Circ_0087862 promotes the progression of colorectal cancer by sponging miR-142-3p and up-regulating BACH1 expression.

{"sci_version": "1.2", "schema": "https://corpus.bntrg.co.uk/sci/1.0/sci.schema.json", "id": "pmid:34390174", "kind": "science-record", "revision": 8, "content_hash": "sha256:195ae2ba1e28c6574a06c84191792a0a1375c9f9a82f7d9c56300aead72161fd", "created_at": "2026-11-01T15:41:47Z", "updated_at": "2026-11-01T22:04:28Z", "generator": {"name": "corpus-assay-engine", "run_id": "reading-sci-2026-11-01"}, "paper": {"state": "complete", "title": "Circ_0087862 promotes the progression of colorectal cancer by sponging miR-142-3p and up-regulating BACH1 expression.", "doi": "10.1002/kjm2.12437", "pmid": "34390174", "authors": ["Bo Huang", "De-Jun Cui", "Fang Yan", "Liu-Chan Yang", "Man-Man Zhang", "Xun Zhao"], "journal": "The Kaohsiung journal of medical sciences", "year": 2021, "abstract": "Circular RNAs (circRNAs) feature prominently in regulating the malignant biological behaviors of colorectal cancer (CRC), including cell viability, cell cycle progression, apoptosis, migration, invasion, and so on. This study is performed to probe into the biological function and molecular mechanism of circ_0087862 in CRC. The expression profile of GSE138589 was available from Gene Expression Omnibus (GEO), and the differentially expressed circRNAs were analyzed by GEO2R. The expression of circ_0087862, miR-142-3p, and BACH1 mRNA in CRC tissues and cells was measured by qRT-PCR. CCK-8 assay was employed to determine the proliferation of CRC cells. Scratch wound healing and transwell assays were used to examine the migration and invasion of CRC cells. The targeting relationships between circ_0087862 and miR-142-3p, and between miR-142-3p and BACH1 3'UTR were verified by dual-luciferase reporter gene assay and RIP assay. BACH1 protein expression was probed by western blot. Circ_0087862 was highly expressed in CRC tissues and cell lines. Knocking down circ_0087862 significantly restrained the multiplication, migration and invasion of CRC cells. miR-142-3p inhibition weakened the impact of circ_0087862 knockdown on CRC cells. Circ_0087862 regulated BACH1 expressions by targeting miR-142-3p. Circ_0087862 regulates BACH1 expressions through sponging miR-142-3p, and promotes the proliferation, migration, and invasion of CRC cells.", "claims": [{"id": "claim-method", "statement": "Pearson's correlation analysis was used to evaluate the correlation among circ_0087862 expression, miR‐142‐3p expression and BACH1 mRNA expression in CRC tissues.", "kind": "methodological", "target": null, "evidence": [{"asset": "source:pmid:34390174", "locator": "sections[13] \"Statistical analysis\" paragraph 2", "quote": "Pearson's correlation analysis was used to evaluate the correlation among circ_0087862 expression, miR‐142‐3p expression and BACH1 mRNA expression in CRC tissues."}], "state": "complete"}, {"id": "claim-data-access", "statement": "To screen out the molecules that may affect the CRC progression, we downloaded the expression profile of GSE138589 from the Gene Expression Omnibus (GEO) (https://www.ncbi.nlm.nih.gov/gds/), including six CRC tissues and six normal tissues adjacent to cancer.", "kind": "methodological", "target": null, "evidence": [{"asset": "source:pmid:34390174", "locator": "sections[15] \"Circ_0087862 is up‐regulated in CRC tissues\" paragraph 2", "quote": "To screen out the molecules that may affect the CRC progression, we downloaded the expression profile of GSE138589 from the Gene Expression Omnibus (GEO) (https://www.ncbi.nlm.nih.gov/gds/), including six CRC tissues and six normal tissues adjacent to cancer."