← All .science files
pmid:34484169
The Role of graRS in Regulating Virulence and Antimicrobial Resistance in Methicillin-Resistant Staphylococcus aureus.
Le Chen · Zihui Wang · Tao Xu · Hongfei Ge · Fangyue Zhou · Xiaoyi Zhu · Xianhui Li · Di Qu · Chunquan Zheng · Yang Wu · Keqing Zhao
Frontiers in microbiology · 2021 doi:10.3389/fmicb.2021.727104
Paper
complete
Experiment
partial
Data
partial
Analysis
complete
Execution
absent
Execution evidence has not yet been added to this .science file. Explore its methods, data and open questions to plan the next step.
Record details sci_version · id · kind · revision · content_hash · schema · created_at · updated_at · generator
paper object · 10 fields
authors array · 11 items
claims array · 2 items
[0] object · 6 fields
gaps array · 0 items
experiment object · 8 fields
steps array · 3 items
[0] object · 13 fields
parameters object · 0 fields
inputs array · 1 item
outputs array · 1 item
instruments array · 0 items
reagents array · 0 items
[1] object · 13 fields
parameters object · 0 fields
inputs array · 0 items
outputs array · 1 item
instruments array · 0 items
reagents array · 0 items
[2] object · 13 fields
parameters object · 0 fields
inputs array · 0 items
outputs array · 1 item
instruments array · 0 items
reagents array · 0 items
materials array · 0 items
instruments array · 0 items
reagents array · 0 items
conditions object · 0 fields
gaps array · 1 item
data object · 3 fields
assets array · 5 items
[0] object · 15 fields
structure object · 4 fields
[1] object · 16 fields
structure object · 5 fields
table object · 8 fields
rows array · 63 items
[0] array · 2 items
[1] array · 2 items
[2] array · 2 items
[3] array · 2 items
[4] array · 2 items
[5] array · 2 items
[6] array · 2 items
[7] array · 2 items
[8] array · 2 items
[9] array · 2 items
[10] array · 2 items
[11] array · 2 items
[12] array · 2 items
[13] array · 2 items
[14] array · 2 items
[15] array · 2 items
[16] array · 2 items
[17] array · 2 items
[18] array · 2 items
[19] array · 2 items
[20] array · 2 items
[21] array · 2 items
[22] array · 2 items
[23] array · 2 items
[24] array · 2 items
[25] array · 2 items
[26] array · 2 items
[27] array · 2 items
[28] array · 2 items
[29] array · 2 items
[30] array · 2 items
[31] array · 2 items
[32] array · 2 items
[33] array · 2 items
[34] array · 2 items
[35] array · 2 items
[36] array · 2 items
[37] array · 2 items
[38] array · 2 items
[39] array · 2 items
[40] array · 2 items
[41] array · 2 items
[42] array · 2 items
[43] array · 2 items
[44] array · 2 items
[45] array · 2 items
[46] array · 2 items
[47] array · 2 items
[48] array · 2 items
[49] array · 2 items
[50] array · 2 items
[51] array · 2 items
[52] array · 2 items
[53] array · 2 items
[54] array · 2 items
[55] array · 2 items
[56] array · 2 items
[57] array · 2 items
[58] array · 2 items
[59] array · 2 items
[60] array · 2 items
[61] array · 2 items
[62] array · 2 items
[2] object · 16 fields
structure object · 5 fields
table object · 8 fields
rows array · 4 items
[0] array · 4 items
[1] array · 4 items
[2] array · 4 items
[3] array · 4 items
[3] object · 16 fields
structure object · 5 fields
table object · 8 fields
rows array · 25 items
[0] array · 4 items
[1] array · 4 items
[2] array · 3 items
[3] array · 3 items
[4] array · 3 items
[5] array · 3 items
[6] array · 3 items
[7] array · 3 items
[8] array · 4 items
