A Co-Expression Network Reveals the Potential Regulatory Mechanism of lncRNAs in Relapsed Hepatocellular Carcinoma.

{"sci_version": "1.2", "schema": "https://corpus.bntrg.co.uk/sci/1.0/sci.schema.json", "id": "pmid:34532296", "kind": "science-record", "revision": 8, "content_hash": "sha256:01dee43956361254a29abdee10d0b1fedad5c047b1917ce2191a0cbeffae6fab", "created_at": "2026-11-01T15:41:52Z", "updated_at": "2026-11-01T22:47:32Z", "generator": {"name": "corpus-assay-engine", "run_id": "reading-sci-2026-11-01"}, "paper": {"state": "complete", "title": "A Co-Expression Network Reveals the Potential Regulatory Mechanism of lncRNAs in Relapsed Hepatocellular Carcinoma.", "doi": "10.3389/fonc.2021.745166", "pmid": "34532296", "authors": ["Yuan Fang", "Yang Yang", "XiaoLi Zhang", "Na Li", "Bo Yuan", "Li Jin", "Sheng Bao", "MengGe Li", "Dan Zhao", "LingRui Li", "Zhong Zeng", "HanFei Huang"], "journal": "Frontiers in oncology", "year": 2021, "abstract": "BACKGROUND: The mechanistic basis for relapsed hepatocellular carcinoma (HCC) remains poorly understood. Recent research has highlighted the important roles of long non-coding RNAs (lncRNAs) in HCC. However, there are only a few studies on the association between lncRNAs and HCC relapse.\nMETHODS: Differentially expressed lncRNAs and mRNAs between a primary HCC group and relapsed HCC group were identified using the edge R package to analyze the GSE101432 dataset. The differentially expressed lncRNAs and mRNAs were used to construct a lncRNA-mRNA co-expression network. Weighted gene co-expression network analysis followed by Gene Ontology (GO) enrichment analyses were conducted on the database. Furthermore, correlation and survival analyses were performed using The Cancer Genome Atlas database, and expression in the clinical samples was verified by qRT-PCR. Thereafter, we inputted the genes from the two groups into the HCC TNM stage and tumor grade database from TCGA. Finally, we performed Kaplan-Meier survival analysis on the lncRNAs related to relapsed HCC.\nRESULTS: In this study, lncRNAs and mRNAs associated with HCC relapse were identified. Two gene modules were found to be closely linked to this. The GO terms in the yellow and black modules were related to cell proliferation, differentiation, and survival, as well as some transcription-related biological processes. Through qRT-PCR, we found that the expression levels of LINC00941 and LINC00668 in relapsed HCC were higher than those in primary HCC. Further, mRNA levels of LOX, OTX1, MICB, NDUFA4L2, BAIAP2L2, and KCTD17 were changed in relapsed HCC compared to levels in primary HCC. In addition, we verified that these genes could predict the overall survival and recurrence-free survival of HCC. Moreover, we found that LINC00668 and LINC00941 could affect tumor grade and TNM stages. In total, we identified and validated two lncRNAs (LINC00941 and LINC00668) and six mRNAs (LOX, MICB, OTX1, BAIAP2L2, KCTD17, NDUFA4L2) associated with HCC relapse.