Aurora kinase A (AURKA) promotes the progression and imatinib resistance of advanced gastrointestinal stromal tumors.

{"sci_version": "1.2", "schema": "https://corpus.bntrg.co.uk/sci/1.0/sci.schema.json", "id": "pmid:34332577", "kind": "science-record", "revision": 7, "content_hash": "sha256:8ce4d3c28a7cde063d79a8a25c30054fed6b3aca08f9fdc81ba5dc96bc543797", "created_at": "2026-11-01T15:41:46Z", "updated_at": "2026-11-01T22:04:21Z", "generator": {"name": "corpus-assay-engine", "run_id": "reading-sci-2026-11-01"}, "paper": {"state": "complete", "title": "Aurora kinase A (AURKA) promotes the progression and imatinib resistance of advanced gastrointestinal stromal tumors.", "doi": "10.1186/s12935-021-02111-7", "pmid": "34332577", "authors": ["Xiaobin Cheng", "Jinhai Wang", "Sen Lu", "Weina Fan", "Weilin Wang"], "journal": "Cancer cell international", "year": 2021, "abstract": "BACKGROUND: Gastrointestinal stromal tumor (GIST) is a common tumor that originates from the alimentary system mesenchyme. Compared to typical gastrointestinal carcinomas, GISTs exhibit unique malignant behaviors. Bioinformatic tools and subsequent experiments were applied to investigate novel targets involved in GIST progression and imatinib resistance.\nMETHODS: Differences in gene expression profiles between advanced and nonadvanced GISTs were comprehensively analyzed based on the Gene Expression Omnibus (GEO) dataset GSE136755. A protein-protein interaction (PPI) network was constructed to identify the potential target gene. Gene set enrichment analysis (GSEA) was used to elucidate relevant biological events related to the target gene based on the GSE47911 dataset. Subsequently, immunohistochemistry and Kaplan-Meier analysis were performed to validate the prognostic value of the target gene in GISTs. Overexpression of the target gene was conducted to analyze its function in the proliferation, apoptosis, and imatinib resistance of GIST/T1 cells.\nRESULTS: In the current study, a total of 606 differentially expressed genes (DEGs) were screened based on the GSE136755 dataset, and the upregulated DEGs in advanced GISTs were mainly involved in cell division through functional annotations. The intersecting hub gene, Aurora kinase A (AURKA), was identified by degree and bottleneck algorithms. GSEA revealed that AURKA was involved in cell cycle-related biological processes. Analysis of the Oncomine and GEPIA databases revealed a pattern of elevated AURKA expression in most human malignances. Clinical assays demonstrated that AURKA could be an independent prognostic factor for GISTs. Additionally, overexpression of AURKA was experimentally demonstrated to promote cell proliferation, inhibit cell apoptosis, and enhance imatinib resistance in GIST/T1 cells.\nCONCLUSIONS: These findings indicated that overexpression of AURKA promoted GIST progression and enhanced imatinib resistance, implying that AURKA is a potential therapeutic target for GISTs.", "claims": [{"id": "claim-data-access", "statement": "All data and materials generated and analyzed during this study are included in the main paper.", "kind": "methodological", "target": null, "evidence": [{"asset": "source:pmid:34332577", "locator": "sections[32] \"Availability of data and materials\" paragraph 2", "quote": "All data and materials generated and analyzed during this study are included in the main paper."