[9] array · 3 items
[10] array · 3 items
[11] array · 3 items
[12] array · 3 items
[13] array · 3 items
[14] array · 3 items
[15] array · 3 items
[16] array · 3 items
[17] array · 3 items
[18] array · 4 items
[19] array · 3 items
[20] array · 3 items
[21] array · 3 items
[22] array · 3 items
[23] array · 4 items
[24] array · 3 items
[4] object · 16 fields
structure object · 5 fields
table object · 8 fields
rows array · 6 items
[0] array · 2 items
[1] array · 5 items
[2] array · 5 items
[3] array · 5 items
[4] array · 5 items
[5] array · 5 items
gaps array · 0 items
analysis object · 4 fields
methods array · 2 items
[0] object · 10 fields
dsl_operations array · 1 item
missing_operations array · 0 items
parameters object · 0 fields
data_shapes array · 1 item
[1] object · 10 fields
dsl_operations array · 1 item
missing_operations array · 0 items
parameters object · 0 fields
data_shapes array · 1 item
targets array · 0 items
gaps array · 0 items
capability object · 3 fields
requirements array · 1 item
[0] object · 6 fields
assay_families array · 9 items
gaps array · 0 items
readiness object · 8 fields
axes object · 3 fields
method object · 5 fields
required_operations array · 1 item
missing_operations array · 0 items
capability object · 4 fields
data object · 6 fields
accessions array · 0 items
resolved_accessions array · 0 items
statements array · 1 item
can_run object · 3 fields
dsl_operations array · 1 item
assets array · 5 items
steps array · 1 item
must_build object · 5 fields
dsl_operations array · 0 items
converters array · 0 items
readers array · 0 items
capabilities array · 0 items
data_gaps array · 1 item
gaps array · 1 item
review object · 5 fields
machine_critique object · 5 fields
reader object · 5 fields
evidence_check object · 2 fields
usage object · 3 fields
stages array · 1 item
[0] object · 4 fields
gaps array · 3 items
provenance object · 7 fields
entities array · 3 items
activities array · 3 items
[0] object · 4 fields
used array · 3 items
[0] object · 3 fields
[1] object · 3 fields
[2] object · 3 fields
[1] object · 4 fields
agents array · 2 items
lineage object · 4 fields
gaps array · 5 items
assays array · 4 items
[0] object · 11 fields
required_operations array · 0 items
source_hashes object · 1 field
evidence array · 2 items
[1] object · 11 fields
required_operations array · 0 items
source_hashes object · 1 field
evidence array · 3 items
[2] object · 11 fields
required_operations array · 0 items
source_hashes object · 1 field
evidence array · 1 item
[3] object · 11 fields
required_operations array · 1 item
source_hashes object · 1 field
evidence array · 1 item
Complete file
{"sci_version": "1.2", "schema": "https://corpus.bntrg.co.uk/sci/1.0/sci.schema.json", "id": "pmid:34484169", "kind": "science-record", "revision": 6, "content_hash": "sha256:0ae0abf240f9072c14fc253d357967d6bede8f7eb6a6a99d6921481383a33b1f", "created_at": "2026-11-01T15:41:50Z", "updated_at": "2026-11-01T21:26:09Z", "generator": {"name": "corpus-assay-engine", "run_id": "reading-sci-2026-11-01"}, "paper": {"state": "complete", "title": "The Role of graRS in Regulating Virulence and Antimicrobial Resistance in Methicillin-Resistant Staphylococcus aureus.", "doi": "10.3389/fmicb.2021.727104", "pmid": "34484169", "authors": ["Le Chen", "Zihui Wang", "Tao Xu", "Hongfei Ge", "Fangyue Zhou", "Xiaoyi Zhu", "Xianhui Li", "Di Qu", "Chunquan