The Circadian Clock Gene, Bmal1, Regulates Intestinal Stem Cell Signaling and Represses Tumor Initiation.

{"sci_version": "1.2", "schema": "https://corpus.bntrg.co.uk/sci/1.0/sci.schema.json", "id": "pmid:34534703", "kind": "science-record", "revision": 7, "content_hash": "sha256:9b8744b894cc6ce551329a2937af9f3dc63bd5f85c77863d1e4d0eee0b7bce11", "created_at": "2026-11-01T15:41:52Z", "updated_at": "2026-11-01T22:04:45Z", "generator": {"name": "corpus-assay-engine", "run_id": "reading-sci-2026-11-01"}, "paper": {"state": "complete", "title": "The Circadian Clock Gene, Bmal1, Regulates Intestinal Stem Cell Signaling and Represses Tumor Initiation.", "doi": "10.1016/j.jcmgh.2021.08.001", "pmid": "34534703", "authors": ["Kyle Stokes", "Malika Nunes", "Chantelle Trombley", "Danilo E F L Flôres", "Gang Wu", "Zainab Taleb", "Abedalrhman Alkhateeb", "Suhrid Banskota", "Chris Harris", "Oliver P Love", "Waliul I Khan", "Luis Rueda", "John B Hogenesch", "Phillip Karpowicz"], "journal": "Cellular and molecular gastroenterology and hepatology", "year": 2021, "abstract": "BACKGROUND & AIMS: Circadian rhythms are daily physiological oscillations driven by the circadian clock: a 24-hour transcriptional timekeeper that regulates hormones, inflammation, and metabolism. Circadian rhythms are known to be important for health, but whether their loss contributes to colorectal cancer is not known. We tested the nonredundant clock gene Bmal1 in intestinal homeostasis and tumorigenesis, using the Apcmin model of colorectal cancer.\nMETHODS: Bmal1 mutant, epithelium-conditional Bmal1 mutant, and photoperiod (day/night cycle) disrupted mice bearing the Apcmin allele were assessed for tumorigenesis. Tumors and normal nontransformed tissue were characterized. Intestinal organoids were assessed for circadian transcription rhythms by RNA sequencing, and in vivo and organoid assays were used to test Bmal1-dependent proliferation and self-renewal.\nRESULTS: Loss of Bmal1 or circadian photoperiod increases tumor initiation. In the intestinal epithelium the clock regulates transcripts involved in regeneration and intestinal stem cell signaling. Tumors have no self-autonomous clock function and only weak clock function in vivo. Apcmin clock-disrupted tumors show high Yes-associated protein 1 (Hippo signaling) activity but show low Wnt (Wingless and Int-1) activity. Intestinal organoid assays show that loss of Bmal1 increases self-renewal in a Yes-associated protein 1-dependent manner.\nCONCLUSIONS: Bmal1 regulates intestinal stem cell pathways, including Hippo signaling, and the loss of circadian rhythms potentiates tumor initiation. Transcript profiling: GEO accession number: GSE157357.", "claims": [{"id": "claim-data-access", "statement": "Transcript profiling: GEO accession number: GSE157357.", "kind": "methodological", "target": null, "evidence": [{"asset": "source:pmid:34534703", "locator": "sections[0] \"Abstract\" paragraph 4", "quote": "Transcript profiling: GEO accession number: GSE157357."}], "state": "complete"}], "gaps": []}, "experiment": {"state": "complete", "objective": null, "steps": [{"id": "read_published_estimate", "order": 1, "name": "Read the published estimate from the source", "kind": "other", "state": "complete", "blocked_on": null, "description": "The claim, method and evidence span published with the source article.", "duration_hours": null, "parameters": {}, "inputs": ["source:pmid:34534703"], "outputs": ["the published estimate and its evidence"], "instruments": [], "reagents": []}, {"id": "obtain_source_data", "order": 2, "name": "Obtain the source data from the named repository", "kind": "data-preparation", "state": "complete", "blocked_on": null, "description": "The GEO series accession resolves and its sample accessions are listed. This lane did not download the dataset or read its licence.", "duration_hours": null, "parameters": {}, "inputs": ["data:geo:GSE157357"], "outputs": ["the source data with its repository provenance"], "instruments": [], "reagents": []}, {"id": "run_analysis", "order": 3, "name": "Run the published analysis", "kind": "analysis", "state": "complete", "blocked_on": null, "description": "Apply the paper's statistical method to the resolved series and compare the result with the published target.", "duration_hours": null, "parameters": {}, "inputs": ["data:geo:GSE157357"], "outputs": ["the replicated result and its comparison"], "instruments": [], "reagents": []}], "materials": [], "instruments": [], "reagents": [], "conditions": {}, "gaps": []}, "data": {"state": "partial", "assets": [{"id": "source:pmid:34534703", "role": "manuscript", "format": "xml", "media_type": "application/xml", "uri": "https://doi.org/10.1016/j.jcmgh.2021.08.001", "sha256": "sha256:aaeb09afefe6d1068dd57cdde3cc592d63230689b6f81d8925aca61baa6bae9c", "bytes": 