Key radioresistance regulation models and marker genes identified by integrated transcriptome analysis in nasopharyngeal carcinoma.

{"sci_version": "1.2", "schema": "https://corpus.bntrg.co.uk/sci/1.0/sci.schema.json", "id": "pmid:34432380", "kind": "science-record", "revision": 6, "content_hash": "sha256:73da5375f0c3d15f903b70834eb956efc2b78b64ef9edcaf2212cb1ea9300d61", "created_at": "2026-11-01T15:41:49Z", "updated_at": "2026-11-01T21:26:05Z", "generator": {"name": "corpus-assay-engine", "run_id": "reading-sci-2026-11-01"}, "paper": {"state": "complete", "title": "Key radioresistance regulation models and marker genes identified by integrated transcriptome analysis in nasopharyngeal carcinoma.", "doi": "10.1002/cam4.4228", "pmid": "34432380", "authors": ["Zhuang Sun", "Xiaohui Wang", "Jingyun Wang", "Jing Wang", "Xiao Liu", "Runda Huang", "Chunyan Chen", "Meiling Deng", "Hanyu Wang", "Fei Han"], "journal": "Cancer medicine", "year": 2021, "abstract": "Nasopharyngeal carcinoma (NPC) is a malignancy that is endemic to China and Southeast Asia. Radiotherapy is the usual treatment, however, radioresistance remains a major reason for failure. This study aimed to find key radioresistance regulation models and marker genes of NPC and clarify the mechanism of NPC radioresistance by RNA sequencing and bioinformatics analysis of the differences in gene expression profiles between radioresistant and radiosensitive NPC tissues. A total of 21 NPC biopsy specimens with different radiosensitivity were analyzed by RNA sequencing. Differentially expressed genes in RNA sequencing data were identified using R software. The differentially expressed gene data derived from RNA sequencing as well as prior knowledge in the form of pathway databases were integrated to find sub-networks of related genes. The data of RNA sequencing with the GSE48501 data from the GEO database were combined to further search for more reliable genes associated with radioresistance of NPC. Survival analyses using the Kaplan-Meier method based on the expression of the genes were conducted to facilitate the understanding of the clinical significance of the differentially expressed genes. RT-qPCR was performed to validate the expression levels of the differentially expressed genes. We identified 1182 differentially expressed genes between radioresistant and radiosensitive NPC tissue samples. Compared to the radiosensitive group, 22 genes were significantly upregulated and 1160 genes were downregulated in the radioresistant group. In addition, 10 major NPC radiation resistance network models were identified through integration analysis with known NPC radiation resistance-associated genes and mechanisms. Furthermore, we identified three core genes, DOCK4, MCM9, and POPDC3 among 12 common downregulated genes in the two datasets, which were validated by RT-qPCR. The findings of this study provide new clues for clarifying the mechanism of NPC radioresistance, and further experimental studies of these core genes are warranted.", "claims": [{"id": "claim-data-access", "statement": "The data that support the findings of this study are available from the corresponding author upon reasonable request.", "kind": "methodological", "target": null, "evidence": [{"asset": "source:pmid:34432380", "locator": "sections[29] \"DATA AVAILABILITY STATEMENT\" paragraph 2", "quote": "The data that support the findings of this study are available from the corresponding author upon reasonable request."}], "state": "complete"}], "gaps": []}, "experiment": {"state": "complete", "objective": null, "steps": [{"id": "read_published_estimate", "order": 1, "name": "Read the published estimate from the source", "kind": "other", "state": "complete", "blocked_on": null, "description": "The claim, method and evidence span published with the source article.", "duration_hours": null, "parameters": {}, "inputs": ["source:pmid:34432380"], "outputs": ["the published estimate and its evidence"], "instruments": [], "reagents": []}, {"id": "obtain_source_data", "order": 2, "name": "Obtain the source data from the named repository", "kind": "data-preparation", "state": "complete", "blocked_on": null, "description": "The GEO series accession resolves and its sample accessions are listed. This lane did not download the dataset or read its