Zheng", "Yang Wu", "Keqing Zhao"], "journal": "Frontiers in microbiology", "year": 2021, "abstract": "Methicillin-resistant Staphylococcus aureus (MRSA) is a common cause of both community- and hospital-associated infections. The antibiotic resistance and virulence characteristics of MRSA are largely regulated by two-component signal transduction systems (TCS) including the graRS TCS. To make a relatively comprehensive insight into graRS TCS in MRSA, the bioinformatics analysis of dataset GSE26016 (a S. aureus HG001 WT strain vs. the ΔgraRS mutant) from Gene Expression Omnibus (GEO) database was performed, and a total of 563 differentially expressed genes (DEGs) were identified. GO analysis revealed that the DEGs were mainly enriched in the \"de novo\" IMP biosynthetic process, lysine biosynthetic process via diaminopimelate, and pathogenesis; and they were mainly enriched in purine metabolism, lysine biosynthesis, and monobactam biosynthesis in KEGG analysis. WGCNA suggested that the turquoise module was related to the blue module, and the genes in these two modules were associated with S. aureus virulence and infection. To investigate the role of graRS in bacterial virulence, a graRS knockout mutant (ΔgraRS) was constructed using MRSA USA500 2,395 strain as a parent strain. Compared to the wild-type strain, the USA500ΔgraRS showed reduced staphyloxanthin production, retarded coagulation, weaker hemolysis on blood agar plates, and a decreased biofilm formation. These altered phenotypes were restored by the complementation of a plasmid-expressed graRS. Meanwhile, an expression of the virulence-associated genes (coa, hla, hlb, agrA, and mgrA) was downregulated in the ΔgraRS mutant. Consistently, the A549 epithelial cells invasion of the ΔgraRS mutant was 4-fold lower than that of the USA500 wild-type strain. Moreover, on the Galleria mellonella infection model, the survival rate at day 5 post infection in the USA500ΔgraRS group (55%) was obviously higher than that in the USA500 group (20%), indicating graRS knockout leads to a decreased virulence in vivo. In addition, the deletion of the graRS in the MRSA USA500 strain resulted in its increased susceptibilities to ampicillin, oxacillin, vancomycin, and gentamicin. Our work suggests that the graRS TCS plays an important role in regulating S. aureus virulence in vitro and in vivo and modulate bacterial resistance to various antibiotics.", "claims": [{"id": "claim-method", "statement": "Kaplan–Meier analysis was performed for the survival plots of in vivo infection. A log-rank test was carried out for comparison of survival curves.", "kind": "methodological", "target": null, "evidence": [{"asset": "source:pmid:34484169", "locator": "sections[19] \"Statistical Analysis\" paragraph 2", "quote": "Kaplan–Meier analysis was performed for the survival plots of in vivo infection. A log-rank test was carried out for comparison of survival curves."}], "state": "complete"}, {"id": "claim-data-access", "statement": "The original contributions presented in the study are included in the article/Supplementary Material, and further inquiries can be directed to the corresponding author/s.", "kind": "methodological", "target": null, "evidence": [{"asset": "source:pmid:34484169", "locator": "sections[31] \"Data Availability Statement\" paragraph 2", "quote": "The original contributions presented in the study are included in the article/Supplementary Material, and further inquiries can be directed to the corresponding author/s."