}], "state": "complete"}], "gaps": []}, "experiment": {"state": "complete", "objective": null, "steps": [{"id": "read_published_estimate", "order": 1, "name": "Read the published estimate from the source", "kind": "other", "state": "complete", "blocked_on": null, "description": "The claim, method and evidence span published with the source article.", "duration_hours": null, "parameters": {}, "inputs": ["source:pmid:34332577"], "outputs": ["the published estimate and its evidence"], "instruments": [], "reagents": []}, {"id": "obtain_source_data", "order": 2, "name": "Obtain the source data from the named repository", "kind": "data-preparation", "state": "complete", "blocked_on": null, "description": "The GEO series accession resolves and its sample accessions are listed. This lane did not download the dataset or read its licence.", "duration_hours": null, "parameters": {}, "inputs": ["data:geo:GSE136755"], "outputs": ["the source data with its repository provenance"], "instruments": [], "reagents": []}, {"id": "run_analysis", "order": 3, "name": "Run the published analysis", "kind": "analysis", "state": "complete", "blocked_on": null, "description": "Apply the paper's statistical method to the resolved series and compare the result with the published target.", "duration_hours": null, "parameters": {}, "inputs": ["data:geo:GSE136755"], "outputs": ["the replicated result and its comparison"], "instruments": [], "reagents": []}], "materials": [], "instruments": [], "reagents": [], "conditions": {}, "gaps": []}, "data": {"state": "partial", "assets": [{"id": "source:pmid:34332577", "role": "manuscript", "format": "xml", "media_type": "application/xml", "uri": "https://doi.org/10.1186/s12935-021-02111-7", "sha256": "sha256:6b0786283636e0a6ec40b57e505da96e0169f723b09c74d36a19a9f6bdbad0d9", "bytes": 48793, "access": "open", "state": "resolved", "reader": null, "reader_status": "reader_required", "identifier": "10.1186/s12935-021-02111-7", "version": null, "note": "Full article fetched from PMC; the checksum covers the rendered section body, not the original XML bytes.", "structure": {"pmcid": "PMC8325869", "source": "europe_pmc_fulltext", "coverage": "whole_body", "text_hash_scope": "rendered_section_body"}}, {"id": "data:geo:GSE136755", "role": "raw", "format": "geo-series", "media_type": "application/vnd.ncbi.geo-series+json", "uri": "https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE136755", "sha256": null, "bytes": null, "access": "open", "state": "resolved", "reader": null, "reader_status": "reader_required", "identifier": "GSE136755", "version": null, "note": "All data and materials generated and analyzed during this study are included in the main paper.", "structure": {"repository": "GEO", "access_route": "GEO accession URL", "access_statement_verbatim": "All data and materials generated and analyzed during this study are included in the main paper.", "access_statement_kind": "data_availability_statement", "sample_accessions": ["GSM4057318", "GSM4057319", "GSM4057320", "GSM4057321", "GSM4057322", "GSM4057323", "GSM4057324", "GSM4057325", "GSM4057326", "GSM4057327", "GSM4057328", "GSM4057329", "GSM4057330", "GSM4057331", "GSM4057332", "GSM4057333", "GSM4057334", "GSM4057335", "GSM4057336", "GSM4057337", "GSM4057338", "GSM4057339", "GSM4057340", "GSM4057341", "GSM4057342", "GSM4057343", "GSM4057344", "GSM4057345", "GSM4057346", "GSM4057347", "GSM4057348", "GSM4057349", "GSM4057350", "GSM4057351", "GSM4057352", "GSM4057353", "GSM4057354", "GSM4057355", "GSM4057356", "GSM4057357", "GSM4057358", "GSM4057359", "GSM4057360", "GSM4057361", "GSM4057362", "GSM4057363", "GSM4057364", "GSM4057365", "GSM4057366", "GSM4057367", "GSM4057368", "GSM4057369", "GSM4057370", "GSM4057371", "GSM4057372", "GSM4057373", "GSM4057374", "GSM4057375", "GSM4057376", "GSM4057377", "GSM4057378", "GSM4057379", "GSM4057380", "GSM4057381", "GSM4057382"], "sample_count": 65, "group_sizes": null, "group_sizes_basis": null, "platform": "17077", "taxon": "Homo sapiens", "title": "Driver gene alterations and activated signaling pathways toward malignant progression of gastrointestinal stromal