\nCONCLUSION: In summary, we identified the key gene modules and central genes associated with relapsed HCC and constructed lncRNA-mRNA networks related to this. These genes are likely to have potential prognostic value for relapsed HCC and might shed new light on novel biomarkers or diagnostic targets for relapsed HCC.", "claims": [{"id": "claim-method", "statement": "The software edgeR (18), which is specifically applied to analyze the differential expression of genes, was used to screen the RNA-seq data for DEGs. The expression profile of genes associated with HCC (GSE101432) was obtained from the NCBI GEO database (https://www.ncbi.nlm.nih.gov/geo/).", "kind": "methodological", "target": null, "evidence": [{"asset": "source:pmid:34532296", "locator": "sections[4] \"Read Alignments and Analysis of Differentially Expressed Genes (DEGs)\" paragraph 2", "quote": "The software edgeR (18), which is specifically applied to analyze the differential expression of genes, was used to screen the RNA-seq data for DEGs."}, {"asset": "source:pmid:34532296", "locator": "sections[3] \"Data Downloading and Preprocessing\" paragraph 2", "quote": "The expression profile of genes associated with HCC (GSE101432) was obtained from the NCBI GEO database (https://www.ncbi.nlm.nih.gov/geo/)."}], "state": "complete"}, {"id": "claim-data-access", "statement": "Publicly available datasets were analyzed in this study. This data can be found here: Gene Expression Omnibus accession GSE101432 and TCGA (https://portal.gdc.cancer.gov/).", "kind": "methodological", "target": null, "evidence": [{"asset": "source:pmid:34532296", "locator": "sections[22] \"Data Availability Statement\" paragraph 2", "quote": "Publicly available datasets were analyzed in this study. This data can be found here: Gene Expression Omnibus accession GSE101432 and TCGA (https://portal.gdc.cancer.gov/)."}], "state": "complete"}], "gaps": []}, "experiment": {"state": "complete", "objective": null, "steps": [{"id": "read_published_estimate", "order": 1, "name": "Read the published estimate from the source", "kind": "other", "state": "complete", "blocked_on": null, "description": "The claim, method and evidence span published with the source article.", "duration_hours": null, "parameters": {}, "inputs": ["source:pmid:34532296"], "outputs": ["the published estimate and its evidence"], "instruments": [], "reagents": []}, {"id": "obtain_source_data", "order": 2, "name": "Obtain the source data from the named repository", "kind": "data-preparation", "state": "complete", "blocked_on": null, "description": "The GEO series accession resolves and its sample accessions are listed. This lane did not download the dataset or read its licence.", "duration_hours": null, "parameters": {}, "inputs": ["data:geo:GSE101432"], "outputs": ["the source data with its repository provenance"], "instruments": [], "reagents": []}, {"id": "run_analysis", "order": 3, "name": "Run the published analysis", "kind": "analysis", "state": "complete", "blocked_on": null, "description": "Apply the paper's statistical method to the resolved series and compare the result with the published target.", "duration_hours": null, "parameters": {}, "inputs": ["data:geo:GSE101432"], "outputs": ["the replicated result and its comparison"], "instruments": [], "reagents": []}], "materials": [], "instruments": [], "reagents": [], "conditions": {}, "gaps": []}, "data": {"state": "partial", "assets": [{"id": "source:pmid:34532296", "role": "manuscript", "format": "xml", "media_type": "application/xml", "uri": "https://doi.org/10.3389/fonc.2021.745166", "sha256": "sha256:20f32116cb4404fae453222fcc47f9db20763bb1d6c049b6e8d1c322e92d9ae3", "bytes": 49032, "access": "open", "state": "resolved", "reader": null, "reader_status": "reader_required", "identifier": "10.3389/fonc.2021.745166", "version": null, "note": "Full article fetched from PMC; the