}], "state": "complete"}], "gaps": []}, "experiment": {"state": "partial", "objective": null, "steps": [{"id": "read_published_estimate", "order": 1, "name": "Read the published estimate from the source", "kind": "other", "state": "complete", "blocked_on": null, "description": "The claim, method and evidence span published with the source article.", "duration_hours": null, "parameters": {}, "inputs": ["source:pmid:34484169"], "outputs": ["the published estimate and its evidence"], "instruments": [], "reagents": []}, {"id": "obtain_source_data", "order": 2, "name": "Obtain the source data from the named repository", "kind": "data-preparation", "state": "blocked", "blocked_on": "data:accession_absent", "description": "The GEO series accession resolves and its sample accessions are listed. This lane did not download the dataset or read its licence.", "duration_hours": null, "parameters": {}, "inputs": [], "outputs": ["the source data with its repository provenance"], "instruments": [], "reagents": []}, {"id": "run_analysis", "order": 3, "name": "Run the published analysis", "kind": "analysis", "state": "complete", "blocked_on": null, "description": "Apply the paper's statistical method to the resolved series and compare the result with the published target.", "duration_hours": null, "parameters": {}, "inputs": [], "outputs": ["the replicated result and its comparison"], "instruments": [], "reagents": []}], "materials": [], "instruments": [], "reagents": [], "conditions": {}, "gaps": ["step:obtain_source_data blocked on data:accession_absent"]}, "data": {"state": "partial", "assets": [{"id": "source:pmid:34484169", "role": "manuscript", "format": "xml", "media_type": "application/xml", "uri": "https://doi.org/10.3389/fmicb.2021.727104", "sha256": "sha256:0995c921dc7ff1c99809d0ab73d317c42037c804ec8eae0b4ba5d3ba586aa5e6", "bytes": 53855, "access": "open", "state": "resolved", "reader": null, "reader_status": "reader_required", "identifier": "10.3389/fmicb.2021.727104", "version": null, "note": "Full article fetched from PMC; the checksum covers the rendered section body, not the original XML bytes.", "structure": {"pmcid": "PMC8415711", "source": "europe_pmc_fulltext", "coverage": "whole_body", "text_hash_scope": "rendered_section_body"}}, {"id": "asset:table:pmid:34484169:1", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:bc6123ee25ebf1a0bc13d3bd508d37ddc24a0153d32de0a04b53ef62921be276", "bytes": 2380, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[10]/table-wrap[1]#tab1", "version": null, "note": "Primers used in this study.", "structure": {"pmcid": "PMC8415711", "section_index": 10, "section_title": "RNA Extraction and Quantitative Real-Time-PCR", "row_count": 63, "column_count": 2}, "table": {"label": "Table 1", "caption": "Primers used in this study.", "rows": [["Primers", "Sequence (5' → 