}], "state": "complete"}], "gaps": []}, "experiment": {"state": "complete", "objective": null, "steps": [{"id": "read_published_estimate", "order": 1, "name": "Read the published estimate from the source", "kind": "other", "state": "complete", "blocked_on": null, "description": "The claim, method and evidence span published with the source article.", "duration_hours": null, "parameters": {}, "inputs": ["source:pmid:34390174"], "outputs": ["the published estimate and its evidence"], "instruments": [], "reagents": []}, {"id": "obtain_source_data", "order": 2, "name": "Obtain the source data from the named repository", "kind": "data-preparation", "state": "complete", "blocked_on": null, "description": "The GEO series accession resolves and its sample accessions are listed. This lane did not download the dataset or read its licence.", "duration_hours": null, "parameters": {}, "inputs": ["data:geo:GSE138589"], "outputs": ["the source data with its repository provenance"], "instruments": [], "reagents": []}, {"id": "run_analysis", "order": 3, "name": "Run the published analysis", "kind": "analysis", "state": "complete", "blocked_on": null, "description": "Apply the paper's statistical method to the resolved series and compare the result with the published target.", "duration_hours": null, "parameters": {}, "inputs": ["data:geo:GSE138589"], "outputs": ["the replicated result and its comparison"], "instruments": [], "reagents": []}], "materials": [], "instruments": [], "reagents": [], "conditions": {}, "gaps": []}, "data": {"state": "partial", "assets": [{"id": "source:pmid:34390174", "role": "manuscript", "format": "xml", "media_type": "application/xml", "uri": "https://doi.org/10.1002/kjm2.12437", "sha256": "sha256:ab445ef9aa43346fd88e96d5749382bef011953ce5496796a9372947a22ecd2e", "bytes": 25526, "access": "open", "state": "resolved", "reader": null, "reader_status": "reader_required", "identifier": "10.1002/kjm2.12437", "version": null, "note": "Full article fetched from PMC; the checksum covers the rendered section body, not the original XML bytes.", "structure": {"pmcid": "PMC11896406", "source": "europe_pmc_fulltext", "coverage": "whole_body_without_references", "text_hash_scope": "rendered_section_body"}}, {"id": "data:geo:GSE138589", "role": "raw", "format": "geo-series", "media_type": "application/vnd.ncbi.geo-series+json", "uri": "https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE138589", "sha256": null, "bytes": null, "access": "open", "state": "resolved", "reader": null, "reader_status": "reader_required", "identifier": "GSE138589", "version": null, "note": "To screen out the molecules that may affect the CRC progression, we downloaded the expression profile of GSE138589 from the Gene Expression Omnibus (GEO) (https://www.ncbi.nlm.nih.gov/gds/), including six CRC tissues and six normal tissues adjacent to cancer.", "structure": {"repository": "GEO", "access_route": "GEO accession URL", "access_statement_verbatim": "To screen out the molecules that may affect the CRC progression, we downloaded the expression profile of GSE138589 from the Gene Expression Omnibus (GEO) (https://www.ncbi.nlm.nih.gov/gds/), including six CRC tissues and six normal tissues adjacent to cancer.", "access_statement_kind": "repository_route_statement", "sample_accessions": ["GSM4113975", "GSM4113976", "GSM4113977", "GSM4113978", "GSM4113979", "GSM4113980", "GSM4113981", "GSM4113982", "GSM4113983", "GSM4113984", "GSM4113985", "GSM4113986"], "sample_count": 12, "group_sizes": null, "group_sizes_basis": null, "platform": "19978", "taxon": "Homo