Long Non-Coding RNA GABPB1-AS1 Augments Malignancy of Glioma Cells by Sequestering MicroRNA-330 and Reinforcing the ZNF367/Cell Cycle Signaling Pathway.

{"sci_version": "1.2", "schema": "https://corpus.bntrg.co.uk/sci/1.0/sci.schema.json", "id": "pmid:34276213", "kind": "science-record", "revision": 9, "content_hash": "sha256:4f209816f298759e0789550ca56c37a3771da79afaa5dceba37a8a6f1b461a08", "created_at": "2026-11-01T15:41:43Z", "updated_at": "2026-11-01T22:47:07Z", "generator": {"name": "corpus-assay-engine", "run_id": "reading-sci-2026-11-01"}, "paper": {"state": "complete", "title": "Long Non-Coding RNA GABPB1-AS1 Augments Malignancy of Glioma Cells by Sequestering MicroRNA-330 and Reinforcing the ZNF367/Cell Cycle Signaling Pathway.", "doi": "10.2147/NDT.S305182", "pmid": "34276213", "authors": ["Xiulong Li", "Hongfeng Wang"], "journal": "Neuropsychiatric disease and treatment", "year": 2021, "abstract": "BACKGROUND: Deregulation of long non-coding RNAs (lncRNAs) is frequently relevant to the malignant phenotypical changes. This study aimed to explore the role of lncRNA GABPB1-AS1 in the malignancy of glioma cells.\nMETHODS: Abnormally expressed genes in glioma were analyzed using a GEO GSE2223 dataset. Short hairpin (sh) RNA silencing of GABPB1-AS1 was introduced in glioma cells to explore its correlation with the proliferation, apoptosis, and invasiveness of cancer cells. The target transcripts of GABPB1-AS1 were predicted by bioinformatics analyses. MicroRNA (miR)-330 inhibition was additionally introduced in the glioma cells after GABPB1-AS1 knockdown for rescue experiments. Animal studies were performed by inducing xenograft tumors in nude mice.\nRESULTS: GABPB1-AS1 was highly expressed in the glioma tissues and associated with advanced WHO grades. GABPB1-AS1 knockdown reduced proliferation and invasiveness of glioma cells in vitro and in vivo. miR-330 was a target transcript of GABPB1-AS1. miR-330 inhibition restored the malignancy of glioma cells. miR-330 directly bound to ZNF367. ZNF367 was highly expressed in glioma tissues and positively correlated with GABPB1-AS1 expression, and it was relevant to the cell cycle signaling pathway. Downregulation of GABPB1-AS1 reduced the expression of ZNF367 and reduced the levels of cell cycle-related proteins PCNA, CDC20, CDC7 and CCNA1 in cells.\nCONCLUSION: This study demonstrated that GABPB1-AS1 competitively bound to miR-330 and de-repressed ZNF367 expression, leading to activation of the cell cycle signaling pathway and the growth and metastasis of glioma cells.", "claims": [{"id": "claim-method", "statement": "Data were analyzed by unpaired t-test (C) or one-way ANOVA (E and F).", "kind": "methodological", "target": null, "evidence": [{"asset": "source:pmid:34276213", "locator": "sections[18] \"LncRNA GABPB1-AS1 is Highly Expressed in Glioma Samples\" paragraph 3", "quote": "Data were analyzed by unpaired t-test (C) or one-way ANOVA (E and F)."}], "state": "complete"}, {"id": "claim-data-access", "statement": "A GSE2223 dataset comprising gene expression data of 4 normal brain tissues and 29 glioma tissues was obtained from the GEO database.", "kind": "methodological", "target": null, "evidence": [{"asset": "source:pmid:34276213", "locator": "sections[3] \"Bioinformatic Analysis\" paragraph 2", "quote": "A GSE2223 dataset comprising gene expression data of 4 normal brain tissues and 29 glioma tissues was obtained from the GEO database."