Circular RNA circ_0011385 promotes cervical cancer progression through competitively binding to miR-149-5p and up-regulating SOX4 expression.

{"sci_version": "1.2", "schema": "https://corpus.bntrg.co.uk/sci/1.0/sci.schema.json", "id": "pmid:34369654", "kind": "science-record", "revision": 8, "content_hash": "sha256:69faefd5846f12805d71d4ef13f4bcbffb9e9deb2f0870bbc058b75206001cd1", "created_at": "2026-11-01T15:41:47Z", "updated_at": "2026-11-01T22:04:27Z", "generator": {"name": "corpus-assay-engine", "run_id": "reading-sci-2026-11-01"}, "paper": {"state": "complete", "title": "Circular RNA circ_0011385 promotes cervical cancer progression through competitively binding to miR-149-5p and up-regulating SOX4 expression.", "doi": "10.1002/kjm2.12432", "pmid": "34369654", "authors": ["An-Li Xu", "Wen-Shuang Wang", "Man-Yin Zhao", "Jia-Nan Sun", "Xiao-Ran Chen", "Jian-Qing Hou"], "journal": "The Kaohsiung journal of medical sciences", "year": 2021, "abstract": "Circular RNAs (circRNAs), emerging as a new type of non-coding RNAs, play important roles in cancers. Instead, the functions and mechanisms of circ_0011385 in cervical cancer (CC) are still inconclusive. Microarray data GSE102686 was downloaded from Gene Expression Omnibus (GEO) database, and were utilized to screen out circRNAs differently expressed in CC tissues. Circ_0011385, miR-149-5p, SRY-box transcription factor 4 (SOX4) mRNA expressions in CC tissues and cells were probed by quantitative real-time PCR (qRT-PCR). CC cell lines with circ_0011385 knockdown were constructed, and he multiplication, migration, invasion, and apoptosis of CC cells were evaluated by cell counting kit-8 (CCK-8) method, transwell assay, and flow cytometry. In addition, the targeting relationships between miR-149-5p and circ_0011385 or SOX4 mRNA 3'UTR were probed by dual-luciferase reporter gene assay and RNA pull-down assay. The regulatory function of circ_0011385 and miR-149-5p on SOX4 expression was studied with western blot. Expressions of circ_0011385 and SOX4 mRNA were raised in CC tissues and cells, while miR-149-5p expression was decreased. Knocking down circ_0011385 restrained the multiplication, migration, and invasion of CC cells and induced the apoptosis. Circ_0011385 directly targeted miR-149-5p, and SOX4 was the target of miR-149-5p, which could be positively regulated by circ_0011385. Circ_0011385 elevates SOX4 expression by targeting miR-149-5p, thus participating in promoting the malignant biological behaviors of CC cells.", "claims": [{"id": "claim-method", "statement": "With the data from GSE102686, the differentially expressed circRNAs in CC tissues (vs normal tissues) was analyzed by GEO2R.", "kind": "methodological", "target": null, "evidence": [{"asset": "source:pmid:34369654", "locator": "sections[16] \"Circ_0011385 expression is raised in CC tissues and cells\" paragraph 3", "quote": "With the data from GSE102686, the differentially expressed circRNAs in CC tissues (vs normal tissues) was analyzed by GEO2R."}], "state": "complete"}], "gaps": []}, "experiment": {"state": "complete", "objective": null, "steps": [{"id": "read_published_estimate", "order": 1, "name": "Read the published estimate from the source", "kind": "other", "state": "complete", "blocked_on": null, "description": "The claim, method and evidence span published with the source article.", "duration_hours": null, "parameters": {}, "inputs": ["source:pmid:34369654"], "outputs": ["the published estimate and its evidence"], "instruments": [], "reagents": []}, {"id": "obtain_source_data", "order": 2, "name": "Obtain the source data from the named repository", "kind": "data-preparation", "state": "complete", "blocked_on": null, "description": "The GEO series