tumors", "resolution_checked_at": "2026-11-01T15:39:54Z", "resolution_check": "identifier_resolution_only_no_download_no_licence_read", "downloaded": false, "licence_read": false}}, {"id": "data:geo:GSE47911", "role": "raw", "format": "geo-series", "media_type": "application/vnd.ncbi.geo-series+json", "uri": "https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE47911", "sha256": null, "bytes": null, "access": "open", "state": "resolved", "reader": null, "reader_status": "reader_required", "identifier": "GSE47911", "version": null, "note": "All data and materials generated and analyzed during this study are included in the main paper.", "structure": {"repository": "GEO", "access_route": "GEO accession URL", "access_statement_verbatim": "All data and materials generated and analyzed during this study are included in the main paper.", "access_statement_kind": "data_availability_statement", "sample_accessions": ["GSM1162315", "GSM1162316", "GSM1162317", "GSM1162318", "GSM1162319", "GSM1162320", "GSM1162321", "GSM1162322", "GSM1162323", "GSM1162324", "GSM1162325", "GSM1162326", "GSM1162327", "GSM1162328", "GSM1162329", "GSM1162330"], "sample_count": 16, "group_sizes": null, "group_sizes_basis": null, "platform": "6480", "taxon": "Homo sapiens", "title": "Gene expression signatures in gastric gastrointestinal stromal tumors (GISTs)", "resolution_checked_at": "2026-11-01T15:39:54Z", "resolution_check": "identifier_resolution_only_no_download_no_licence_read", "downloaded": false, "licence_read": false}}, {"id": "asset:table:pmid:34332577:1", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:46ab10586429eae2f3e0a159004c5b825f2b7bd017350ddc92cd37bd0d37d742", "bytes": 395, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[11]/table-wrap[1]#Tab1", "version": null, "note": "Sequences of primers used for quantitative real-time PCR analysis", "structure": {"pmcid": "PMC8325869", "section_index": 11, "section_title": "RNA extraction and real-time quantitative PCR (RT-qPCR)", "row_count": 3, "column_count": 3}, "table": {"label": "Table 1", "caption": "Sequences of primers used for quantitative real-time PCR analysis", "rows": [["Gene", "Forward (5′–3′)", "Reverse (5′–3′)"], ["Homo AURKA", "TGGGTGGTCAGTACATGCTC", "TGCATCCGACCTTCAATCATTTC"], ["Homo ACTB", "AGCGAGCATCCCCCAAAGTT", "GGGCACGAAGGCTCATCATT"]], "row_count": 3, "column_count": 3, "numeric_cells": 2, "header_rows": 1, "locator": "section[11]/table-wrap[1]#Tab1"}}, {"id": "asset:table:pmid:34332577:2", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:dc82a65560c08f82fdfbb7874e8dd40b2f9a273541461a09af813ab88051bf5f", "bytes": 921, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[22]/table-wrap[1]#Tab2", "version": null, "note": "Correlation between AURKA expression level and clinical features in 49 GIST patients", "structure": {"pmcid": "PMC8325869", "section_index": 22, "section_title": "Correlation between AURKA expression and the clinicopathological features of GISTs", "row_count": 12, "column_count": 6}, "table": {"label": "Table 2", "caption": "Correlation between AURKA expression level and clinical features in 49 GIST patients", "rows": [["Parameter", "Characteristic", "No. patients (%)", "AURKA score", "Statistics", "P value"], ["Gender", "Female", "23 (46.9)", "1.93 ± 1.35", "t = − 0.430", "0.669"], ["Male", "26 (53.1)", "2.12 ± 1.52", "", ""], ["Age", "< 57", "24 (49.0)", "2.05 ± 1.52", "t = − 0.121", "0.904"], ["≥ 57", "25 (51.0)", "2.00 ± 1.36", "", ""], ["Location", "Stomach", "14 (28.6)", "1.74 ± 1.30", "F = 1.321", "0.277"], ["Small intestine", "12 (24.5)", "1.68 ± 1.30", "", ""], ["Large intestine", "23 (46.9)", "2.37 ± 1.53", "", ""], ["Risk*", "High", "18 (36.7)", "2.02 ± 1.43", "F = 35.449", "< 0.001"], ["Intermediate", "4 (8.2)", "2.1 ± 1.29", "", ""], ["Low", "20 (40.8)", "1.26 ± 0.74", "", ""], ["Very low", "7 (14.3)", "0.40 ± 0.52", "", ""]], "row_count": 12, "column_count": 6, "numeric_cells": 32, "header_rows": 1, "locator": "section[22]/table-wrap[1]#Tab2"}}, {"id": "asset:table:pmid:34332577:3", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:78320415124adf5a18a6ff5bd74e43a6ed523d08b962a1559b26f6c6835fcf1e", "bytes": 