sapiens", "title": "circRNA Microarray for human colorectal adenocarcinoma and normal mucosa", "resolution_checked_at": "2026-11-01T15:39:54Z", "resolution_check": "identifier_resolution_only_no_download_no_licence_read", "downloaded": false, "licence_read": false}}, {"id": "asset:table:pmid:34390174:1", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:e53782cdd811fe12986c8f1c4f92b1d6d5eaf6c087586cda2b3e9d399871ef0e", "bytes": 567, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[6]/table-wrap[1]#kjm212437-tbl-0001", "version": null, "note": "Sequences used for qRT‐PCR", "structure": {"pmcid": "PMC11896406", "section_index": 6, "section_title": "Quantitative real‐time PCR", "row_count": 11, "column_count": 2}, "table": {"label": "TABLE 1", "caption": "Sequences used for qRT‐PCR", "rows": [["Names", "Sequences"], ["circ_0087862", "F: AGCCAGTTTCAACAACCCTGA"], ["", "R: TGAGCCACAGTTGTGGTGG"], ["miR‐142‐3p", "F: GTCGTATCCAGTGCAGGG"], ["", "R: CGACGTGTAGTGTTTCCTA"], ["U6", "F: CTCGCTTCGGCAGCACATATACT"], ["", "R: ACGCTTCACGAATTTGCGTGTC"], ["BACH1", "F: TGCGATGTCACCATCTTTGT"], ["", "R: CCTGGCCTACGATTCTTGAG"], ["β‐actin", "F: TCCCTGGAGAAGAGCTACG"], ["", "R: GTAGTTTCGTGGATGCCACA"]], "row_count": 11, "column_count": 2, "numeric_cells": 2, "header_rows": 1, "locator": "section[6]/table-wrap[1]#kjm212437-tbl-0001"}}, {"id": "asset:table:pmid:34390174:2", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:2fd559ef33951223dbee6d6baf432969cd418dcd87f58c9d8bfa8acc97c9087a", "bytes": 1006, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[19]/table-wrap[1]#kjm212437-tbl-0002", "version": null, "note": "Correlation of BACH1 protein expression with clinical characteristics of CRC (n = 38)", "structure": {"pmcid": "PMC11896406", "section_index": 19, "section_title": "Circ_0087862/miR‐142‐3p axis regulates BACH1", "row_count": 23, "column_count": 6}, "table": {"label": "TABLE 2", "caption": "Correlation of BACH1 protein expression with clinical characteristics of CRC (n = 38)", "rows": [["Characteristics", "Number", "BACH1 protein expression", "χ2", "P‐value"], ["Low (n = 19)", "High (n = 19)"], ["Gender"], ["Male", "20", "11", "9", "0.4222", "0.5158"], ["Female", "18", "8", "10", "", ""], ["Age (years)"], ["≥60", "11", "6", "5", "0.1279", "0.7206"], ["<60", "27", "13", "14", "", ""], ["Tumor location"], ["Rectum", "23", "10", "13", "0.9913", "0.3194"], ["Colon", "15", "9", "6", "", ""], ["Lymph node metastasis"], ["Absent", "18", "13", "5", "6.7556", "0.0093**"], ["Present", "20", "6", "14", "", ""], ["Tumor size (cm)"], ["<5", "14", "10", "4", "4.0714", "0.0436*"], ["≥5", "24", "9", "15", "", ""], ["Differentiation grade"], ["Moderate + poor", "22", "12", "10", "0.4318", "0.5111"], ["Well", "16", "7", "9", "", ""], ["TNM stage"], ["I, II", "15", "11", "4", "5.3971", "0.0202*"], ["III, IV", "23", "8", "15", "", ""]], "row_count": 23, "column_count": 6, "numeric_cells": 63, "header_rows": 2, "locator": "section[19]/table-wrap[1]#kjm212437-tbl-0002"}}], "gaps": ["asset:data:geo:GSE138589 not downloaded", "asset:data:geo:GSE138589 licence not read"]}, "analysis": {"state": "partial", "methods": [{"id": "method-1", "family": "correlation_analysis", "specific": "pearson", "label": "Correlation analysis", "dsl_operations": ["pearson_r"], "missing_operations": [], "expressible": true, "parameters": {}, "data_shapes": ["paired_numeric_columns"], "evidence": {"score": 1.0, "band": "verbatim", "quote": "Pearson's correlation analysis was used to evaluate the correlation among circ_0087862 expression, miR‐142‐3p expression and BACH1 mRNA expression in CRC tissues."