using the Limma version 3.36.2 R package.", "kind": "methodological", "target": null, "evidence": [{"asset": "source:pmid:34234457", "locator": "sections[4] \"Differently Expressed miRNAs and mRNAs Analysis\" paragraph 2", "quote": "R software was used to compare two groups of tissues using the Limma version 3.36.2 R package."}], "state": "complete"}, {"id": "claim-data-access", "statement": "The datasets used and/or analyzed during the current study are available from the Yulan Gu on reasonable request.", "kind": "methodological", "target": null, "evidence": [{"asset": "source:pmid:34234457", "locator": "sections[22] \"Data Sharing Statement\" paragraph 2", "quote": "The datasets used and/or analyzed during the current study are available from the Yulan Gu on reasonable request."}], "state": "complete"}], "gaps": []}, "experiment": {"state": "partial", "objective": null, "steps": [{"id": "read_published_estimate", "order": 1, "name": "Read the published estimate from the source", "kind": "other", "state": "complete", "blocked_on": null, "description": "The claim, method and evidence span published with the source article.", "duration_hours": null, "parameters": {}, "inputs": ["source:pmid:34234457"], "outputs": ["the published estimate and its evidence"], "instruments": [], "reagents": []}, {"id": "obtain_source_data", "order": 2, "name": "Obtain the source data from the named repository", "kind": "data-preparation", "state": "blocked", "blocked_on": "data:accession_absent", "description": "The GEO series accession resolves and its sample accessions are listed. This lane did not download the dataset or read its licence.", "duration_hours": null, "parameters": {}, "inputs": [], "outputs": ["the source data with its repository provenance"], "instruments": [], "reagents": []}, {"id": "run_analysis", "order": 3, "name": "Run the published analysis", "kind": "analysis", "state": "complete", "blocked_on": null, "description": "Apply the paper's statistical method to the resolved series and compare the result with the published target.", "duration_hours": null, "parameters": {}, "inputs": [], "outputs": ["the replicated result and its comparison"], "instruments": [], "reagents": []}], "materials": [], "instruments": [], "reagents": [], "conditions": {}, "gaps": ["step:obtain_source_data blocked on data:accession_absent"]}, "data": {"state": "partial", "assets": [{"id": "source:pmid:34234457", "role": "manuscript", "format": "xml", "media_type": "application/xml", "uri": "https://doi.org/10.2147/OTT.S311038", "sha256": "sha256:380ed60751dd1cee0c1505f9bd8f3b384c01e0c1180c1462eac04af1956e66a4", "bytes": 38592, "access": "open", "state": "resolved", "reader": null, "reader_status": "reader_required", "identifier": "10.2147/OTT.S311038", "version": null, "note": "Full article fetched from PMC; the checksum covers the rendered section body, not the original XML bytes.", "structure": {"pmcid": "PMC8242151", "source": "europe_pmc_fulltext", "coverage": "whole_body", "text_hash_scope": "rendered_section_body"}}, {"id": "asset:table:pmid:34234457:1", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:ca265378872737718b1b8eb95fd06bac9822b644ad5cbd7880276c0af839b782", "bytes": 830, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[9]/table-wrap[1]#t0001", "version": null, "note": "The Primers for Quantitative Real-Time Polymerase Chain Reaction, with β-Actin and U6 Used as the Control", "structure": {"pmcid": "PMC8242151", "section_index": 9, "section_title": "Verification of miRNA Expression", "row_count": 6, "column_count": 3}, "table": {"label": "Table 1", "caption": "The Primers for Quantitative Real-Time Polymerase Chain Reaction, with β-Actin and U6 Used as the Control", "rows": [["Primer Sets Name", "Reverse Transcriptase Primers (5ʹ to 3ʹ)", "RT-qPCR Primers (5ʹ to 3ʹ)"], ["hsa-mir-100", "GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACCACAAGT", "F: CAGTGCAGGGTCCGAGGTATR: CGCGAACCCGTAGATCCGAA"], ["hsa-mir-99a", "GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACCACAAGA", "F: CAGTGCAGGGTCCGAGGTATR: CGTATAACCCGTAGATCCGAT"], ["U6", "GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACAAAATA", "F: AGAGAAGATTAGCATGGCCCCTGR: ATCCAGTGCAGGGTCCGAGG"], ["HS3ST", "", "F: GGCTGGATTGGTACAGGAGCR: CCACGATCAGCTTGGTGTCT"], ["β-actin", "", "F: CTCCATCCTGGCCTCGCTGTR: GCTGTCACCTTCACCGTTCC"]], "row_count": 6, "column_count": 3, "numeric_cells": 4, "header_rows": 1, "locator": "section[9]/table-wrap[1]#t0001"}}, {"id": "asset:table:pmid:34234457:2", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:5b9f52ece1e30c2d631b09677cad439dc003c9a002f298d111078f22b6c2dff2", "bytes": 658, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[10]/table-wrap[1]#t0002", "version": null, "note": "Differentially Expressed (DE) miRNAs Identified from GSE56350 and GSE70574 Dataset", "structure": {"pmcid": "PMC8242151", "section_index": 10, "section_title": "Verification of mRNA Expression", "row_count": 6, "column_count": 6}, "table": {"label": "Table 2", "caption": "Differentially Expressed (DE) miRNAs Identified from GSE56350 and GSE70574 Dataset", "rows": [["ID", "logFC", "AveExpr", "t", "P.Value", "Adj. P.Val"], ["hsa-miR-99a", "−3.2998", "5.878924", "−9.07224", "1.47E-10", "1.08E-07"], ["hsa-miR-100", "−2.35603", "6.687555", "−4.37844", "0.00011", "0.003868"], ["hsa-miR-125b", "−2.95247", "5.767905", "−4.71345", "4.12E-05", "0.002706"], ["hsa-miR-143", "−3.34466", "5.496491", "−5.96943", "9.83E-07", "0.000242"], ["hsa-miR-375", "−1.95009", "7.292945", "−3.1063", "0.003834", "0.049641"]], "row_count": 6, "column_count": 6, "numeric_cells": 30, "header_rows": 1, "locator": "section[10]/table-wrap[1]#t0002"}}], "gaps": []}, "analysis": {"state": "complete", "methods": [{"id": "method-1", "family": "differential_expression", "specific": "limma_voom", "label": "Differential expression analysis", "dsl_operations": ["normalise_counts", "differential_expression_fit", "fdr_bh"], "missing_operations": [], "expressible": true, "parameters": {}, "data_shapes": ["count_matrix_with_condition"], "evidence": {"score": 1.0, "band": "verbatim", "quote": "R software was used to compare two groups of tissues using the Limma version 3.36.2 R package."}}], "targets": [], "gaps": []}, "capability": {"state": "complete", "requirements": [{"capability_id": "capability:computational_analysis", "label": "Computational analysis platform", "assay_families": ["meta_analysis", "machine_learning", "survival_analysis", "statistical_regression", "pca", "molecular_docking", "network_analysis", "differential_expression", "gwas"], "availability_state": "owned", "tier_unlocked": "R1", "candidate": "Automated Assays Laravel application and simulated adapters"}], "gaps": []}, "readiness": {"state": "blocked", "tier": "R4", "blocking_axis": "data", "blocked_on": "data:accession_absent", "axes": {"method": {"tier": "R1", "expressible": true, "required_operations": ["normalise_counts", "differential_expression_fit", "fdr_bh"], "missing_operations": [], "basis": "The paper names the method it used and the corpus's method extractor maps it onto the DSL catalogue: limma_voom."}, "capability": {"tier": "R1", "capability_id": "capability:computational_analysis", "availability_state": "owned", "basis": "The computational analysis is owned. The physical bench the paper used is not, so a physical validation cannot be run here."}, "data": {"tier": "R4", "reachable": false, "accessions": [], "resolved_accessions": [], "statements": ["The datasets used and/or analyzed during the current study are available from the Yulan Gu on reasonable request."], "basis": "The paper names no accession to its source data, so the data has to come from the authors."