licence.", "duration_hours": null, "parameters": {}, "inputs": ["data:geo:GSE48501"], "outputs": ["the source data with its repository provenance"], "instruments": [], "reagents": []}, {"id": "run_analysis", "order": 3, "name": "Run the published analysis", "kind": "analysis", "state": "complete", "blocked_on": null, "description": "Apply the paper's statistical method to the resolved series and compare the result with the published target.", "duration_hours": null, "parameters": {}, "inputs": ["data:geo:GSE48501"], "outputs": ["the replicated result and its comparison"], "instruments": [], "reagents": []}], "materials": [], "instruments": [], "reagents": [], "conditions": {}, "gaps": []}, "data": {"state": "partial", "assets": [{"id": "source:pmid:34432380", "role": "manuscript", "format": "xml", "media_type": "application/xml", "uri": "https://doi.org/10.1002/cam4.4228", "sha256": "sha256:6546f97896a7d2197b192a9ba3b8aa3e6a2a321104a4b3080e524bf81404f919", "bytes": 47352, "access": "open", "state": "resolved", "reader": null, "reader_status": "reader_required", "identifier": "10.1002/cam4.4228", "version": null, "note": "Full article fetched from PMC; the checksum covers the rendered section body, not the original XML bytes.", "structure": {"pmcid": "PMC8525106", "source": "europe_pmc_fulltext", "coverage": "whole_body", "text_hash_scope": "rendered_section_body"}}, {"id": "data:geo:GSE48501", "role": "raw", "format": "geo-series", "media_type": "application/vnd.ncbi.geo-series+json", "uri": "https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE48501", "sha256": null, "bytes": null, "access": "open", "state": "resolved", "reader": null, "reader_status": "reader_required", "identifier": "GSE48501", "version": null, "note": "The data that support the findings of this study are available from the corresponding author upon reasonable request.", "structure": {"repository": "GEO", "access_route": "GEO accession URL", "access_statement_verbatim": "The data that support the findings of this study are available from the corresponding author upon reasonable request.", "access_statement_kind": "data_availability_statement", "sample_accessions": ["GSM1180035", "GSM1180036", "GSM1180037", "GSM1180038"], "sample_count": 4, "group_sizes": null, "group_sizes_basis": null, "platform": "570", "taxon": "Homo sapiens", "title": "Gene Expression data from human radioresistant and radiosensitive Nasopharyngeal Carcinoma Cells", "resolution_checked_at": "2026-11-01T15:39:54Z", "resolution_check": "identifier_resolution_only_no_download_no_licence_read", "downloaded": false, "licence_read": false}}, {"id": "asset:table:pmid:34432380:1", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:046d2d76cc950308946e756c984393ae0201b8465ff212e9a23da9ff05576643", "bytes": 689, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[3]/table-wrap[1]#cam44228-tbl-0001", "version": null, "note": "The clinical characteristics of nasopharyngeal carcinoma samples", "structure": {"pmcid": "PMC8525106", "section_index": 3, "section_title": "Patients and tissue samples", "row_count": 19, "column_count": 4}, "table": {"label": "TABLE 1", "caption": "The clinical characteristics of nasopharyngeal carcinoma samples", "rows": [["", "Radiosensitive (n=14)", "Radioresistant (n=7)", "P value"], ["Age (mean ±SD)", "45.57±7.76", "40.6±8.32", "0.190"], ["Sex", "", "", "0.006"], ["Male", "14", "3", ""], ["Female", "0", "4", ""], ["T stage", "", "", "0.374"], ["T1", "0", "1", ""], ["T2", "2", "1", ""], ["T3", "10", "3", ""], ["T4", "2", "2", ""], ["N stage", "", "", "0.677"], ["N0", "1", "1", ""], ["N1", "5", "2", ""], ["N2", "6", "4", ""], ["N3", "2", "0", ""], ["TNM stage", "", "", "0.866"], ["II", "1", "1", ""], ["III", "9", "4", ""], ["IV", "4", "2", ""]], "row_count": 19, "column_count": 4, "numeric_cells": 35, "header_rows": 1, "locator": "section[3]/table-wrap[1]#cam44228-tbl-0001"}}, {"id": "asset:table:pmid:34432380:2", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:b9da07d326055a3040d1aba82fa728a4e120dfdc932708152de6151757b09c08", "bytes": 885, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[9]/table-wrap[1]#cam44228-tbl-0002", "version": null, "note": "Known genes and mechanisms associated with radioresistance", "structure": {"pmcid": "PMC8525106", "section_index": 9, "section_title": "Summary