}}, {"id": "method-2", "family": "group_comparison", "specific": "anova", "label": "Group comparison", "dsl_operations": ["group_summary", "welch_t", "bootstrap_mean_difference", "group_comparison_anova"], "missing_operations": [], "expressible": true, "parameters": {}, "data_shapes": ["two_or_more_groups_continuous"], "evidence": {"score": 0.8, "band": "high", "quote": "ANOVA"}}], "targets": [], "gaps": ["method.reader_differs_from_extractor"]}, "capability": {"state": "complete", "requirements": [{"capability_id": "capability:computational_analysis", "label": "Computational analysis platform", "assay_families": ["meta_analysis", "machine_learning", "survival_analysis", "statistical_regression", "pca", "molecular_docking", "network_analysis", "differential_expression", "gwas"], "availability_state": "owned", "tier_unlocked": "R1", "candidate": "Automated Assays Laravel application and simulated adapters"}], "gaps": []}, "readiness": {"state": "complete", "tier": "R1", "blocking_axis": "none", "blocked_on": "nothing:replicable_now", "axes": {"method": {"tier": "R1", "expressible": true, "required_operations": ["pearson_r"], "missing_operations": [], "basis": "The paper names the method it used and the corpus's method extractor maps it onto the DSL catalogue: pearson."}, "capability": {"tier": "R1", "capability_id": "capability:computational_analysis", "availability_state": "owned", "basis": "The computational analysis is owned. The physical bench the paper used is not, so a physical validation cannot be run here."}, "data": {"tier": "R1", "reachable": true, "accessions": ["GSE138589"], "resolved_accessions": ["GSE138589"], "statements": ["To screen out the molecules that may affect the CRC progression, we downloaded the expression profile of GSE138589 from the Gene Expression Omnibus (GEO) (https://www.ncbi.nlm.nih.gov/gds/), including six CRC tissues and six normal tissues adjacent to cancer."], "basis": "The paper names GSE138589 in Gene Expression Omnibus (GEO) and the accession resolves in the repository. No dataset was downloaded and no licence was read."}}, "can_run": {"dsl_operations": ["pearson_r"], "assets": ["source:pmid:34390174", "data:geo:GSE138589", "asset:table:pmid:34390174:1", "asset:table:pmid:34390174:2"], "steps": ["run_analysis"]}, "must_build": {"dsl_operations": [], "converters": [], "readers": [], "capabilities": [], "data_gaps": ["data:geo:GSE138589"]}, "gaps": []}, "review": {"state": "partial", "machine_critique": {"kind": "extraction_review", "reader": {"model": "MiniMax-M3.1-Flash", "provider": "minimax", "provider_family": "minimax", "read_at": "2026-10-31T18:33:31Z", "independence": "single_reader"}, "evidence_check": {"method": "verbatim", "availability": null}, "calls": 3, "usage": {"prompt_tokens": 21625, "completion_tokens": 1201, "cached_tokens": 792}}, "human_critique": null, "stages": [{"id": "extraction", "state": "complete", "reader": "MiniMax-M3.1-Flash", "provider": "minimax"}], "gaps": ["review.independent_reader", "review.machine_critique", "review.human_critique"]}, "execution": {"state": "absent", "status": "not_run", "mode": null, "runs": [], "gaps": ["execution.not_run"]}, "provenance": {"entities": [{"id": "pmid:34390174", "type": "paper", "label": "pmid:34390174"}, {"id": "source:pmid:34390174", "type": "manuscript", "label": "PMID 34390174 full text"}, {"id": "data:geo:GSE138589", "type": "dataset", "label": "GEO GSE138589"}], "activities": [{"id": "activity-reading-sci-2026-11-01", "type": "classification", "used": [{"id": "pmid:34390174", "type": "paper", "label": "pmid:34390174"}, {"id": "source:pmid:34390174", "type": "manuscript", "label": "PMID 