checksum covers the rendered section body, not the original XML bytes.", "structure": {"pmcid": "PMC8438305", "source": "europe_pmc_fulltext", "coverage": "whole_body", "text_hash_scope": "rendered_section_body"}}, {"id": "data:geo:GSE101432", "role": "raw", "format": "geo-series", "media_type": "application/vnd.ncbi.geo-series+json", "uri": "https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE101432", "sha256": null, "bytes": null, "access": "open", "state": "resolved", "reader": null, "reader_status": "reader_required", "identifier": "GSE101432", "version": null, "note": "Publicly available datasets were analyzed in this study. This data can be found here: Gene Expression Omnibus accession GSE101432 and TCGA (https://portal.gdc.cancer.gov/).", "structure": {"repository": "GEO", "access_route": "GEO accession URL", "access_statement_verbatim": "Publicly available datasets were analyzed in this study. This data can be found here: Gene Expression Omnibus accession GSE101432 and TCGA (https://portal.gdc.cancer.gov/).", "access_statement_kind": "data_availability_statement", "sample_accessions": ["GSM2702824", "GSM2702825", "GSM2702826", "GSM2702827", "GSM2702828", "GSM2702829", "GSM2702830", "GSM2702831", "GSM2702832", "GSM2702833", "GSM2702834", "GSM2702835", "GSM2702836", "GSM2702837", "GSM2702838", "GSM2702839", "GSM2702840", "GSM2702841", "GSM2702842", "GSM2702843", "GSM2702844", "GSM2702845", "GSM2702846", "GSM2702847", "GSM2702848", "GSM2702849", "GSM2702850", "GSM2702851", "GSM2702852", "GSM2702853", "GSM2702854", "GSM2702855", "GSM2702856", "GSM2702857", "GSM2702858", "GSM2702859", "GSM2702860", "GSM2702861", "GSM2702862", "GSM2702863", "GSM2702864", "GSM2702865", "GSM2702866", "GSM2702867", "GSM2702868", "GSM2702869", "GSM2702870", "GSM2702871", "GSM2702872", "GSM2702873", "GSM2702874", "GSM2702875"], "sample_count": 52, "group_sizes": null, "group_sizes_basis": null, "platform": "11154", "taxon": "Homo sapiens", "title": "Comprehensive transcriptome analysis in human liver", "resolution_checked_at": "2026-11-01T15:39:54Z", "resolution_check": "identifier_resolution_only_no_download_no_licence_read", "downloaded": false, "licence_read": false}}, {"id": "asset:table:pmid:34532296:1", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:5d76c6b9caef1e4182bd1915c78e956579e257120d9a62f356b8236f100384b4", "bytes": 914, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[8]/table-wrap[1]#T1", "version": null, "note": "Clinical sample information.", "structure": {"pmcid": "PMC8438305", "section_index": 8, "section_title": "Sample Collection", "row_count": 28, "column_count": 2}, "table": {"label": "Table 1", "caption": "Clinical sample information.", "rows": [["Clinical information", "Sample"], ["Primary Tumor", "5"], ["Relapse Tumor", "3"], ["Age, median, (mean)", "54"], ["Gender, male", "4 (50%)"], ["Length of hospital stay (days) (mean)", "10-14 (12.875)"], ["Liver cirrhosis", "4 (50%)"], ["Classification of liver cancer", ""], ["Hepatocellular carcinoma", "8 (100%)"], ["Intrahepatic cholangiocarcinoma", "0"], ["Tumor diameter", ""], ["<2cm", "1 (12.5%)"], ["2cm-5cm", "5 (62.5%)"], [">5cm", "2 (25.0%)"], ["HBV", ""], ["Positive", "4 (50%)"], ["Negative", "4 (50%)"], ["AFP", ""], ["<400", "4 (50%)"], [">400", "4 (50%)"], ["Tumor location", ""], ["Left liver", "5 (62.5%)"], ["Right liver", "3 (37.5%)"], ["Tumor recurrence time (months)", "18,27,76"], ["Outcome", ""], ["Cure", "1 (12.5%)"], ["Improve", "6 (75%)"], ["Death", "1 (12.5%)"]], "row_count": 28, "column_count": 2, "numeric_cells": 26, "header_rows": 1, "locator": "section[8]/table-wrap[1]#T1"}}, {"id": "asset:table:pmid:34532296:2", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:926bd425ed864b04393e3a8f9111cfdeb7e0847969cf562f07948c74d125aef7", "bytes": 1722, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[9]/table-wrap[1]#T2", "version": null, "note": "Primers of lncRNA and mRNA for qRT-PCR.", "structure": {"pmcid": "PMC8438305", "section_index": 9, "section_title": "qRT-PCR", "row_count": 23, "column_count": 4}, "table": {"label": "Table 2", "caption": "Primers of lncRNA and mRNA for qRT-PCR.", "rows": [["Primers for Validated Genes"], ["Gene", "lncRNA ID/GENE ID", "Prime sequence (5’-3’)"], ["Forward", "Reverse"], ["RP11-334A14.8", "NONHSAT003288.2", "AGGGAACCCCATTCTTCCAA", "AGAGGTCTCAAGGCACAGAT"], ["LINC00668", "NONHSAT057143.2", "GGGTCCAAGGGATCTGCAAG", "CCGCCCAAGATTCCTCTAGC"], ["CTD-2369P2.5", "NONHSAT061043.2", "GCACTTTCCCAAGGGTACAA", "CCCTTGACCCTAACCTCTGA"], ["LINC00941", "NONHSAT027514.2", "CATGTACGTTGCTATCCAGGC", "CTCCTTAATGTCACGCACGAT"], ["AF124730.4", "NONHSAT081627.2", "GCCACACAAATGTTCACCAC", "GAGCAGAAGGACTCAGTGTG"], ["RP13-143G15.4", "NONHSAT115109.2", "ACCCTTGCAACCTTTCTCAG", "TGGCCACCTTGTAGGTTAGA"], ["RP11-973F15.2", "NONHSAT128496.2", "GACAGCCCCCAAAGAACC", "ATCCCCGGACTGCTGC"], ["RP5-967N21.11", "NONHSAT188398.1", "TGGTATGTTTGTGTTCCATTTGC", "AATGCGAGCACAAGATAATTTTT"], ["RASAL1", "8437", "CAGCTCCCTGAATGTTCGC", "TCCTCATCCAGCACGTAGAAG"], ["NDUFA4L2", "56901", "CCTGAGCCCCAATGACCAATA", "TCTGGCCGGTCCTTCTTCA"], ["KCTD17", "79734", "AGTCGGACCGGGATGAGAC", "CCATGCCGGAGGAAGTTCA"], ["BAIAP2L2", "80115", "GCCGAGGTCTACTTCAGTGC", "GCTGGGTGTCAGACATCTGC"], ["MDFI", "4188", "CCACCGGAAGTTGCAGACA", "GGAACTCGCAGAACAGGCA"], ["SLC44A5", "204962", "GACTTTGGTGATCCAAGGACAT", "GTCTGTAGGATAGGCTGCTCT"], ["GPR160", "26996", "CCAGCCATCTACCAAAGCCTG", "GCCAGTAACTCTGAATGCTGACA"], ["LOX", "4015", "GCCGACCAAGATATTCCTGGG", "GCAGGTCATAGTGGCTAAACTC"], ["NXPH4", "11247", "AAGGTCTTCGGACGGCCTA", "GCAGCGAAAACTTGAGGGTAT"], ["OTX1", "5013", "GCGTCGTCGCTGAGTACAC", "ACATGGGATAAGAGGCTGCTG"], ["GMNN", "51053", "GCCCTGGGGTTATTGTCCC", "AGCGCCTTTCTCCGTTTTTCT"], ["MICB", "4277", "TCTTCGTTACAACCTCATGGTG", "TCCCAGGTCTTAGCTCCCAG"]], "row_count": 23, "column_count": 4, "numeric_cells": 32, "header_rows": 3, "locator": "section[9]/table-wrap[1]#T2"}}], "gaps": ["asset:data:geo:GSE101432 not downloaded", "asset:data:geo:GSE101432 licence not read"]}, "analysis": {"state": "partial", "methods": [{"id": "method-1", "family": "differential_expression", "specific": "edger", "label": "Differential expression analysis", "dsl_operations": ["normalise_counts", "differential_expression_fit", "fdr_bh"], "missing_operations": [], "expressible": true, "parameters": {}, "data_shapes": ["count_matrix_with_condition"], "evidence": {"score": 1.0, "band": "reordered", "quote": "The software edgeR (18), which is specifically applied to analyze the differential expression of genes, was used to screen the RNA-seq data for DEGs. The expression profile of genes associated with HCC (GSE101432) was obtained from the NCBI GEO database (https://www.ncbi.nlm.nih.gov/geo/)."