of the known genes and mechanisms associated with radioresistance", "row_count": 6, "column_count": 3}, "table": {"label": "TABLE 2", "caption": "Known genes and mechanisms associated with radioresistance", "rows": [["Radioresistance‐related mechanisms", "Radioresistance‐associated genes", "Refs"], ["Enhanced DNA damage repair", "MRE11, RAD50, NBS1, ATM, ATR, RAD51, BRCA1, BRCA2, DNA‐PK, XRCC4, LIG4, H2AX, MDMX, MDM2, MDC1, 53BP1, TLK1, Rad9, ATF2, and SMC1", "48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59"], ["Altered cell cycle", "Chk1, Chk2, CDC25A, CDK2, CDC25C, CDK1, p21, p16, GADD45, NF‐kappa‐B, and FANCD2", "60, 61, 62, 63, 64, 65, 66, 67, 68"], ["Evasion of apoptosis", "TP53, Bcl2, Bax, FAS, TNF, TRAIL, Livin, XIAP, CIAP1, CIAP2, Survivin, Smac, Caspase, RelB, CREB, and SAPK", "69, 70, 71, 72, 73, 74"], ["Hypoxia", "HIF1", "75, 76, 77"], ["Angiogenesis", "VEGF", "78"]], "row_count": 6, "column_count": 3, "numeric_cells": 8, "header_rows": 1, "locator": "section[9]/table-wrap[1]#cam44228-tbl-0002"}}, {"id": "asset:table:pmid:34432380:3", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:37cf44dde8f5d33412a5acf8c64ba02786ee3afc3a97f243e87b1d3943969622", "bytes": 487, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[12]/table-wrap[1]#cam44228-tbl-0003", "version": null, "note": "A list of primers used in this study", "structure": {"pmcid": "PMC8525106", "section_index": 12, "section_title": "RT‐qPCR validation for the expression of the differentially expressed genes", "row_count": 9, "column_count": 2}, "table": {"label": "TABLE 3", "caption": "A list of primers used in this study", "rows": [["Gene", "Primer Sequence (5’−3’)"], ["DOCK4", "F:ATTCCAGAGAGCCAGGAGGT"], ["R:TGACGTTCTCTCCACCCAGA"], ["MCM9", "F:AGGTTCTGGAGTTTGAGCGG"], ["R:ACAAGCCTGAGAGGCAAGTG"], ["POPDC3", "F:TGCACAACCTGGAAGCAAGA"], ["R:AGAAAACCCAACCCCAGCAA"], ["GAPDH", "F:GCATCCTGGGCTACACTGAG"], ["R:AAAGTGGTCGTTGAGGGCAA"]], "row_count": 9, "column_count": 2, "numeric_cells": 1, "header_rows": 1, "locator": "section[12]/table-wrap[1]#cam44228-tbl-0003"}}], "gaps": ["asset:data:geo:GSE48501 not downloaded", "asset:data:geo:GSE48501 licence not read"]}, "analysis": {"state": "complete", "methods": [{"id": "method-1", "family": "survival_analysis", "specific": "kaplan_meier", "label": "Survival analysis", "dsl_operations": ["survival_km"], "missing_operations": [], "expressible": true, "parameters": {}, "data_shapes": ["time_to_event_with_censoring"], "evidence": {"score": 0.7, "band": "medium", "quote": "Kaplan-Meier"}}], "targets": [], "gaps": []}, "capability": {"state": "complete", "requirements": [{"capability_id": "capability:computational_analysis", "label": "Computational analysis platform", "assay_families": ["meta_analysis", "machine_learning", "survival_analysis", "statistical_regression", "pca", "molecular_docking", "network_analysis", "differential_expression", "gwas"], "availability_state": "owned", "tier_unlocked": "R1", "candidate": "Automated Assays Laravel application and simulated adapters"}], "gaps": []}, "readiness": {"state": "complete", "tier": "R1", "blocking_axis": "none", "blocked_on": "nothing:replicable_now", "axes": {"method": {"tier": "R1", "expressible": true, "required_operations": ["survival_km"], "missing_operations": [], "basis": "The paper names the method it used and the corpus's method extractor maps it onto the DSL catalogue: kaplan_meier."}, "capability": {"tier": "R1", "capability_id": "capability:computational_analysis", "availability_state": "owned", "basis": "The computational analysis is owned. The physical bench the paper used is not, so a physical validation cannot be run here."}, "data": {"tier": "R1", "reachable": true, "accessions": ["GSE48501"], "resolved_accessions": ["GSE48501"], "statements": ["The data that support the findings of this study are available from the corresponding author upon reasonable request."], "basis": "The paper names GSE48501 in Gene Expression Omnibus (GEO) database and the accession resolves in the repository. No dataset was downloaded and no licence was read."