3')"], ["gyrB(F)", "ACATTACAGCAGCGTATTAG"], ["gyrB(R)", "CTCATAGTGATAGGAGTCTTCT"], ["graR(F)", "GTTGCTGGTATTGAAGATT"], ["graR(R)", "GTTCCATACTCATCACTTG"], ["graS(F)", "TTACTATATGAATGGTCTCGTAT"], ["graS(R)", "ACCTGACTAATATGTCTTGTT"], ["vraF(F)", "AAGAAGTGTTGCGAGATA"], ["vraF(R)", "ATGCTTGCGTATATCAGA"], ["vraG(F)", "GTTAATCGGTGTCGCTTAT"], ["vraG(R)", "ATCCTGTGGTAATCAATACTATAC"], ["dltX(F)", "GCCACCTAATAAATATGTTGAAGC"], ["dltX(R)", "GTGTCGCCACTGCCATAA"], ["dltA(F)", "GAAGGTGAACTTGTTATCG"], ["dltA(R)", "TTCCATTCTGTAGCCATT"], ["mprF(F)", "CGCTATTACTTCTGGCTTACG"], ["mprF(R)", "AATAATCTCCTCGCAATCTTCAAT"], ["mecA(F)", "TTAATAAGTGAGGTGCGTTA"], ["mecA(R)", "TAGGTGTTGGTGAAGATATAC"], ["mecR1(F)", "GATTAAGGCATTCCGACAA"], ["mecR1(R)", "CGACTACGACAGTTGGTA"], ["femA(F)", "GCTGAAGATGCTGGTGTAGTT"], ["femA(R)", "GTGCGGTATATGCTGCGTAA"], ["femB(F)", "TTCTCTGGTGGTTCATCA"], ["femB(R)", "CGCCATAATCTTCACTGTT"], ["pbp1(F)", "AAGTGCCAGATGTTGAAGG"], ["pbp 1(R)", "GTGTGCCAGAACCAATAGTAA"], ["pbp 2(F)", "ACACCTCAATACACTATG"], ["pbp 2(R)", "GGATACTACCACTTACTG"], ["pbp 3(F)", "TTCAGCCGTATCCAACATT"], ["pbp 3(R)", "GTGCCAAGAGGTCGTATT"], ["pbp 4(F)", "TATGAACAATAAGTGCTAATCC"], ["pbp 4(R)", "GACCTCCAACTGTAGAAG"], ["fmtA(F)", "TAACCAATCCATTATTACAT"], ["fmtA(R)", "ACAACTACATACTTATCATTA"], ["fmtB(F)", "ATTGCTAATGCTTCAGTT"], ["fmtB(R)", "ATAATGGTGTGGATAATGG"], ["glmM(F)", "TGGATTATGAGAGGCTGAA"], ["glmM(R)", "GAAGTGATGCGATTAGGTATT"], ["fmtC(F)", "CGCTATTACTTCTGGCTTACG"], ["fmtC(R)", "AATAATCTCCTCGCAATCTTCAAT"], ["abcA(F)", "GAACCTATTGAACCGACAGAA"], ["abcA(R)", "TTGGAACGACACATCATCTAAT"], ["trfA(F)", "GCATATCATAGCAATCCAAT"], ["trfA(R)", "ACTTCTGTTCTGTCTGTT"], ["llm(F)", "CTGCCTTAGTAGTTGCTT"], ["llm(R)", "CTATTGTAATGAGTCCGATTG"], ["flp(F)", "CCAATGATTCGCAACAACA"], ["flp(R)", "CAACATCTTGATAACCATAACCTT"], ["prfp(F)", "AACGCTTGTTGTAAGATT"], ["prfp(R)", "TGTTGTAAGTCAATTAGAGG"], ["mdh(F)", "GCACTTCCAATTACTGTT"], ["mdh(R)", "GCAGGTAGACTATATCGT"], ["spx(F)", "GTTGATATTGATTCACTACCA"], ["spx(R)", "CGTTGTGCTTCTTGTAAT"], ["mgrA(F)", "TACCTAATAAGCGATTAAGTT"], ["mgrA(R)", "AACGAATGGAACAAGTAG"], ["norG(F)", "GCACCAGCAATAAGAATAGG"], ["norG(R)", "TTCAACATCTCATATACAACCATT"], ["sigB(F)", "TTCCATTGCTTCTAACACTT"], ["sigB(R)", "GATGAACTAACCGCTGAAT"], ["agrA(F)", "GCAGTAATTCAGTGTATGTTCA"], ["agrA(R)", "TATGGCGATTGACGACAA"]], "row_count": 63, "column_count": 2, "numeric_cells": 8, "header_rows": 1, "locator": "section[10]/table-wrap[1]#tab1"}}, {"id": "asset:table:pmid:34484169:2", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:e5f3c597aaf4e8bf5b35670a696425ee048a89b67301f3a09aba3d151c61dabb", "bytes": 348, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[24]/table-wrap[1]#tab2", "version": null, "note": "The number of mRNAs contained in different modules (top six modules).", "structure": {"pmcid": "PMC8415711", "section_index": 24, "section_title": "Co-expression Network Analysis of GSE26016", "row_count": 4, "column_count": 4}, "table": {"label": "Table 2", "caption": "The number of mRNAs contained in different modules (top six modules).", "rows": [["Modules*", "Freq*", "Modules", "Freq"], ["Turquoise", "964", "Blue", "497"], ["Grey", "407", "Brown", "332"], ["Yellow", "134", "Green", "52"]], "row_count": 4, "column_count": 4, "numeric_cells": 6, "header_rows": 1, "locator": "section[24]/table-wrap[1]#tab2"}}, {"id": "asset:table:pmid:34484169:3", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:e4204f314daabc1fa67130119fde56f166615e5578ce554b712e09d82a7db156", "bytes": 1640, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[24]/table-wrap[2]#tab3", "version": null, "note": "GO and KEGG enrichment analyses of module blue and turquoise constructed by WGCNA (p < 0.05, count ≥ 10).", "structure": {"pmcid": "PMC8415711", "section_index": 