}], "state": "complete"}], "gaps": []}, "experiment": {"state": "complete", "objective": null, "steps": [{"id": "read_published_estimate", "order": 1, "name": "Read the published estimate from the source", "kind": "other", "state": "complete", "blocked_on": null, "description": "The claim, method and evidence span published with the source article.", "duration_hours": null, "parameters": {}, "inputs": ["source:pmid:34276213"], "outputs": ["the published estimate and its evidence"], "instruments": [], "reagents": []}, {"id": "obtain_source_data", "order": 2, "name": "Obtain the source data from the named repository", "kind": "data-preparation", "state": "complete", "blocked_on": null, "description": "The GEO series accession resolves and its sample accessions are listed. This lane did not download the dataset or read its licence.", "duration_hours": null, "parameters": {}, "inputs": ["data:geo:GSE2223"], "outputs": ["the source data with its repository provenance"], "instruments": [], "reagents": []}, {"id": "run_analysis", "order": 3, "name": "Run the published analysis", "kind": "analysis", "state": "complete", "blocked_on": null, "description": "Apply the paper's statistical method to the resolved series and compare the result with the published target.", "duration_hours": null, "parameters": {}, "inputs": ["data:geo:GSE2223"], "outputs": ["the replicated result and its comparison"], "instruments": [], "reagents": []}], "materials": [], "instruments": [], "reagents": [], "conditions": {}, "gaps": []}, "data": {"state": "partial", "assets": [{"id": "source:pmid:34276213", "role": "manuscript", "format": "xml", "media_type": "application/xml", "uri": "https://doi.org/10.2147/NDT.S305182", "sha256": "sha256:ece5964f6fb914ee5482fc8b393117f432dada0fd68dbf139f61f73531163570", "bytes": 52143, "access": "open", "state": "resolved", "reader": null, "reader_status": "reader_required", "identifier": "10.2147/NDT.S305182", "version": null, "note": "Full article fetched from PMC; the checksum covers the rendered section body, not the original XML bytes.", "structure": {"pmcid": "PMC8280909", "source": "europe_pmc_fulltext", "coverage": "whole_body", "text_hash_scope": "rendered_section_body"}}, {"id": "data:geo:GSE2223", "role": "raw", "format": "geo-series", "media_type": "application/vnd.ncbi.geo-series+json", "uri": "https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE2223", "sha256": null, "bytes": null, "access": "open", "state": "resolved", "reader": null, "reader_status": "reader_required", "identifier": "GSE2223", "version": null, "note": "A GSE2223 dataset comprising gene expression data of 4 normal brain tissues and 29 glioma tissues was obtained from the GEO database.", "structure": {"repository": "GEO", "access_route": "GEO accession URL", "access_statement_verbatim": "A GSE2223 dataset comprising gene expression data of 4 normal brain tissues and 29 glioma tissues was obtained from the GEO database.", "access_statement_kind": "repository_route_statement", "sample_accessions": ["GSM40660", "GSM40661", "GSM40662", "GSM40663", "GSM40664", "GSM40665", "GSM40666", "GSM40667", "GSM40668", "GSM40669", "GSM40670", "GSM40671", "GSM40672", "GSM40673", "GSM40674", "GSM40675", "GSM40676", "GSM40677", "GSM40678", "GSM40679", "GSM40680", "GSM40681", "GSM40682", "GSM40683", "GSM40684", "GSM40685", "GSM40686", "GSM40687", "GSM40688", "GSM40689", "GSM40690", "GSM40691", "GSM40692", "GSM40693", "GSM40694", "GSM40695", "GSM40696", "GSM40697", "GSM40698", "GSM40699", "GSM40700", "GSM40701", "GSM40702", "GSM40703", "GSM40704", "GSM40705", "GSM40706", "GSM40707", "GSM40708", "GSM40709", "GSM40710", "GSM40711", "GSM40712", "GSM40713"], "sample_count": 54, "group_sizes": null, "group_sizes_basis": null, "platform": "1833", "taxon": "Homo sapiens", "title": "Gene expression profiling in human glial brain