accession resolves and its sample accessions are listed. This lane did not download the dataset or read its licence.", "duration_hours": null, "parameters": {}, "inputs": ["data:geo:GSE102686"], "outputs": ["the source data with its repository provenance"], "instruments": [], "reagents": []}, {"id": "run_analysis", "order": 3, "name": "Run the published analysis", "kind": "analysis", "state": "complete", "blocked_on": null, "description": "Apply the paper's statistical method to the resolved series and compare the result with the published target.", "duration_hours": null, "parameters": {}, "inputs": ["data:geo:GSE102686"], "outputs": ["the replicated result and its comparison"], "instruments": [], "reagents": []}], "materials": [], "instruments": [], "reagents": [], "conditions": {}, "gaps": []}, "data": {"state": "partial", "assets": [{"id": "source:pmid:34369654", "role": "manuscript", "format": "xml", "media_type": "application/xml", "uri": "https://doi.org/10.1002/kjm2.12432", "sha256": "sha256:f5604235c6067b40523e5fb2b098a890a5a3d6205b62154dacab050df2a52edb", "bytes": 34495, "access": "open", "state": "resolved", "reader": null, "reader_status": "reader_required", "identifier": "10.1002/kjm2.12432", "version": null, "note": "Full article fetched from PMC; the checksum covers the rendered section body, not the original XML bytes.", "structure": {"pmcid": "PMC11896328", "source": "europe_pmc_fulltext", "coverage": "whole_body", "text_hash_scope": "rendered_section_body"}}, {"id": "data:geo:GSE102686", "role": "raw", "format": "geo-series", "media_type": "application/vnd.ncbi.geo-series+json", "uri": "https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE102686", "sha256": null, "bytes": null, "access": "open", "state": "resolved", "reader": null, "reader_status": "reader_required", "identifier": "GSE102686", "version": null, "note": "“GSE102686 was downloaded from the Gene Expression Omnibus (GEO) database (https://www.ncbi.nlm.nih.gov/geo/), and it was used to analyze the expression profile of circRNAs in CC tissues and normal tissues.”", "structure": {"repository": "GEO", "access_route": "GEO accession URL", "access_statement_verbatim": "“GSE102686 was downloaded from the Gene Expression Omnibus (GEO) database (https://www.ncbi.nlm.nih.gov/geo/), and it was used to analyze the expression profile of circRNAs in CC tissues and normal tissues.”", "access_statement_kind": "repository_route_statement", "sample_accessions": ["GSM2742920", "GSM2742921", "GSM2742922", "GSM2742923", "GSM2742924", "GSM2742925", "GSM2742926", "GSM2742927", "GSM2742928", "GSM2742929"], "sample_count": 10, "group_sizes": null, "group_sizes_basis": null, "platform": "19978", "taxon": "Homo sapiens", "title": "Circular RNA profile of human cervical squamous cell carcinoma", "resolution_checked_at": "2026-11-01T15:39:54Z", "resolution_check": "identifier_resolution_only_no_download_no_licence_read", "downloaded": false, "licence_read": false}}, {"id": "asset:table:pmid:34369654:1", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:7159e5e4c515acea377656470b0a779ca172d5e70ddec26c07f1844044adfe7c", "bytes": 564, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[7]/table-wrap[1]#kjm212432-tbl-0001", "version": null, "note": "Primers used for qRT‐PCR", "structure": {"pmcid": "PMC11896328", "section_index": 7, "section_title": "qRT‐PCR", "row_count": 6, "column_count": 3}, "table": {"label": "TABLE 1", "caption": "Primers used for qRT‐PCR", "rows": [["", "Forward sequence 5′–3′", "Reverse sequence 5′–3′"], ["circ_0011385", "AATCACCAGTGCTGTTTGGG", "CAAAGTCAAAACCGCAGGTCC"], ["SOX4 mRNA", "GGTCTCTAGTTCTTGCACGCTC", "CGGAATCGGCACTAAGGAG"], ["GADPH", "TATGATGATATCAAGAGGGTAGT", "TGTATCCAAACTCATTGTCATAC"], ["miR‐149‐5p", "GGCTCTGGCTCCGTGTCTT", "CAGTGCAGGGTCCGAGGTATT"], ["U6", "CAAATTCGTGAAGCGTTCCATA", "AGTGCAGGGTCCGAGGTA