1366, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[22]/table-wrap[2]#Tab3", "version": null, "note": "Correlation between AURKA intensity and clinical features based on GSE136755", "structure": {"pmcid": "PMC8325869", "section_index": 22, "section_title": "Correlation between AURKA expression and the clinicopathological features of GISTs", "row_count": 21, "column_count": 6}, "table": {"label": "Table 3", "caption": "Correlation between AURKA intensity and clinical features based on GSE136755", "rows": [["Parameter", "Characteristic", "No. patients (%)", "AURKA intensity", "Statistics", "P value"], ["Gender", "Female", "26 (40.0)", "6.19 ± 0.97", "t = − 1.458", "0.150"], ["Male", "39 (60.0)", "6.63 ± 1.47", "", ""], ["Age", "< 68", "31 (47.7)", "6.28 ± 1.17", "t = 1.022", "0.311"], ["≥ 68", "34 (52.3)", "6.62 ± 1.41", "", ""], ["Location*", "Stomach", "43 (66.2)", "6.14 ± 1.25", "F = 4.306", "0.018"], ["Non-stomach", "16 (24.6)", "6.95 ± 0.99", "", ""], ["Metastasis", "6 (9.2)", "7.39 ± 1.74", "", ""], ["Risk*", "High", "17 (26.2)", "7.54 ± 1.30", "F = 11.898", "< 0.001"], ["Intermediate", "9 (13.8)", "5.75 ± 0.54", "", ""], ["Low", "22 (33.8)", "6.06 ± 0.94", "", ""], ["Very low", "11 (16.9)", "5.66 ± 0.74", "", ""], ["Stage*", "IV", "9 (13.8)", "7.94 ± 1.63", "F = 10.686", "< 0.001"], ["III", "9 (13.8)", "6.85 ± 0.89", "", ""], ["II", "8 (12.3)", "7.13 ± 1.55", "", ""], ["I", "39 (60.0)", "5.89 ± 0.84", "", ""], ["Mutation", "Sensitive", "56 (86.2)", "6.39 ± 1.21", "F = 2.541", "0.087"], ["Resistance", "7 (10.8)", "7.33 ± 1.84", "", ""], ["N/A", "2 (3.1)", "5.29 ± 0.20", "", ""], ["Mutation", "Sensitive", "56 (88.9)", "6.39 ± 1.21", "t = 1.814", "0.075"], ["Resistance", "7 (11.1)", "7.33 ± 1.84", "", ""]], "row_count": 21, "column_count": 6, "numeric_cells": 56, "header_rows": 1, "locator": "section[22]/table-wrap[2]#Tab3"}}, {"id": "asset:table:pmid:34332577:4", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:8f584a97ff8ae076e5a5593e2b3a9cec4de77dd016a2cb4246175d6e78e3221f", "bytes": 1052, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[22]/table-wrap[3]#Tab4", "version": null, "note": "Correlation between AURKA intensity and clinical features based on the published raw data", "structure": {"pmcid": "PMC8325869", "section_index": 22, "section_title": "Correlation between AURKA expression and the clinicopathological features of GISTs", "row_count": 14, "column_count": 6}, "table": {"label": "Table 4", "caption": "Correlation between AURKA intensity and clinical features based on the published raw data", "rows": [["Parameter", "Characteristic", "No. patients (%)", "AURKA intensity", "Statistics", "P value"], ["Location", "Stomach", "40 (66.7)", "8.91 ± 1.25", "F = 1.923", "0.156"], ["Non-stomach", "16 (26.7)", "9.64 ± 1.55", "", ""], ["Parenteral", "4 (6.7)", "9.47 ± 1.69", "", ""], ["AFIP risk*", "High", "17 (28.3)", "10.2 ± 1.59", "F = 8.686", "< 0.001"], ["Intermediate", "14 (23.3)", "9.38 ± 1.43", "", ""], ["Low", "16 (26.7)", "8.48 ± 0.64", "", ""], ["Very low", "13 (21.7)", "8.34 ± 0.55", "", ""], ["Local recurrence*", "No", "54 (90.0)", "8.83 ± 1.03", "t = 7.377", "< 0.001"], ["Yes", "6 (10.0)", "12.0 ± 0.63", "", ""], ["Metastasis*", "No", "45 (75.0)", "8.56 ± 0.82", "t = 6.921", "< 0.001"], ["Yes", "15 (25.0)", "10.9 ± 1.22", "", ""], ["Mutation*", "Sensitive", "45 (75.0)", "8.91 ± 0.18", "t = 2.442", "0.018"], ["Resistance", "15 (25.0)", "9.88 ± 0.44", "", ""]], "row_count": 14, "column_count": 6, "numeric_cells": 36, "header_rows": 1, "locator": "section[22]/table-wrap[3]#Tab4"}}], "gaps": ["asset:data:geo:GSE136755 not downloaded", "asset:data:geo:GSE136755 licence not read", "asset:data:geo:GSE47911 not downloaded", "asset:data:geo:GSE47911 licence not