24, "section_title": "Co-expression Network Analysis of GSE26016", "row_count": 25, "column_count": 4}, "table": {"label": "Table 3", "caption": "GO and KEGG enrichment analyses of module blue and turquoise constructed by WGCNA (p < 0.05, count ≥ 10).", "rows": [["Module", "Term", "Count", "p"], ["Turquoise_GO", "GO:0006189~“de novo” IMP biosynthetic process", "11", "0.002"], ["GO:0019843~rRNA binding", "22", "0.004"], ["GO:0022625~cytosolic large ribosomal subunit", "16", "0.005"], ["GO:0000287~magnesium ion binding", "36", "0.007"], ["GO:0003735~structural constituent of ribosome", "29", "0.012"], ["GO:0005737~cytoplasm", "145", "0.016"], ["GO:0051287~NAD binding", "13", "0.047"], ["Turquoise_KEGG", "sao01110: Biosynthesis of secondary metabolites", "108", "0.000"], ["sao00230: Purine metabolism", "34", "0.001"], ["sao01130: Biosynthesis of antibiotics", "76", "0.002"], ["sao00300: Lysine biosynthesis", "11", "0.004"], ["sao01100: Metabolic pathways", "183", "0.007"], ["sao01210:2-Oxocarboxylic acid metabolism", "14", "0.009"], ["sao01230: Biosynthesis of amino acids", "51", "0.010"], ["sao00290: Valine, leucine, and isoleucine biosynthesis", "10", "0.017"], ["sao00770: Pantothenate and CoA biosynthesis", "11", "0.031"], ["sao03018: RNA degradation", "10", "0.033"], ["Blue_GO", "GO:0005576~extracellular region", "35", "0.000"], ["GO:0009405~pathogenesis", "28", "0.000"], ["GO:0003735~structural constituent of ribosome", "15", "0.010"], ["GO:0009401~phosphoenolpyruvate-dependent sugar phosphotransferase system", "11", "0.010"], ["GO:0016020~membrane", "11", "0.034"], ["Blue_KEGG", "sao00052: Galactose metabolism", "13", "0.000"], ["sao05150: Staphylococcus aureus infection", "11", "0.010"]], "row_count": 25, "column_count": 4, "numeric_cells": 72, "header_rows": 1, "locator": "section[24]/table-wrap[2]#tab3"}}, {"id": "asset:table:pmid:34484169:4", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:6eff6d9956f6f3a9c5bbfb356dbc5bb3e6ab70d457741fd2c5586ccd39826f2a", "bytes": 512, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[29]/table-wrap[1]#tab4", "version": null, "note": "The MIC of ampicillin, gentamicin, oxacillin, and vancomycin for different Staphylococcus aureus strains (the broth microdilution method).", "structure": {"pmcid": "PMC8415711", "section_index": 29, "section_title": "Effect of graRS Mutation in USA500 on the Antimicrobial Susceptibilities", "row_count": 6, "column_count": 5}, "table": {"label": "Table 4", "caption": "The MIC of ampicillin, gentamicin, oxacillin, and vancomycin for different Staphylococcus aureus strains (the broth microdilution method).", "rows": [["", "MIC*"], ["", "Ampicillin", "Oxacillin", "Vancomycin", "Gentamicin"], ["USA500WT", ">8", ">8", "1", "4"], ["USA500ΔgraRS", "2", "2", "0.25", "0.5"], ["USA500ΔgraRS:: pRB475-graRS", "8", ">8", "1", "4"], ["ATCC29213", "2", "0.125", "0.5", "1"]], "row_count": 6, "column_count": 5, "numeric_cells": 20, "header_rows": 2, "locator": "section[29]/table-wrap[1]#tab4"}}], "gaps": []}, "analysis": {"state": "complete", "methods": [{"id": "method-1", "family": "survival_analysis", "specific": "log_rank_test", "label": "Survival analysis", "dsl_operations": ["logrank_test"], "missing_operations": [], "expressible": true, "parameters": {}, "data_shapes": ["time_to_event_with_censoring"], "evidence": {"score": 1.0, "band": "verbatim", "quote": "Kaplan–Meier analysis was performed for the survival plots of in vivo infection. A log-rank test was carried out for comparison of survival curves."