}}, {"id": "method-2", "family": "survival_analysis", "specific": "kaplan_meier", "label": "Survival analysis", "dsl_operations": ["survival_km"], "missing_operations": [], "expressible": true, "parameters": {}, "data_shapes": ["time_to_event_with_censoring"], "evidence": {"score": 0.7, "band": "medium", "quote": "Kaplan-Meier"}}, {"id": "method-3", "family": "survival_analysis", "specific": "log_rank_test", "label": "Survival analysis", "dsl_operations": ["logrank_test"], "missing_operations": [], "expressible": true, "parameters": {"hazard_ratio": "Hazard ratios (HR) and 95% confidence int"}, "data_shapes": ["time_to_event_with_censoring"], "evidence": {"score": 0.8, "band": "high", "quote": "log-rank"}}, {"id": "method-4", "family": "principal_component_analysis", "specific": "pca", "label": "Principal component analysis", "dsl_operations": ["pca_fit"], "missing_operations": [], "expressible": true, "parameters": {}, "data_shapes": ["wide_numeric_matrix"], "evidence": {"score": 0.8, "band": "high", "quote": "Principal component analysis"}}], "targets": [], "gaps": ["method.reader_differs_from_extractor"]}, "capability": {"state": "complete", "requirements": [{"capability_id": "capability:computational_analysis", "label": "Computational analysis platform", "assay_families": ["meta_analysis", "machine_learning", "survival_analysis", "statistical_regression", "pca", "molecular_docking", "network_analysis", "differential_expression", "gwas"], "availability_state": "owned", "tier_unlocked": "R1", "candidate": "Automated Assays Laravel application and simulated adapters"}], "gaps": []}, "readiness": {"state": "complete", "tier": "R1", "blocking_axis": "none", "blocked_on": "nothing:replicable_now", "axes": {"method": {"tier": "R1", "expressible": true, "required_operations": ["normalise_counts", "differential_expression_fit", "fdr_bh"], "missing_operations": [], "basis": "The paper names the method it used and the corpus's method extractor maps it onto the DSL catalogue: edger."}, "capability": {"tier": "R1", "capability_id": "capability:computational_analysis", "availability_state": "owned", "basis": "The computational analysis is owned. The physical bench the paper used is not, so a physical validation cannot be run here."}, "data": {"tier": "R1", "reachable": true, "accessions": ["GSE101432"], "resolved_accessions": ["GSE101432"], "statements": ["Publicly available datasets were analyzed in this study. This data can be found here: Gene Expression Omnibus accession GSE101432 and TCGA (https://portal.gdc.cancer.gov/)."], "basis": "The paper names GSE101432 in Gene Expression Omnibus (GEO) and the accession resolves in the repository. No dataset was downloaded and no licence was read."}}, "can_run": {"dsl_operations": ["normalise_counts", "differential_expression_fit", "fdr_bh"], "assets": ["source:pmid:34532296", "data:geo:GSE101432", "asset:table:pmid:34532296:1", "asset:table:pmid:34532296:2"], "steps": ["run_analysis"]}, "must_build": {"dsl_operations": [], "converters": [], "readers": [], "capabilities": [], "data_gaps": ["data:geo:GSE101432"]}, "gaps": []}, "review": {"state": "partial", "machine_critique": {"kind": "extraction_review", "reader": {"model": "MiniMax-M3.1-Flash", "provider": "minimax", "provider_family": "minimax", "read_at": "2026-10-31T18:34:47Z", "independence": "single_reader"}, "evidence_check": {"method": "reordered", "availability": "verbatim"}, "calls": 3, "usage": {"prompt_tokens": 39105, "completion_tokens": 1324, "cached_tokens": 