34390174 full text"}, {"id": "data:geo:GSE138589", "type": "dataset", "label": "GEO GSE138589"}], "agent": "agent:corpus-assay-engine"}, {"id": "activity-read-34390174", "type": "extraction", "used": ["source:pmid:34390174"], "agent": "agent:minimax-reader"}, {"id": "activity-resolve-GSE138589", "type": "accession_resolution", "used": ["data:geo:GSE138589"], "agent": "agent:corpus-assay-engine"}], "agents": [{"id": "agent:corpus-assay-engine", "type": "software", "label": "Corpus assay engine"}, {"id": "agent:minimax-reader", "type": "software", "label": "MiniMax literature reader"}], "source_run_id": "reading-sci-2026-11-01", "dsl_catalogue_fingerprint": "343fb30756ba6ec3", "capability_table_fingerprint": "2cb3e42f047d2ecf", "snapshot_id": "ba34b49490d9bfaf"}, "lineage": {"parent_id": "pmid:34390174", "parent_hash": "sha256:602b6aa1ad1c9314e19a8eed8ff593f66fc79ff9d11b90ee1984bb18206f523b", "fork_of": null, "generation": 7}, "gaps": ["asset:data:geo:GSE138589 licence not read", "asset:data:geo:GSE138589 not downloaded", "execution.not_run", "method.reader_differs_from_extractor", "review.human_critique", "review.independent_reader", "review.machine_critique"], "assays": [{"role": "data_generation", "definition_id": "apoptosis_assay", "definition_version": "99e1195c7d6f", "definition_digest": null, "required_operations": [], "support_state": "partial", "source_hashes": {"assay_lexicon": "99e1195c7d6f"}, "confidence": 0.99, "evidence": ["ding cell viability, cell cycle progression, apoptosis, migration, invasion, and so on. This study", "C tissues and cells was measured by qRT-PCR. CCK-8 assay was employed to determine the prolifer"], "order_basis": "paper_text_order:245", "id": "assay:1"}, {"role": "data_generation", "definition_id": "western_blot", "definition_version": "99e1195c7d6f", "definition_digest": null, "required_operations": [], "support_state": "partial", "source_hashes": {"assay_lexicon": "99e1195c7d6f"}, "confidence": 0.93, "evidence": ["ssay. BACH1 protein expression was probed by western blot. Circ_0087862 was highly expressed in CRC ti"], "order_basis": "paper_text_order:1045", "id": "assay:2"}, {"role": "data_generation", "definition_id": "transfection", "definition_version": "99e1195c7d6f", "definition_digest": null, "required_operations": [], "support_state": "partial", "source_hashes": {"assay_lexicon": "99e1195c7d6f"}, "confidence": 0.85, "evidence": ["hibition weakened the impact of circ_0087862 knockdown on CRC cells. Circ_0087862 regulated BACH1 e"], "order_basis": "paper_text_order:1291", "id": "assay:3"}, {"role": "data_generation", "definition_id": "cell_culture", "definition_version": "99e1195c7d6f", "definition_digest": null, "required_operations": [], "support_state": "partial", "source_hashes": {"assay_lexicon": "99e1195c7d6f"}, "confidence": 0.77, "evidence": ["rt‐tandem repeat (STR) profiling. Cells were cultured in DMEM (Thermo Fisher Scientific, Shanghai, Ch"], "order_basis": "paper_text_order:2354", "id": "assay:4"}, {"role": "analysis", "definition_id": "correlation_analysis", "definition_version": "f2132e96ae6c7a4e", "definition_digest": null, "required_operations": ["pearson_r"], "support_state": "supported", "source_hashes": {"dsl_catalogue": "f2132e96ae6c7a4e"}, "confidence": 1.0, "evidence": ["Pearson's correlation analysis was used to evaluate the correlation among circ_0087862 expression, miR‐142‐3p expression and BACH1 mRNA expression in CRC tissues."], "order_basis": "consumes_earlier_output", "id": "assay:5"}]}