}}, {"id": "method-2", "family": "clustering", "specific": "hierarchical", "label": "Clustering", "dsl_operations": ["hierarchical_cluster"], "missing_operations": [], "expressible": true, "parameters": {}, "data_shapes": ["feature_matrix"], "evidence": {"score": 0.8, "band": "high", "quote": "hierarchical clustering"}}], "targets": [], "gaps": []}, "capability": {"state": "complete", "requirements": [{"capability_id": "capability:computational_analysis", "label": "Computational analysis platform", "assay_families": ["meta_analysis", "machine_learning", "survival_analysis", "statistical_regression", "pca", "molecular_docking", "network_analysis", "differential_expression", "gwas"], "availability_state": "owned", "tier_unlocked": "R1", "candidate": "Automated Assays Laravel application and simulated adapters"}], "gaps": []}, "readiness": {"state": "blocked", "tier": "R4", "blocking_axis": "data", "blocked_on": "data:accession_absent", "axes": {"method": {"tier": "R1", "expressible": true, "required_operations": ["logrank_test"], "missing_operations": [], "basis": "The paper names the method it used and the corpus's method extractor maps it onto the DSL catalogue: log_rank_test."}, "capability": {"tier": "R1", "capability_id": "capability:computational_analysis", "availability_state": "owned", "basis": "The computational analysis is owned. The physical bench the paper used is not, so a physical validation cannot be run here."}, "data": {"tier": "R4", "reachable": false, "accessions": [], "resolved_accessions": [], "statements": ["The original contributions presented in the study are included in the article/Supplementary Material, and further inquiries can be directed to the corresponding author/s."], "basis": "The paper names no accession to its source data, so the data has to come from the authors."}}, "can_run": {"dsl_operations": ["logrank_test"], "assets": ["source:pmid:34484169", "asset:table:pmid:34484169:1", "asset:table:pmid:34484169:2", "asset:table:pmid:34484169:3", "asset:table:pmid:34484169:4"], "steps": ["run_analysis"]}, "must_build": {"dsl_operations": [], "converters": [], "readers": [], "capabilities": [], "data_gaps": ["data:geo:None"]}, "gaps": ["data:accession_absent"]}, "review": {"state": "partial", "machine_critique": {"kind": "extraction_review", "reader": {"model": "MiniMax-M3.1-Flash", "provider": "minimax", "provider_family": "minimax", "read_at": "2026-10-31T19:47:32Z", "independence": "single_reader"}, "evidence_check": {"method": "verbatim", "availability": "verbatim"}, "calls": 3, "usage": {"prompt_tokens": 45139, "completion_tokens": 1253, "cached_tokens": 784}}, "human_critique": null, "stages": [{"id": "extraction", "state": "complete", "reader": "MiniMax-M3.1-Flash", "provider": "minimax"}], "gaps": ["review.independent_reader", "review.machine_critique", "review.human_critique"]}, "execution": {"state": "absent", "status": "not_run", "mode": null, "runs": [], "gaps": ["execution.not_run"]}, "provenance": {"entities": [{"id": "pmid:34484169", "type": "paper", "label": "pmid:34484169"}, {"id": "source:pmid:34484169", "type": "manuscript", "label": "PMID 34484169 full text"}, {"id": "data:geo:None", "type": "dataset", "label": "GEO