Oncogenic role of early growth response-1 in liver cancer through the regulation of the microRNA-675/sestrin 3 and the Wnt/β-catenin signaling pathway.

{"sci_version": "1.2", "schema": "https://corpus.bntrg.co.uk/sci/1.0/sci.schema.json", "id": "pmid:34409922", "kind": "science-record", "revision": 7, "content_hash": "sha256:01ef5f6a86cb79878892ad6c5301f645ab94fda8c40b675535ee85f6baed977c", "created_at": "2026-11-01T15:41:48Z", "updated_at": "2026-11-01T22:04:29Z", "generator": {"name": "corpus-assay-engine", "run_id": "reading-sci-2026-11-01"}, "paper": {"state": "complete", "title": "Oncogenic role of early growth response-1 in liver cancer through the regulation of the microRNA-675/sestrin 3 and the Wnt/β-catenin signaling pathway.", "doi": "10.1080/21655979.2021.1964889", "pmid": "34409922", "authors": ["Lingling Zhang", "Ran Ren", "Xue Yang", "Yiman Ge", "Xiajun Zhang", "Hongping Yuan"], "journal": "Bioengineered", "year": 2021, "abstract": "Early growth response-1 (EGR1) is a multi-domain protein and an immediate early transcription factor that is induced during liver injury and controls the expression of a variety of genes implicated in metabolism, cell proliferation, and tumorigenesis. Liver cancer (LC) is a highly malignant disease with high mortality worldwide. This study focused on the function of EGR1 in LC development and the mechanism of action. Two LC-related datasets GSE101728 and GSE138178 downloaded from the Gene Expression Omnibus (GEO) database were used for identification of key genes involved in cancer progression. A microarray analysis was conducted to identify differentially expressed microRNAs (miRNAs) after EGR1 knockdown. The target gene of miR-675 was identified by integrated analysis. EGR1 and miR-675 were highly expressed, whereas sestrin 3 (SESN3) was poorly expressed in LC tissues and cells. High EGR1 expression was associated with poor liver function and disease severity in patients with LC. Knockdown of EGR1 weakened proliferation and invasiveness of LC cells. EGR1 bound to the miR-675 promoter and increased its transcription, and miR-675 bound to SESN3 mRNA to induce its downregulation. miR-675 upregulation promoted the malignance of LC cells, but further upregulation of SESN3 reduced invasiveness of cells. SESN3 was enriched in the Wnt/β-catenin signaling. EGR1 and miR-675 activated the Wnt/β-catenin through downregulating SESN3. This study demonstrated that EGR1 promotes the malignant behaviors of LC cells through mediating the miRNA-675/SESN3/Wnt/β-catenin axis.", "claims": [{"id": "claim-data-access", "statement": "All the data generated or analyzed during this study are included in this published article.", "kind": "methodological", "target": null, "evidence": [{"asset": "source:pmid:34409922", "locator": "sections[35] \"Availability of data and materials\" paragraph 2", "quote": "All the data generated or analyzed during this study are included in this published article."}], "state": "complete"}], "gaps": []}, "experiment": {"state": "partial", "objective": null, "steps": [{"id": "read_published_estimate", "order": 1, "name": "Read the published estimate from the source", "kind": "other", "state": "complete", "blocked_on": null, "description": "The claim, method and evidence span published with the source article.", "duration_hours": null, "parameters": {}, "inputs": ["source:pmid:34409922"], "outputs": ["the published estimate and its evidence"], "instruments": [], "reagents": []}, {"id": "obtain_source_data", "order": 2, "name": "Obtain the source data from the named repository", "kind": "data-preparation", "state": "blocked", "blocked_on": "data:accession_absent", "description": "The GEO series accession resolves and its sample accessions are listed. This lane did not download the dataset or read its licence.", "duration_hours": null, "parameters": {}, "inputs": [], "outputs": ["the source data with its repository provenance"], "instruments": [], "reagents": []}, {"id": "run_analysis", "order": 3, "name": "Run the published