TTC"]], "row_count": 6, "column_count": 3, "numeric_cells": 4, "header_rows": 1, "locator": "section[7]/table-wrap[1]#kjm212432-tbl-0001"}}, {"id": "asset:table:pmid:34369654:2", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:c50396deab8602a615968af228cb2c36435591a65f287dd79dc4a132715332d2", "bytes": 918, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[16]/table-wrap[1]#kjm212432-tbl-0002", "version": null, "note": "Associations between the expression levels of circ_0011385 and clinicopathological features of CC patients", "structure": {"pmcid": "PMC11896328", "section_index": 16, "section_title": "Circ_0011385 expression is raised in CC tissues and cells", "row_count": 20, "column_count": 6}, "table": {"label": "TABLE 2", "caption": "Associations between the expression levels of circ_0011385 and clinicopathological features of CC patients", "rows": [["Parameters category", "Numbers (n = 50)", "circ_0011385 expression", "χ2", "p value"], ["High", "Low"], ["Age (years)"], ["<50", "22", "14", "8", "2.9221", "0.0874"], ["≥50", "28", "11", "17", "", ""], ["Differentiation"], ["G1 + G2", "23", "12", "11", "0.0805", "0.7766"], ["G3", "27", "13", "14", "", ""], ["FIGO stage"], ["I", "13", "3", "10", "5.0936", "0.0240 *"], ["II", "37", "22", "15", "", ""], ["Tumor size (cm)"], ["<4", "19", "9", "10", "0.0849", "0.7708"], ["≥4", "31", "16", "15", "", ""], ["HPV16/18"], ["Negative", "14", "6", "8", "0.3968", "0.5287"], ["Positive", "36", "19", "17", "", ""], ["Depth of stromal invasion"], ["<1/2", "24", "11", "13", "0.3205", "0.5713"], ["≥1/2", "26", "14", "12", "", ""]], "row_count": 20, "column_count": 6, "numeric_cells": 58, "header_rows": 2, "locator": "section[16]/table-wrap[1]#kjm212432-tbl-0002"}}], "gaps": ["asset:data:geo:GSE102686 not downloaded", "asset:data:geo:GSE102686 licence not read"]}, "analysis": {"state": "partial", "methods": [{"id": "method-1", "family": "group_comparison", "specific": "anova", "label": "Group comparison", "dsl_operations": ["group_summary", "welch_t", "bootstrap_mean_difference", "group_comparison_anova"], "missing_operations": [], "expressible": true, "parameters": {}, "data_shapes": ["two_or_more_groups_continuous"], "evidence": {"score": 0.8, "band": "high", "quote": "ANOVA"}}, {"id": "method-2", "family": "correlation_analysis", "specific": "pearson", "label": "Correlation analysis", "dsl_operations": ["pearson_r"], "missing_operations": [], "expressible": true, "parameters": {}, "data_shapes": ["paired_numeric_columns"], "evidence": {"score": 0.8, "band": "high", "quote": "Pearson's correlation"}}, {"id": "method-3", "family": null, "specific": null, "label": "GEO2R", "dsl_operations": [], "missing_operations": [], "expressible": null, "parameters": {}, "data_shapes": [], "evidence": {"score": 1.0, "band": "verbatim", "quote": "With the data from GSE102686, the differentially expressed circRNAs in CC tissues (vs normal tissues) was analyzed by GEO2R."}}], "targets": [], "gaps": ["method.reader_named_unmapped"]}, "capability": {"state": "complete", "requirements": [{"capability_id": "capability:computational_analysis", "label": "Computational analysis platform", "assay_families": ["meta_analysis", "machine_learning", "survival_analysis", "statistical_regression", "pca", "molecular_docking", "network_analysis", "differential_expression", "gwas"], "availability_state": "owned", "tier_unlocked": "R1", "candidate": "Automated Assays Laravel application and simulated adapters"}], "gaps": []}, "readiness": {"state": "complete", "tier": "R1", "blocking_axis": "none", "blocked_on": "nothing:replicable_now", "axes": {"method": {"tier": "R1", "expressible": true, "required_operations": ["group_summary", "welch_t", "bootstrap_mean_difference", "group_comparison_anova"], "missing_operations": [], "basis": "The paper names the method it used and the corpus's method extractor maps it onto the DSL catalogue: anova."