}}, "can_run": {"dsl_operations": ["survival_km"], "assets": ["source:pmid:34432380", "data:geo:GSE48501", "asset:table:pmid:34432380:1", "asset:table:pmid:34432380:2", "asset:table:pmid:34432380:3"], "steps": ["run_analysis"]}, "must_build": {"dsl_operations": [], "converters": [], "readers": [], "capabilities": [], "data_gaps": ["data:geo:GSE48501"]}, "gaps": []}, "review": {"state": "partial", "machine_critique": {"kind": "extraction_review", "reader": {"model": "MiniMax-M3.1-Flash", "provider": "minimax", "provider_family": "minimax", "read_at": "2026-10-31T19:46:29Z", "independence": "single_reader"}, "evidence_check": {"method": null, "availability": "verbatim"}, "calls": 3, "usage": {"prompt_tokens": 36441, "completion_tokens": 1305, "cached_tokens": 792}}, "human_critique": null, "stages": [{"id": "extraction", "state": "complete", "reader": "MiniMax-M3.1-Flash", "provider": "minimax"}], "gaps": ["review.independent_reader", "review.machine_critique", "review.human_critique"]}, "execution": {"state": "absent", "status": "not_run", "mode": null, "runs": [], "gaps": ["execution.not_run"]}, "provenance": {"entities": [{"id": "pmid:34432380", "type": "paper", "label": "pmid:34432380"}, {"id": "source:pmid:34432380", "type": "manuscript", "label": "PMID 34432380 full text"}, {"id": "data:geo:GSE48501", "type": "dataset", "label": "GEO GSE48501"}], "activities": [{"id": "activity-reading-sci-2026-11-01", "type": "classification", "used": [{"id": "pmid:34432380", "type": "paper", "label": "pmid:34432380"}, {"id": "source:pmid:34432380", "type": "manuscript", "label": "PMID 34432380 full text"}, {"id": "data:geo:GSE48501", "type": "dataset", "label": "GEO GSE48501"}], "agent": "agent:corpus-assay-engine"}, {"id": "activity-read-34432380", "type": "extraction", "used": ["source:pmid:34432380"], "agent": "agent:minimax-reader"}, {"id": "activity-resolve-GSE48501", "type": "accession_resolution", "used": ["data:geo:GSE48501"], "agent": "agent:corpus-assay-engine"}], "agents": [{"id": "agent:corpus-assay-engine", "type": "software", "label": "Corpus assay engine"}, {"id": "agent:minimax-reader", "type": "software", "label": "MiniMax literature reader"}], "source_run_id": "reading-sci-2026-11-01", "dsl_catalogue_fingerprint": "343fb30756ba6ec3", "capability_table_fingerprint": "2cb3e42f047d2ecf", "snapshot_id": "ba34b49490d9bfaf"}, "lineage": {"parent_id": "pmid:34432380", "parent_hash": "sha256:9db1124eda0dddc6b77a36c1c50ebefdebfd16f3dc6e6b7a89440a790fd1bba3", "fork_of": null, "generation": 5}, "gaps": ["asset:data:geo:GSE48501 licence not read", "asset:data:geo:GSE48501 not downloaded", "execution.not_run", "review.human_critique", "review.independent_reader", "review.machine_critique"], "assays": [{"role": "data_generation", "definition_id": "rna_seq", "definition_version": "99e1195c7d6f", "definition_digest": null, "required_operations": [], "support_state": "partial", "source_hashes": {"assay_lexicon": "99e1195c7d6f"}, "confidence": 0.99, "evidence": ["ls and marker genes identified by integrated transcriptome analysis in nasopharyngeal carcinoma.", "rify the mechanism of NPC radioresistance by RNA sequencing and bioinformatics analysis of the differenc", "different radiosensitivity were analyzed by RNA sequencing. Differentially expressed genes in RNA seque", "equencing. Differentially expressed genes in RNA sequencing data were identified using R software. The d"], "order_basis": "paper_text_order:35", "id": "assay:1"}, {"role": "data_generation", "definition_id": "qpcr", "definition_version": "99e1195c7d6f", "definition_digest": null, "required_operations": [], "support_state": "partial", "source_hashes": {"assay_lexicon": "99e1195c7d6f"}, "confidence": 0.99, "evidence": ["cance of the differentially expressed genes. RT-qPCR was performed to validate the expression lev", "in the two datasets, which were validated by RT-qPCR. The findings of this study provide new clue", "ce of the differentially expressed genes. RT-qPCR was performed to validate the expression lev", "the two datasets, which were validated by RT-qPCR. The findings of this study provide new clue"], "order_basis": "paper_text_order:1299", "id": "assay:2"}, {"role": "analysis", "definition_id": "survival_analysis", "definition_version": "f2132e96ae6c7a4e", "definition_digest": null, "required_operations": ["survival_km"], "support_state": "supported", "source_hashes": {"dsl_catalogue": "f2132e96ae6c7a4e"}, "confidence": 0.7, "evidence": ["Kaplan-Meier"], "order_basis": "consumes_earlier_output", "id": "assay:3"}]}