792}}, "human_critique": null, "stages": [{"id": "extraction", "state": "complete", "reader": "MiniMax-M3.1-Flash", "provider": "minimax"}], "gaps": ["review.independent_reader", "review.machine_critique", "review.human_critique"]}, "execution": {"state": "absent", "status": "not_run", "mode": null, "runs": [], "gaps": ["execution.not_run"]}, "provenance": {"entities": [{"id": "pmid:34532296", "type": "paper", "label": "pmid:34532296"}, {"id": "source:pmid:34532296", "type": "manuscript", "label": "PMID 34532296 full text"}, {"id": "data:geo:GSE101432", "type": "dataset", "label": "GEO GSE101432"}], "activities": [{"id": "activity-reading-sci-2026-11-01", "type": "classification", "used": [{"id": "pmid:34532296", "type": "paper", "label": "pmid:34532296"}, {"id": "source:pmid:34532296", "type": "manuscript", "label": "PMID 34532296 full text"}, {"id": "data:geo:GSE101432", "type": "dataset", "label": "GEO GSE101432"}], "agent": "agent:corpus-assay-engine"}, {"id": "activity-read-34532296", "type": "extraction", "used": ["source:pmid:34532296"], "agent": "agent:minimax-reader"}, {"id": "activity-resolve-GSE101432", "type": "accession_resolution", "used": ["data:geo:GSE101432"], "agent": "agent:corpus-assay-engine"}], "agents": [{"id": "agent:corpus-assay-engine", "type": "software", "label": "Corpus assay engine"}, {"id": "agent:minimax-reader", "type": "software", "label": "MiniMax literature reader"}], "source_run_id": "reading-sci-2026-11-01", "dsl_catalogue_fingerprint": "343fb30756ba6ec3", "capability_table_fingerprint": "2cb3e42f047d2ecf", "snapshot_id": "ba34b49490d9bfaf"}, "lineage": {"parent_id": "pmid:34532296", "parent_hash": "sha256:dee2ac31501b2e0b040995a7be66aa83097e99151f6ce3647206ef4af7ca0a2f", "fork_of": null, "generation": 7}, "gaps": ["asset:data:geo:GSE101432 licence not read", "asset:data:geo:GSE101432 not downloaded", "execution.not_run", "method.reader_differs_from_extractor", "review.human_critique", "review.independent_reader", "review.machine_critique"], "assays": [{"role": "data_generation", "definition_id": "rna_seq", "definition_version": "99e1195c7d6f", "definition_digest": null, "required_operations": [], "support_state": "partial", "source_hashes": {"assay_lexicon": "99e1195c7d6f"}, "confidence": 0.93, "evidence": ["expression of genes, was used to screen the RNA-seq data for DEGs. A fold-change ≥2 or ≤0.5 and"], "order_basis": "paper_text_order:2937", "id": "assay:1"}, {"role": "data_generation", "definition_id": "amplicon_seq", "definition_version": "99e1195c7d6f", "definition_digest": null, "required_operations": [], "support_state": "partial", "source_hashes": {"assay_lexicon": "99e1195c7d6f"}, "confidence": 0.93, "evidence": ["e visualization of next-generation sequence (NGS) data and genomic annotations. The pheatmap"], "order_basis": "paper_text_order:4308", "id": "assay:2"}, {"role": "analysis", "definition_id": "differential_expression", "definition_version": "f2132e96ae6c7a4e", "definition_digest": null, "required_operations": ["normalise_counts", "differential_expression_fit", "fdr_bh"], "support_state": "supported", "source_hashes": {"dsl_catalogue": "f2132e96ae6c7a4e"}, "confidence": 1.0, "evidence": ["The software edgeR (18), which is specifically applied to analyze the differential expression of genes, was used to screen the RNA-seq data for DEGs. The expression profile of genes associated with HCC (GSE101432) was obtained from the NCBI GEO database (https://www.ncbi.nlm.nih.gov/geo/)."], "order_basis": "consumes_earlier_output", "id": "assay:3"}]}