}, "capability": {"tier": "R1", "capability_id": "capability:computational_analysis", "availability_state": "owned", "basis": "The computational analysis is owned. The physical bench the paper used is not, so a physical validation cannot be run here."}, "data": {"tier": "R1", "reachable": true, "accessions": ["GSE102686"], "resolved_accessions": ["GSE102686"], "statements": ["“GSE102686 was downloaded from the Gene Expression Omnibus (GEO) database (https://www.ncbi.nlm.nih.gov/geo/), and it was used to analyze the expression profile of circRNAs in CC tissues and normal tissues.”"], "basis": "The paper names GSE102686 in Gene Expression Omnibus (GEO) and the accession resolves in the repository. No dataset was downloaded and no licence was read."}}, "can_run": {"dsl_operations": ["group_summary", "welch_t", "bootstrap_mean_difference", "group_comparison_anova"], "assets": ["source:pmid:34369654", "data:geo:GSE102686", "asset:table:pmid:34369654:1", "asset:table:pmid:34369654:2"], "steps": ["run_analysis"]}, "must_build": {"dsl_operations": [], "converters": [], "readers": [], "capabilities": [], "data_gaps": ["data:geo:GSE102686"]}, "gaps": []}, "review": {"state": "partial", "machine_critique": {"kind": "extraction_review", "reader": {"model": "MiniMax-M3.1-Flash", "provider": "minimax", "provider_family": "minimax", "read_at": "2026-10-31T18:33:26Z", "independence": "single_reader"}, "evidence_check": {"method": "verbatim", "availability": null}, "calls": 3, "usage": {"prompt_tokens": 31263, "completion_tokens": 1042, "cached_tokens": 792}}, "human_critique": null, "stages": [{"id": "extraction", "state": "complete", "reader": "MiniMax-M3.1-Flash", "provider": "minimax"}], "gaps": ["review.independent_reader", "review.machine_critique", "review.human_critique"]}, "execution": {"state": "absent", "status": "not_run", "mode": null, "runs": [], "gaps": ["execution.not_run"]}, "provenance": {"entities": [{"id": "pmid:34369654", "type": "paper", "label": "pmid:34369654"}, {"id": "source:pmid:34369654", "type": "manuscript", "label": "PMID 34369654 full text"}, {"id": "data:geo:GSE102686", "type": "dataset", "label": "GEO GSE102686"}], "activities": [{"id": "activity-reading-sci-2026-11-01", "type": "classification", "used": [{"id": "pmid:34369654", "type": "paper", "label": "pmid:34369654"}, {"id": "source:pmid:34369654", "type": "manuscript", "label": "PMID 34369654 full text"}, {"id": "data:geo:GSE102686", "type": "dataset", "label": "GEO GSE102686"}], "agent": "agent:corpus-assay-engine"}, {"id": "activity-read-34369654", "type": "extraction", "used": ["source:pmid:34369654"], "agent": "agent:minimax-reader"}, {"id": "activity-resolve-GSE102686", "type": "accession_resolution", "used": ["data:geo:GSE102686"], "agent": "agent:corpus-assay-engine"}], "agents": [{"id": "agent:corpus-assay-engine", "type": "software", "label": "Corpus assay engine"}, {"id": "agent:minimax-reader", "type": "software", "label": "MiniMax literature reader"}], "source_run_id": "reading-sci-2026-11-01", "dsl_catalogue_fingerprint": "343fb30756ba6ec3", "capability_table_fingerprint": "2cb3e42f047d2ecf", "snapshot_id": "ba34b49490d9bfaf"}, "lineage": {"parent_id": "pmid:34369654", "parent_hash": "sha256:0f82f0f8927716002f45a803475442b727e35abad4e233b0b5fcb3304ac05490", "fork_of": null, "generation": 7}, "gaps": ["asset:data:geo:GSE102686 licence not read", "asset:data:geo:GSE102686 not