tumors", "resolution_checked_at": "2026-11-01T15:39:54Z", "resolution_check": "identifier_resolution_only_no_download_no_licence_read", "downloaded": false, "licence_read": false}}, {"id": "asset:table:pmid:34276213:1", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:283e7086b9a5fc6d239927bd4bac924207adaee892d555f4a8eb124cef0438ea", "bytes": 747, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[5]/table-wrap[1]#t0001", "version": null, "note": "Primer Sequences for RT-qPCR", "structure": {"pmcid": "PMC8280909", "section_index": 5, "section_title": "Reverse Transcription Quantitative Polymerase Chain Reaction (RT-qPCR)", "row_count": 17, "column_count": 2}, "table": {"label": "Table 1", "caption": "Primer Sequences for RT-qPCR", "rows": [["Gene", "Primer Sequence (5ʹ-3ʹ)"], ["GABPB1-AS1", "F: GTTCTGCGGTGGGTAGGAGT"], ["R: CCTCTTGGCTGTCCTTCCGTCTC"], ["ZNF367", "F: CTCGCTTCGGCAGCACAT"], ["R: TTTGCGTGTCATCCTTGCG"], ["ZO-1", "F: GTCCAGAATCTCGGAAAAGTGCC"], ["R: CTTTCAGCGCACCATACCAACC"], ["E-cadherin", "F: GCCTCCTGAAAAGAGAGTGGAAG"], ["R: TGGCAGTGTCTCTCCAAATCCG"], ["N-cadherin", "F: CCTCCAGAGTTTACTGCCATGAC"], ["R: GTAGGATCTCCGCCACTGATTC"], ["GAPDH", "F: ATCACCATCTTCCAGGAGCG"], ["R: CAAATGAGCCCCAGCCTTC"], ["miR-330", "F: TCTCTGGGCCTGTGTC"], ["R: GAACATGTCTGCGTATCTC"], ["U6", "F: CTCGCTTCGGCAGCACAT"], ["R: TTTGCGTGTCATCCTTGCG"]], "row_count": 17, "column_count": 2, "numeric_cells": 4, "header_rows": 1, "locator": "section[5]/table-wrap[1]#t0001"}}], "gaps": ["asset:data:geo:GSE2223 not downloaded", "asset:data:geo:GSE2223 licence not read"]}, "analysis": {"state": "complete", "methods": [{"id": "method-1", "family": "group_comparison", "specific": "anova", "label": "Group comparison", "dsl_operations": ["group_summary", "welch_t", "bootstrap_mean_difference", "group_comparison_anova"], "missing_operations": [], "expressible": true, "parameters": {}, "data_shapes": ["two_or_more_groups_continuous"], "evidence": {"score": 1.0, "band": "verbatim", "quote": "Data were analyzed by unpaired t-test (C) or one-way ANOVA (E and F)."}}, {"id": "method-2", "family": "image_quantification", "specific": "densitometry", "label": "Image analysis / quantification", "dsl_operations": ["segment_objects", "quantify_intensity"], "missing_operations": [], "expressible": true, "parameters": {}, "data_shapes": ["image_stack"], "evidence": {"score": 0.8, "band": "high", "quote": "optical density"}}, {"id": "method-3", "family": "diagnostic_evaluation", "specific": "roc", "label": "Diagnostic test evaluation", "dsl_operations": ["confusion_counts", "roc_curve", "sensitivity_specificity", "solve_confusion_matrix", "classification_metrics", "published_precision_envelope"], "missing_operations": [], "expressible": true, "parameters": {}, "data_shapes": ["reference_standard_and_test"], "evidence": {"score": 0.8, "band": "high", "quote": "ROC curve"}}], "targets": [], "gaps": []}, "capability": {"state": "complete", "requirements": [{"capability_id": "capability:computational_analysis", "label": "Computational analysis platform", "assay_families": ["meta_analysis", "machine_learning", "survival_analysis", "statistical_regression", "pca", "molecular_docking", "network_analysis", "differential_expression", "gwas"], "availability_state": "owned", "tier_unlocked": "R1", "candidate": "Automated Assays Laravel application and simulated adapters"}], "gaps": []}, "readiness": {"state": "complete", "tier": "R1", "blocking_axis": "none", "blocked_on": "nothing:replicable_now", "axes": {"method": {"tier": "R1", "expressible": true, "required_operations": ["group_summary", "welch_t", "bootstrap_mean_difference", "group_comparison_anova"], "missing_operations": [], "basis": "The paper names the method it used and the corpus's method extractor maps it onto the DSL catalogue: anova."