read"]}, "analysis": {"state": "complete", "methods": [{"id": "method-1", "family": "group_comparison", "specific": "anova", "label": "Group comparison", "dsl_operations": ["group_summary", "welch_t", "bootstrap_mean_difference", "group_comparison_anova"], "missing_operations": [], "expressible": true, "parameters": {}, "data_shapes": ["two_or_more_groups_continuous"], "evidence": {"score": 0.8, "band": "high", "quote": "analysis of variance"}}, {"id": "method-2", "family": "survival_analysis", "specific": "kaplan_meier", "label": "Survival analysis", "dsl_operations": ["survival_km"], "missing_operations": [], "expressible": true, "parameters": {}, "data_shapes": ["time_to_event_with_censoring"], "evidence": {"score": 0.7, "band": "medium", "quote": "Kaplan-Meier"}}, {"id": "method-3", "family": "survival_analysis", "specific": "cox_proportional_hazards", "label": "Survival analysis", "dsl_operations": ["cox_ph"], "missing_operations": [], "expressible": true, "parameters": {}, "data_shapes": ["time_to_event_with_censoring"], "evidence": {"score": 0.8, "band": "high", "quote": "Cox proportional hazards"}}, {"id": "method-4", "family": "survival_analysis", "specific": "log_rank_test", "label": "Survival analysis", "dsl_operations": ["logrank_test"], "missing_operations": [], "expressible": true, "parameters": {}, "data_shapes": ["time_to_event_with_censoring"], "evidence": {"score": 0.8, "band": "high", "quote": "log-rank"}}, {"id": "method-5", "family": "network_analysis", "specific": "ppi_network", "label": "Network / pathway analysis", "dsl_operations": ["build_graph", "centrality_scores", "pathway_enrich"], "missing_operations": [], "expressible": true, "parameters": {}, "data_shapes": ["edge_list"], "evidence": {"score": 0.7, "band": "medium", "quote": "protein-protein interaction"}}], "targets": [], "gaps": []}, "capability": {"state": "complete", "requirements": [{"capability_id": "capability:computational_analysis", "label": "Computational analysis platform", "assay_families": ["meta_analysis", "machine_learning", "survival_analysis", "statistical_regression", "pca", "molecular_docking", "network_analysis", "differential_expression", "gwas"], "availability_state": "owned", "tier_unlocked": "R1", "candidate": "Automated Assays Laravel application and simulated adapters"}], "gaps": []}, "readiness": {"state": "complete", "tier": "R1", "blocking_axis": "none", "blocked_on": "nothing:replicable_now", "axes": {"method": {"tier": "R1", "expressible": true, "required_operations": ["group_summary", "welch_t", "bootstrap_mean_difference", "group_comparison_anova"], "missing_operations": [], "basis": "The paper names the method it used and the corpus's method extractor maps it onto the DSL catalogue: anova."}, "capability": {"tier": "R1", "capability_id": "capability:computational_analysis", "availability_state": "owned", "basis": "The computational analysis is owned. The physical bench the paper used is not, so a physical validation cannot be run here."}, "data": {"tier": "R1", "reachable": true, "accessions": ["GSE136755", "GSE47911"], "resolved_accessions": ["GSE136755", "GSE47911"], "statements": ["All data and materials generated and analyzed during this study are included in the main paper."], "basis": "The paper names GSE136755, GSE47911 in Gene Expression Omnibus (GEO) and the accession resolves in the repository. No dataset was downloaded and no licence was read."