downloaded", "execution.not_run", "method.reader_named_unmapped", "review.human_critique", "review.independent_reader", "review.machine_critique"], "assays": [{"role": "data_generation", "definition_id": "microarray", "definition_version": "99e1195c7d6f", "definition_digest": null, "required_operations": [], "support_state": "partial", "source_hashes": {"assay_lexicon": "99e1195c7d6f"}, "confidence": 0.93, "evidence": ["cervical cancer (CC) are still inconclusive. Microarray data GSE102686 was downloaded from Gene Expr"], "order_basis": "paper_text_order:301", "id": "assay:1"}, {"role": "data_generation", "definition_id": "qpcr", "definition_version": "99e1195c7d6f", "definition_digest": null, "required_operations": [], "support_state": "partial", "source_hashes": {"assay_lexicon": "99e1195c7d6f"}, "confidence": 0.93, "evidence": ["issues and cells were probed by quantitative real-time PCR (qRT-PCR). CC cell lines with circ_0011385 k"], "order_basis": "paper_text_order:598", "id": "assay:2"}, {"role": "data_generation", "definition_id": "transfection", "definition_version": "99e1195c7d6f", "definition_digest": null, "required_operations": [], "support_state": "partial", "source_hashes": {"assay_lexicon": "99e1195c7d6f"}, "confidence": 0.85, "evidence": ["R (qRT-PCR). CC cell lines with circ_0011385 knockdown were constructed, and he multiplication, mig"], "order_basis": "paper_text_order:655", "id": "assay:3"}, {"role": "data_generation", "definition_id": "apoptosis_assay", "definition_version": "99e1195c7d6f", "definition_digest": null, "required_operations": [], "support_state": "partial", "source_hashes": {"assay_lexicon": "99e1195c7d6f"}, "confidence": 0.99, "evidence": ["he multiplication, migration, invasion, and apoptosis of CC cells were evaluated by cell counting", "on, and invasion of CC cells and induced the apoptosis. Circ_0011385 directly targeted miR-149-5p,", "cells were evaluated by cell counting kit-8 (CCK-8) method, transwell assay, and flow cytometry"], "order_basis": "paper_text_order:732", "id": "assay:4"}, {"role": "data_generation", "definition_id": "flow_cytometry", "definition_version": "99e1195c7d6f", "definition_digest": null, "required_operations": [], "support_state": "partial", "source_hashes": {"assay_lexicon": "99e1195c7d6f"}, "confidence": 0.93, "evidence": ["g kit-8 (CCK-8) method, transwell assay, and flow cytometry. In addition, the targeting relationships be"], "order_basis": "paper_text_order:828", "id": "assay:5"}, {"role": "data_generation", "definition_id": "western_blot", "definition_version": "99e1195c7d6f", "definition_digest": null, "required_operations": [], "support_state": "partial", "source_hashes": {"assay_lexicon": "99e1195c7d6f"}, "confidence": 0.93, "evidence": ["R-149-5p on SOX4 expression was studied with western blot. Expressions of circ_0011385 and SOX4 mRNA w"], "order_basis": "paper_text_order:1107", "id": "assay:6"}, {"role": "data_generation", "definition_id": "cell_culture", "definition_version": "99e1195c7d6f", "definition_digest": null, "required_operations": [], "support_state": "partial", "source_hashes": {"assay_lexicon": "99e1195c7d6f"}, "confidence": 0.77, "evidence": ["METHODS Cell culture Human CC cell lines (HeLa, SiHa, C‐33A, CaSki) and human normal cervic"], "order_basis": "paper_text_order:1687", "id": "assay:7"}, {"role": "analysis", "definition_id": "group_comparison", "definition_version": "f2132e96ae6c7a4e", "definition_digest": null, "required_operations": ["group_summary", "welch_t", "bootstrap_mean_difference", "group_comparison_anova"], "support_state": "supported", "source_hashes": {"dsl_catalogue": "f2132e96ae6c7a4e"}, "confidence": 0.8, "evidence": ["ANOVA"], "order_basis": "consumes_earlier_output", "id": "assay:8"}]}