analysis", "kind": "analysis", "state": "complete", "blocked_on": null, "description": "Apply the paper's statistical method to the resolved series and compare the result with the published target.", "duration_hours": null, "parameters": {}, "inputs": [], "outputs": ["the replicated result and its comparison"], "instruments": [], "reagents": []}], "materials": [], "instruments": [], "reagents": [], "conditions": {}, "gaps": ["step:obtain_source_data blocked on data:accession_absent"]}, "data": {"state": "partial", "assets": [{"id": "source:pmid:34409922", "role": "manuscript", "format": "xml", "media_type": "application/xml", "uri": "https://doi.org/10.1080/21655979.2021.1964889", "sha256": "sha256:1a41ff7c20cc168adf723181307622a0f5fc8c8fc7958a8f82954e51649fc2c7", "bytes": 52778, "access": "open", "state": "resolved", "reader": null, "reader_status": "reader_required", "identifier": "10.1080/21655979.2021.1964889", "version": null, "note": "Full article fetched from PMC; the checksum covers the rendered section body, not the original XML bytes.", "structure": {"pmcid": "PMC8806569", "source": "europe_pmc_fulltext", "coverage": "whole_body", "text_hash_scope": "rendered_section_body"}}, {"id": "asset:table:pmid:34409922:1", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:f94fe2188f59d311ed8277d08d914395e80097c56a2a986a58e3ee253f7fc2af", "bytes": 543, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[5]/table-wrap[1]#t0001", "version": null, "note": "Primer sequences for RT-qPCR", "structure": {"pmcid": "PMC8806569", "section_index": 5, "section_title": "Reverse transcription quantitative polymerase chain reaction (RT-qPCR)", "row_count": 11, "column_count": 2}, "table": {"label": "Table 1.", "caption": "Primer sequences for RT-qPCR", "rows": [["Gene", "Primer sequence (5’-3’)"], ["EGR1", "F: CCTATGAGCACCTGACCACA"], ["R: ATCGTTTGGCTGGGATAACTC"], ["miR-675", "F: TGGTGCGGAGAGGGC"], ["R: GAACATGTCTGCGTATCTC"], ["SESN3", "F: CCGCCAGTAACTATCATACATGCG"], ["R: GAGGATGTTGACACAACCAT"], ["GAPDH", "F: CGGAGTCAACGGATTTGGTCGTAT"], ["R: AGCCTTCTCCATGGTGGTGAAGAC"], ["U6", "F: CGCAAGGATGACACGCAAAT"], ["R: ATTTGCGTGTCATCCTTGCG"]], "row_count": 11, "column_count": 2, "numeric_cells": 2, "header_rows": 1, "locator": "section[5]/table-wrap[1]#t0001"}}, {"id": "asset:table:pmid:34409922:2", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:c8844efa4c3e2c58f786ba16d9257fa5d7b7262ad30758212c63e25e3a0db714", "bytes": 670, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[21]/table-wrap[1]#t0002", "version": null, "note": "A KEGG functional annotation for the differentially expressed genes from GSE101728 and GSE138178", "structure": {"pmcid": "PMC8806569", "section_index": 21, "section_title": "EGR1 is highly expressed in LC samples", "row_count": 8, "column_count": 3}, "table": {"label": "Table 2.", "caption": "A KEGG functional annotation for the differentially expressed genes from GSE101728 and GSE138178", "rows": [["Gene name", "KEGG ID", "Functional annotation"], ["CDCA3", "83461", "Cell division cycle associated 3"], ["EGR1", "1958", "Early growth response protein 1"], ["PRSS3", "167681", "Serine protease 35"], ["SESN3", "143686", "Sestrin 1/3"], ["GNMT", "27232", "Glycine N-methyltransferase"], ["SSC5D", "284297", "Scavenger receptor cysteine rich family member with 5 domains"], ["CAMK4", "461992", "Calcium/calmodulin-dependent protein kinase IV"]], "row_count": 8, "column_count": 3, "numeric_cells": 12, "header_rows": 1, "locator": "section[21]/table-wrap[1]#t0002"}}, {"id": "asset:table:pmid:34409922:3", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:1882e66b8faaf5c372e5b8b7bfb7bcf10d2c6b29d736518738f26be8e6f31a6f", "bytes": 762, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[22]/table-wrap[1]#t0003", "version": null, "note": "Correlation between EGR1 expression with the clinical baseline characteristics of patients with LC", "structure": {"pmcid": "PMC8806569", "section_index": 22, "section_title": "EGR1 serves as a potential biomarker of LC", "row_count": 14, "column_count": 