}}, "can_run": {"dsl_operations": ["normalise_counts", "differential_expression_fit", "fdr_bh"], "assets": ["source:pmid:34234457", "asset:table:pmid:34234457:1", "asset:table:pmid:34234457:2"], "steps": ["run_analysis"]}, "must_build": {"dsl_operations": [], "converters": [], "readers": [], "capabilities": [], "data_gaps": ["data:geo:None"]}, "gaps": ["data:accession_absent"]}, "review": {"state": "partial", "machine_critique": {"kind": "extraction_review", "reader": {"model": "MiniMax-M3.1-Flash", "provider": "minimax", "provider_family": "minimax", "read_at": "2026-10-31T19:40:22Z", "independence": "single_reader"}, "evidence_check": {"method": "verbatim", "availability": "verbatim"}, "calls": 3, "usage": {"prompt_tokens": 30964, "completion_tokens": 1814, "cached_tokens": 10504}}, "human_critique": null, "stages": [{"id": "extraction", "state": "complete", "reader": "MiniMax-M3.1-Flash", "provider": "minimax"}], "gaps": ["review.independent_reader", "review.machine_critique", "review.human_critique"]}, "execution": {"state": "absent", "status": "not_run", "mode": null, "runs": [], "gaps": ["execution.not_run"]}, "provenance": {"entities": [{"id": "pmid:34234457", "type": "paper", "label": "pmid:34234457"}, {"id": "source:pmid:34234457", "type": "manuscript", "label": "PMID 34234457 full text"}, {"id": "data:geo:None", "type": "dataset", "label": "GEO None"}], "activities": [{"id": "activity-reading-sci-2026-11-01", "type": "classification", "used": [{"id": "pmid:34234457", "type": "paper", "label": "pmid:34234457"}, {"id": "source:pmid:34234457", "type": "manuscript", "label": "PMID 34234457 full text"}, {"id": "data:geo:None", "type": "dataset", "label": "GEO None"}], "agent": "agent:corpus-assay-engine"}, {"id": "activity-read-34234457", "type": "extraction", "used": ["source:pmid:34234457"], "agent": "agent:minimax-reader"}, {"id": "activity-resolve-None", "type": "accession_resolution", "used": ["data:geo:None"], "agent": "agent:corpus-assay-engine"}], "agents": [{"id": "agent:corpus-assay-engine", "type": "software", "label": "Corpus assay engine"}, {"id": "agent:minimax-reader", "type": "software", "label": "MiniMax literature reader"}], "source_run_id": "reading-sci-2026-11-01", "dsl_catalogue_fingerprint": "343fb30756ba6ec3", "capability_table_fingerprint": "2cb3e42f047d2ecf", "snapshot_id": "ba34b49490d9bfaf"}, "lineage": {"parent_id": "pmid:34234457", "parent_hash": "sha256:752944936a389f9f1055bdab3a276c97151d7db6b0300904fe4f7c7730147a9e", "fork_of": null, "generation": 7}, "gaps": ["execution.not_run", "review.human_critique", "review.independent_reader", "review.machine_critique", "step:obtain_source_data blocked on data:accession_absent"], "assays": [{"role": "data_generation", "definition_id": "qpcr", "definition_version": "99e1195c7d6f", "definition_digest": null, "required_operations": [], "support_state": "partial", "source_hashes": {"assay_lexicon": "99e1195c7d6f"}, "confidence": 0.93, "evidence": ["detected by performing qRT-PCR (quantitative real-time PCR) in colorectal cancer and lymph node tissues"], "order_basis": "paper_text_order:941", "id": "assay:1"}, {"role": "data_generation", "definition_id": "microarray", "definition_version": "99e1195c7d6f", "definition_digest": null, "required_operations": [], "support_state": "partial", "source_hashes": {"assay_lexicon": "99e1195c7d6f"}, "confidence": 0.93, "evidence": ["ed with normal tissues. CONCLUSION: By using microarray and bioinformatics analyses, differentially"], "order_basis": "paper_text_order:1907", "id": "assay:2"}, {"role": "analysis", "definition_id": "differential_expression", "definition_version": "f2132e96ae6c7a4e", "definition_digest": null, "required_operations": ["normalise_counts", "differential_expression_fit", "fdr_bh"], "support_state": "supported", "source_hashes": {"dsl_catalogue": "f2132e96ae6c7a4e"}, "confidence": 1.0, "evidence": ["R software was used to compare two groups of tissues using the Limma version 3.36.2 R package."], "order_basis": "consumes_earlier_output", "id": "assay:3"}]}