}, "capability": {"tier": "R1", "capability_id": "capability:computational_analysis", "availability_state": "owned", "basis": "The computational analysis is owned. The physical bench the paper used is not, so a physical validation cannot be run here."}, "data": {"tier": "R1", "reachable": true, "accessions": ["GSE2223"], "resolved_accessions": ["GSE2223"], "statements": ["A GSE2223 dataset comprising gene expression data of 4 normal brain tissues and 29 glioma tissues was obtained from the GEO database."], "basis": "The paper names GSE2223 in Gene Expression Omnibus (GEO) and the accession resolves in the repository. No dataset was downloaded and no licence was read."}}, "can_run": {"dsl_operations": ["group_summary", "welch_t", "bootstrap_mean_difference", "group_comparison_anova"], "assets": ["source:pmid:34276213", "data:geo:GSE2223", "asset:table:pmid:34276213:1"], "steps": ["run_analysis"]}, "must_build": {"dsl_operations": [], "converters": [], "readers": [], "capabilities": [], "data_gaps": ["data:geo:GSE2223"]}, "gaps": []}, "review": {"state": "partial", "machine_critique": {"kind": "extraction_review", "reader": {"model": "MiniMax-M3.1-Flash", "provider": "minimax", "provider_family": "minimax", "read_at": "2026-10-31T18:32:25Z", "independence": "single_reader"}, "evidence_check": {"method": "verbatim", "availability": null}, "calls": 3, "usage": {"prompt_tokens": 43315, "completion_tokens": 1190, "cached_tokens": 520}}, "human_critique": null, "stages": [{"id": "extraction", "state": "complete", "reader": "MiniMax-M3.1-Flash", "provider": "minimax"}], "gaps": ["review.independent_reader", "review.machine_critique", "review.human_critique"]}, "execution": {"state": "absent", "status": "not_run", "mode": null, "runs": [], "gaps": ["execution.not_run"]}, "provenance": {"entities": [{"id": "pmid:34276213", "type": "paper", "label": "pmid:34276213"}, {"id": "source:pmid:34276213", "type": "manuscript", "label": "PMID 34276213 full text"}, {"id": "data:geo:GSE2223", "type": "dataset", "label": "GEO GSE2223"}], "activities": [{"id": "activity-reading-sci-2026-11-01", "type": "classification", "used": [{"id": "pmid:34276213", "type": "paper", "label": "pmid:34276213"}, {"id": "source:pmid:34276213", "type": "manuscript", "label": "PMID 34276213 full text"}, {"id": "data:geo:GSE2223", "type": "dataset", "label": "GEO GSE2223"}], "agent": "agent:corpus-assay-engine"}, {"id": "activity-read-34276213", "type": "extraction", "used": ["source:pmid:34276213"], "agent": "agent:minimax-reader"}, {"id": "activity-resolve-GSE2223", "type": "accession_resolution", "used": ["data:geo:GSE2223"], "agent": "agent:corpus-assay-engine"}], "agents": [{"id": "agent:corpus-assay-engine", "type": "software", "label": "Corpus assay engine"}, {"id": "agent:minimax-reader", "type": "software", "label": "MiniMax literature reader"}], "source_run_id": "reading-sci-2026-11-01", "dsl_catalogue_fingerprint": "343fb30756ba6ec3", "capability_table_fingerprint": "2cb3e42f047d2ecf", "snapshot_id": "ba34b49490d9bfaf"}, "lineage": {"parent_id": "pmid:34276213", "parent_hash": "sha256:9756903f12ffee3d71ec7c1d9db9591b46d9c712f3e5819ef2893dd896e7fb39", "fork_of": null, "generation": 8}, "gaps": ["asset:data:geo:GSE2223 licence not read", "asset:data:geo:GSE2223 not downloaded", "execution.not_run", "review.human_critique", "review.independent_reader", "review.machine_critique"], "assays": [{"role": "data_generation", "definition_id": "apoptosis_assay", "definition_version": "99e1195c7d6f", "definition_digest": null, "required_operations": [], "support_state": "partial", "source_hashes": {"assay_lexicon": "99e1195c7d6f"}, "confidence": 