5}, "table": {"label": "Table 3.", "caption": "Correlation between EGR1 expression with the clinical baseline characteristics of patients with LC", "rows": [["Clinical characteristics", "EGR1", "p"], ["High", "Low"], ["Age", "≤ 65", "11", "9", "> 0.05"], ["> 65", "13", "10"], ["Sex", "Female", "14", "12", "> 0.05"], ["Male", "10", "7"], ["Size (cm)", "≤ 4", "6", "10", "< 0.05"], ["> 4", "18", "9"], ["TNM stage", "I-II", "7", "13", "< 0.05"], ["III-IV", "17", "6"], ["TBIL (mg/dL)", "1.56 ± 0.36", "0.62 ± 0.25", "< 0.05"], ["AST (IU/L)", "185.69 ± 32.17", "102.75 ± 23.74", "< 0.05"], ["ALT (IU/L)", "95.71 ± 16.72", "47.56 ± 7.42", "< 0.05"], ["AFP (U/L)", "281.52 ± 62.15", "192.71 ± 31.57", "< 0.05"]], "row_count": 14, "column_count": 5, "numeric_cells": 36, "header_rows": 2, "locator": "section[22]/table-wrap[1]#t0003"}}], "gaps": []}, "analysis": {"state": "partial", "methods": [{"id": "method-1", "family": "group_comparison", "specific": "anova", "label": "Group comparison", "dsl_operations": ["group_summary", "welch_t", "bootstrap_mean_difference", "group_comparison_anova"], "missing_operations": [], "expressible": true, "parameters": {}, "data_shapes": ["two_or_more_groups_continuous"], "evidence": {"score": 0.8, "band": "high", "quote": "analysis of variance"}}, {"id": "method-2", "family": null, "specific": null, "label": "paired t test", "dsl_operations": [], "missing_operations": [], "expressible": null, "parameters": {}, "data_shapes": [], "evidence": {"score": 1.0, "band": "reordered", "quote": "“d, expression of EGR1 mRNA in the clinical tumor tissues and the para-cancerous tissues examined by RT-qPCR (n = 43, the paired t test, *p < 0.05)”"}}], "targets": [], "gaps": ["method.reader_named_unmapped"]}, "capability": {"state": "complete", "requirements": [{"capability_id": "capability:computational_analysis", "label": "Computational analysis platform", "assay_families": ["meta_analysis", "machine_learning", "survival_analysis", "statistical_regression", "pca", "molecular_docking", "network_analysis", "differential_expression", "gwas"], "availability_state": "owned", "tier_unlocked": "R1", "candidate": "Automated Assays Laravel application and simulated adapters"}], "gaps": []}, "readiness": {"state": "blocked", "tier": "R4", "blocking_axis": "data", "blocked_on": "data:accession_absent", "axes": {"method": {"tier": "R1", "expressible": true, "required_operations": ["group_summary", "welch_t", "bootstrap_mean_difference", "group_comparison_anova"], "missing_operations": [], "basis": "The paper names the method it used and the corpus's method extractor maps it onto the DSL catalogue: anova."}, "capability": {"tier": "R1", "capability_id": "capability:computational_analysis", "availability_state": "owned", "basis": "The computational analysis is owned. The physical bench the paper used is not, so a physical validation cannot be run here."}, "data": {"tier": "R4", "reachable": false, "accessions": [], "resolved_accessions": [], "statements": ["All the data generated or analyzed during this study are included in this published article."], "basis": "The paper names no accession to its source data, so the data has to come from the authors."}}, "can_run": {"dsl_operations": ["group_summary", "welch_t", "bootstrap_mean_difference", "group_comparison_anova"], "assets": ["source:pmid:34409922", "asset:table:pmid:34409922:1", "asset:table:pmid:34409922:2", "asset:table:pmid:34409922:3"], "steps": ["run_analysis"]}, "must_build": {"dsl_operations": [], "converters": [], "readers": [], "capabilities": [], "data_gaps": ["data:geo:None"]}, "gaps": ["data:accession_absent"]}, "review": {"state": "partial", "machine_critique": {"kind": "extraction_review", "reader": {"model": "MiniMax-M3.1-Flash", "provider": "minimax", "provider_family": "minimax", "read_at": "2026-10-31T19:45:38Z", "independence": "single_reader"}, "evidence_check": {"method": "reordered", "availability": "verbatim"}, "calls": 3, "usage": {"prompt_tokens": 42389, "completion_tokens": 1864, "cached_tokens": 