None"}], "activities": [{"id": "activity-reading-sci-2026-11-01", "type": "classification", "used": [{"id": "pmid:34484169", "type": "paper", "label": "pmid:34484169"}, {"id": "source:pmid:34484169", "type": "manuscript", "label": "PMID 34484169 full text"}, {"id": "data:geo:None", "type": "dataset", "label": "GEO None"}], "agent": "agent:corpus-assay-engine"}, {"id": "activity-read-34484169", "type": "extraction", "used": ["source:pmid:34484169"], "agent": "agent:minimax-reader"}, {"id": "activity-resolve-None", "type": "accession_resolution", "used": ["data:geo:None"], "agent": "agent:corpus-assay-engine"}], "agents": [{"id": "agent:corpus-assay-engine", "type": "software", "label": "Corpus assay engine"}, {"id": "agent:minimax-reader", "type": "software", "label": "MiniMax literature reader"}], "source_run_id": "reading-sci-2026-11-01", "dsl_catalogue_fingerprint": "343fb30756ba6ec3", "capability_table_fingerprint": "2cb3e42f047d2ecf", "snapshot_id": "ba34b49490d9bfaf"}, "lineage": {"parent_id": "pmid:34484169", "parent_hash": "sha256:593280f0804880203e0fa54a48fc2f96409b5746eb9d531eaf881cfd1aa959f8", "fork_of": null, "generation": 5}, "gaps": ["execution.not_run", "review.human_critique", "review.independent_reader", "review.machine_critique", "step:obtain_source_data blocked on data:accession_absent"], "assays": [{"role": "data_generation", "definition_id": "cell_culture", "definition_version": "99e1195c7d6f", "definition_digest": null, "required_operations": [], "support_state": "partial", "source_hashes": {"assay_lexicon": "99e1195c7d6f"}, "confidence": 0.99, "evidence": ["ated in the ΔgraRS mutant. Consistently, the A549 epithelial cells invasion of the ΔgraRS muta", "s. The mRNA of the USA500WT and USA500ΔgraRS cultured in TSB at 4 h was extracted, then qRT-PCR was p"], "order_basis": "paper_text_order:1698", "id": "assay:1"}, {"role": "data_generation", "definition_id": "animal_model", "definition_version": "99e1195c7d6f", "definition_digest": null, "required_operations": [], "support_state": "partial", "source_hashes": {"assay_lexicon": "99e1195c7d6f"}, "confidence": 0.99, "evidence": ["raRS knockout leads to a decreased virulence in vivo. In addition, the deletion of the graRS in t", "regulating S. aureus virulence in vitro and in vivo and modulate bacterial resistance to various", "ysis was performed for the survival plots of in vivo infection. A log-rank test was carried out f"], "order_basis": "paper_text_order:2052", "id": "assay:2"}, {"role": "data_generation", "definition_id": "microarray", "definition_version": "99e1195c7d6f", "definition_digest": null, "required_operations": [], "support_state": "partial", "source_hashes": {"assay_lexicon": "99e1195c7d6f"}, "confidence": 0.93, "evidence": ["Materials and Methods Microarray Materials Dataset GSE26016 downloaded from G"], "order_basis": "paper_text_order:2442", "id": "assay:3"}, {"role": "analysis", "definition_id": "survival_analysis", "definition_version": "f2132e96ae6c7a4e", "definition_digest": null, "required_operations": ["logrank_test"], "support_state": "supported", "source_hashes": {"dsl_catalogue": "f2132e96ae6c7a4e"}, "confidence": 1.0, "evidence": ["Kaplan–Meier analysis was performed for the survival plots of in vivo infection. A log-rank test was carried out for comparison of survival curves."], "order_basis": "consumes_earlier_output", "id": "assay:4"}]}