0.99, "evidence": ["lore its correlation with the proliferation, apoptosis, and invasiveness of cancer cells. The targe", "ted for subsequent use. Cell Counting Kit-8 (CCK-8) Method for Cell Proliferation Exponentially", "each group. Each well was filled with 10 µL CCK-8 solution (Beyotime Biotechnology Co. Ltd., S"], "order_basis": "paper_text_order:540", "id": "assay:1"}, {"role": "data_generation", "definition_id": "transfection", "definition_version": "99e1195c7d6f", "definition_digest": null, "required_operations": [], "support_state": "partial", "source_hashes": {"assay_lexicon": "99e1195c7d6f"}, "confidence": 0.99, "evidence": ["roduced in the glioma cells after GABPB1-AS1 knockdown for rescue experiments. Animal studies were", "ociated with advanced WHO grades. GABPB1-AS1 knockdown reduced proliferation and invasiveness of gl", "onentially growing LN229 and U251 cells were transfected with short hairpin RNA (shRNA) of GABPB1-AS1", "TT) and shRNA-#2 (AUGGCUUUCCCAACCUAGUTT), or transfected with miR-330 mimic (UCUCUGGGCCUGUGUCUUAGGC)"], "order_basis": "paper_text_order:760", "id": "assay:2"}, {"role": "data_generation", "definition_id": "animal_model", "definition_version": "99e1195c7d6f", "definition_digest": null, "required_operations": [], "support_state": "partial", "source_hashes": {"assay_lexicon": "99e1195c7d6f"}, "confidence": 0.99, "evidence": ["nd invasiveness of glioma cells in vitro and in vivo. miR-330 was a target transcript of GABPB1-A", "he length while “b” indicates the width. The mice were euthanized on the 30th d, and the tumors wer", "45th d, and the lung and liver tissues from mice were collected for hematoxylin and eosin (HE) sta", "hanasia, at the end point, the anaesthetized mice were intraperitoneally injected with an over dose"], "order_basis": "paper_text_order:1060", "id": "assay:3"}, {"role": "data_generation", "definition_id": "cell_culture", "definition_version": "99e1195c7d6f", "definition_digest": null, "required_operations": [], "support_state": "partial", "source_hashes": {"assay_lexicon": "99e1195c7d6f"}, "confidence": 0.99, "evidence": ["oliferation Exponentially growing cells were cultured in 96-well plates at 100 μL (1 × 103 cells) per", "oliferation Exponentially growing cells were cultured in 96-well plates at 100 μL (1 × 103 cells)"], "order_basis": "paper_text_order:3789", "id": "assay:4"}, {"role": "data_generation", "definition_id": "qpcr", "definition_version": "99e1195c7d6f", "definition_digest": null, "required_operations": [], "support_state": "partial", "source_hashes": {"assay_lexicon": "99e1195c7d6f"}, "confidence": 0.99, "evidence": ["ABPB1-AS1 in the glioma tissue samples using RT-qPCR (Figure 1C). Next, a ROC curve was produced,", "astrocyte cell-line A735 was examined using RT-qPCR. A similar trend was found in cells that hig", "14) and glioma tissues (n = 58) examined by RT-qPCR; (D) diagnostic value of GABPB1-AS1 in gliom", "in the astrocyte cell line A735 examined by RT-qPCR; (G) expression of GABPB1-AS1 in different t"], "order_basis": "paper_text_order:7023", "id": "assay:5"}, {"role": "analysis", "definition_id": "group_comparison", "definition_version": "f2132e96ae6c7a4e", "definition_digest": null, "required_operations": ["group_summary", "welch_t", "bootstrap_mean_difference", "group_comparison_anova"], "support_state": "supported", "source_hashes": {"dsl_catalogue": "f2132e96ae6c7a4e"}, "confidence": 1.0, "evidence": ["Data were analyzed by unpaired t-test (C) or one-way ANOVA (E and F)."], "order_basis": "consumes_earlier_output", "id": "assay:6"}]}