799}}, "human_critique": null, "stages": [{"id": "extraction", "state": "complete", "reader": "MiniMax-M3.1-Flash", "provider": "minimax"}], "gaps": ["review.independent_reader", "review.machine_critique", "review.human_critique"]}, "execution": {"state": "absent", "status": "not_run", "mode": null, "runs": [], "gaps": ["execution.not_run"]}, "provenance": {"entities": [{"id": "pmid:34409922", "type": "paper", "label": "pmid:34409922"}, {"id": "source:pmid:34409922", "type": "manuscript", "label": "PMID 34409922 full text"}, {"id": "data:geo:None", "type": "dataset", "label": "GEO None"}], "activities": [{"id": "activity-reading-sci-2026-11-01", "type": "classification", "used": [{"id": "pmid:34409922", "type": "paper", "label": "pmid:34409922"}, {"id": "source:pmid:34409922", "type": "manuscript", "label": "PMID 34409922 full text"}, {"id": "data:geo:None", "type": "dataset", "label": "GEO None"}], "agent": "agent:corpus-assay-engine"}, {"id": "activity-read-34409922", "type": "extraction", "used": ["source:pmid:34409922"], "agent": "agent:minimax-reader"}, {"id": "activity-resolve-None", "type": "accession_resolution", "used": ["data:geo:None"], "agent": "agent:corpus-assay-engine"}], "agents": [{"id": "agent:corpus-assay-engine", "type": "software", "label": "Corpus assay engine"}, {"id": "agent:minimax-reader", "type": "software", "label": "MiniMax literature reader"}], "source_run_id": "reading-sci-2026-11-01", "dsl_catalogue_fingerprint": "343fb30756ba6ec3", "capability_table_fingerprint": "2cb3e42f047d2ecf", "snapshot_id": "ba34b49490d9bfaf"}, "lineage": {"parent_id": "pmid:34409922", "parent_hash": "sha256:84c76f51789f162ef504f9972408ca8237969ad569ea671bb5361f4ff9b4b48c", "fork_of": null, "generation": 6}, "gaps": ["execution.not_run", "method.reader_named_unmapped", "review.human_critique", "review.independent_reader", "review.machine_critique", "step:obtain_source_data blocked on data:accession_absent"], "assays": [{"role": "data_generation", "definition_id": "microarray", "definition_version": "99e1195c7d6f", "definition_digest": null, "required_operations": [], "support_state": "partial", "source_hashes": {"assay_lexicon": "99e1195c7d6f"}, "confidence": 0.93, "evidence": ["key genes involved in cancer progression. A microarray analysis was conducted to identify different"], "order_basis": "paper_text_order:712", "id": "assay:1"}, {"role": "data_generation", "definition_id": "transfection", "definition_version": "99e1195c7d6f", "definition_digest": null, "required_operations": [], "support_state": "partial", "source_hashes": {"assay_lexicon": "99e1195c7d6f"}, "confidence": 0.99, "evidence": ["ally expressed microRNAs (miRNAs) after EGR1 knockdown. The target gene of miR-675 was identified b", "on and disease severity in patients with LC. Knockdown of EGR1 weakened proliferation and invasiven"], "order_basis": "paper_text_order:812", "id": "assay:2"}, {"role": "data_generation", "definition_id": "qpcr", "definition_version": "99e1195c7d6f", "definition_digest": null, "required_operations": [], "support_state": "partial", "source_hashes": {"assay_lexicon": "99e1195c7d6f"}, "confidence": 0.99, "evidence": ["and the mechanism of action. Thereafter, the RT-qPCR results suggested that the expression of EGR", "s and the para-cancerous tissues examined by RT-qPCR (n = 43, the paired t test, *p < 0.05); e, e", "d MHCC97-H) and in THLE-3 cells evaluated by RT-qPCR (one-way ANOVA, *p < 0.05) A KEGG functional", "the mechanism of action. Thereafter, the RT-qPCR results suggested that the expression of EGR"], "order_basis": "paper_text_order:4101", "id": "assay:3"}, {"role": "analysis", "definition_id": "group_comparison", "definition_version": "f2132e96ae6c7a4e", "definition_digest": null, "required_operations": ["group_summary", "welch_t", "bootstrap_mean_difference", "group_comparison_anova"], "support_state": "supported", "source_hashes": {"dsl_catalogue": "f2132e96ae6c7a4e"}, "confidence": 0.8, "evidence": ["analysis of variance"], "order_basis": "consumes_earlier_output", "id": "assay:4"}]}