}}, "can_run": {"dsl_operations": ["group_summary", "welch_t", "bootstrap_mean_difference", "group_comparison_anova"], "assets": ["source:pmid:34332577", "data:geo:GSE136755", "asset:table:pmid:34332577:1", "asset:table:pmid:34332577:2", "asset:table:pmid:34332577:3", "asset:table:pmid:34332577:4"], "steps": ["run_analysis"]}, "must_build": {"dsl_operations": [], "converters": [], "readers": [], "capabilities": [], "data_gaps": ["data:geo:GSE136755"]}, "gaps": []}, "review": {"state": "partial", "machine_critique": {"kind": "extraction_review", "reader": {"model": "MiniMax-M3.1-Flash", "provider": "minimax", "provider_family": "minimax", "read_at": "2026-10-31T19:43:41Z", "independence": "single_reader"}, "evidence_check": {"method": null, "availability": "verbatim"}, "calls": 3, "usage": {"prompt_tokens": 38453, "completion_tokens": 2045, "cached_tokens": 793}}, "human_critique": null, "stages": [{"id": "extraction", "state": "complete", "reader": "MiniMax-M3.1-Flash", "provider": "minimax"}], "gaps": ["review.independent_reader", "review.machine_critique", "review.human_critique"]}, "execution": {"state": "absent", "status": "not_run", "mode": null, "runs": [], "gaps": ["execution.not_run"]}, "provenance": {"entities": [{"id": "pmid:34332577", "type": "paper", "label": "pmid:34332577"}, {"id": "source:pmid:34332577", "type": "manuscript", "label": "PMID 34332577 full text"}, {"id": "data:geo:GSE136755", "type": "dataset", "label": "GEO GSE136755"}], "activities": [{"id": "activity-reading-sci-2026-11-01", "type": "classification", "used": [{"id": "pmid:34332577", "type": "paper", "label": "pmid:34332577"}, {"id": "source:pmid:34332577", "type": "manuscript", "label": "PMID 34332577 full text"}, {"id": "data:geo:GSE136755", "type": "dataset", "label": "GEO GSE136755"}], "agent": "agent:corpus-assay-engine"}, {"id": "activity-read-34332577", "type": "extraction", "used": ["source:pmid:34332577"], "agent": "agent:minimax-reader"}, {"id": "activity-resolve-GSE136755", "type": "accession_resolution", "used": ["data:geo:GSE136755"], "agent": "agent:corpus-assay-engine"}], "agents": [{"id": "agent:corpus-assay-engine", "type": "software", "label": "Corpus assay engine"}, {"id": "agent:minimax-reader", "type": "software", "label": "MiniMax literature reader"}], "source_run_id": "reading-sci-2026-11-01", "dsl_catalogue_fingerprint": "343fb30756ba6ec3", "capability_table_fingerprint": "2cb3e42f047d2ecf", "snapshot_id": "ba34b49490d9bfaf"}, "lineage": {"parent_id": "pmid:34332577", "parent_hash": "sha256:27fe3d0ecf7bf53db1e153d091bc837afda76497f041eb7901de111fa3e1fd70", "fork_of": null, "generation": 6}, "gaps": ["asset:data:geo:GSE136755 licence not read", "asset:data:geo:GSE136755 not downloaded", "asset:data:geo:GSE47911 licence not read", "asset:data:geo:GSE47911 not downloaded", "execution.not_run", "review.human_critique", "review.independent_reader", "review.machine_critique"], "assays": [{"role": "data_generation", "definition_id": "ihc", "definition_version": "99e1195c7d6f", "definition_digest": null, "required_operations": [], "support_state": "partial", "source_hashes": {"assay_lexicon": "99e1195c7d6f"}, "confidence": 0.93, "evidence": ["based on the GSE47911 dataset. Subsequently, immunohistochemistry and Kaplan-Meier analysis were performed to"], "order_basis": "paper_text_order:866", "id": "assay:1"}, {"role": "data_generation", "definition_id": "apoptosis_assay", "definition_version": "99e1195c7d6f", "definition_digest": null, "required_operations": [], "support_state": "partial", "source_hashes": {"assay_lexicon": "99e1195c7d6f"}, "confidence": 0.93, "evidence": ["o analyze its function in the proliferation, apoptosis, and imatinib resistance of GIST/T1 cells. R", "to promote cell proliferation, inhibit cell apoptosis, and enhance imatinib resistance in GIST/T1"], "order_basis": "paper_text_order:1084", "id": "assay:2"}, {"role": "analysis", "definition_id": "group_comparison", "definition_version": "f2132e96ae6c7a4e", "definition_digest": null, "required_operations": ["group_summary", "welch_t", "bootstrap_mean_difference", "group_comparison_anova"], "support_state": "supported", "source_hashes": {"dsl_catalogue": "f2132e96ae6c7a4e"}, "confidence": 0.8, "evidence": ["analysis of variance"], "order_basis": "consumes_earlier_output", "id": "assay:3"}]}