94481, "access": "open", "state": "resolved", "reader": null, "reader_status": "reader_required", "identifier": "10.1016/j.jcmgh.2021.08.001", "version": null, "note": "Full article fetched from PMC; the checksum covers the rendered section body, not the original XML bytes.", "structure": {"pmcid": "PMC8591196", "source": "europe_pmc_fulltext", "coverage": "whole_body", "text_hash_scope": "rendered_section_body"}}, {"id": "data:geo:GSE157357", "role": "raw", "format": "geo-series", "media_type": "application/vnd.ncbi.geo-series+json", "uri": "https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE157357", "sha256": null, "bytes": null, "access": "open", "state": "resolved", "reader": null, "reader_status": "reader_required", "identifier": "GSE157357", "version": null, "note": "Transcript profiling: GEO accession number: GSE157357.", "structure": {"repository": "GEO", "access_route": "GEO accession URL", "access_statement_verbatim": "Transcript profiling: GEO accession number: GSE157357.", "access_statement_kind": "data_availability_statement", "sample_accessions": ["GSM4763503", "GSM4763504", "GSM4763505", "GSM4763506", "GSM4763507", "GSM4763508", "GSM4763509", "GSM4763510", "GSM4763511", "GSM4763512", "GSM4763513", "GSM4763514", "GSM4763515", "GSM4763516", "GSM4763517", "GSM4763518", "GSM4763519", "GSM4763520", "GSM4763521", "GSM4763522", "GSM4763523", "GSM4763524", "GSM4763525", "GSM4763526", "GSM4763527", "GSM4763528", "GSM4763529", "GSM4763530", "GSM4763531", "GSM4763532", "GSM4763533", "GSM4763534", "GSM4763535", "GSM4763536", "GSM4763537", "GSM4763538", "GSM4763539", "GSM4763540", "GSM4763541", "GSM4763542", "GSM4763543", "GSM4763544", "GSM4763545", "GSM4763546", "GSM4763547", "GSM4763548", "GSM4763549", "GSM4763550", "GSM4763551", "GSM4763552", "GSM4763553", "GSM4763554", "GSM4763555", "GSM4763556", "GSM4763557", "GSM4763558", "GSM4763559", "GSM4763560", "GSM4763561", "GSM4763562", "GSM4763563", "GSM4763564", "GSM4763565", "GSM4763566", "GSM4763567", "GSM4763568", "GSM4763569", "GSM4763570", "GSM4763571", "GSM4763572", "GSM4763573", "GSM4763574", "GSM4763575", "GSM4763576", "GSM4763577", "GSM4763578", "GSM4763579", "GSM4763580", "GSM4763581", "GSM4763582", "GSM4763583", "GSM4763584", "GSM4763585", "GSM4763586", "GSM4763587", "GSM4763588", "GSM4763589", "GSM4763590", "GSM4763591", "GSM4763592", "GSM4763593", "GSM4763594", "GSM4763595", "GSM4763596", "GSM4763597", "GSM4763598"], "sample_count": 96, "group_sizes": null, "group_sizes_basis": null, "platform": "24247", "taxon": "Mus musculus", "title": "Rhythmic gene expression in mouse intestinal organoids", "resolution_checked_at": "2026-11-01T15:39:54Z", "resolution_check": "identifier_resolution_only_no_download_no_licence_read", "downloaded": false, "licence_read": false}}, {"id": "asset:table:pmid:34534703:1", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:baa5903803d6ea7fc9aa9400e1bcc59aa281c085752212c756e601bed8645abc", "bytes": 1098, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[18]/table-wrap[1]#tbl1", "version": null, "note": "List of Antibodies Used", "structure": {"pmcid": "PMC8591196", "section_index": 18, "section_title": "Staining and Western Blot", "row_count": 13, "column_count": 5}, "table": {"label": "Table 1", "caption": "List of Antibodies Used", "rows": [["Antibody", "Dilution", "Assay", "Supplier", "Product number"], ["Phosphorylated-histone H3 (Ser10)", "1:1000", "IF", "Upstate/Millipore (Oakville, Ontario)", "06-570"], ["Cleaved caspase 3", "1:200", "IF", "Cell Signaling Tech (Whitby, Ontario)", "9661S"], ["Lysozyme", "1:200", "IF", "Agilent/Dako (Santa Clara, CA)", "A0099"], ["Nr1d1", "1:250", "IF", "Abnova (Taipei City, Taiwan)", "H00009572 M02"], ["Yap (D841X) XP (R)", "1:1001:1000", "DABWB", "Cell Signaling Tech", "140745"], ["β-catenin", "1:250", "DAB", "Abcam (Toronto, Ontario)", "Ab32572"], ["Ki67", "1:100", "DAB", "Abcam", "Ab16667"], ["CD45", "1:200", "IF", "Abcam", "ab10558"], ["Nonphosphorylated YAP (Ser127) (E6U8Z) rabbit mAb", "1:1000", "WB", "Cell Signaling Tech", "29495S"], ["Tubulin", "1:10,000", "WB", "Sigma", "T5168"], ["DK α-rabbit-HRP", "1:10,000", "WB", "Jackson Immunoresearch (West Baltimore Pike, PA)", "711-035-152"], ["DK α-mouse-HRP", "1:10,000", "WB", "Jackson Immunoresearch", "715-035-150"]], "row_count": 13, "column_count": 5, "numeric_cells": 30, "header_rows": 1, "locator": "section[18]/table-wrap[1]#tbl1"}}, {"id": "asset:table:pmid:34534703:2", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:7c753db1866e0b77cf5d4bc4f0fac3817df2214fd56be35aede2e97578ef28e6", "bytes": 1146, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[21]/table-wrap[1]#tbl2", "version": null, "note": "List of Quantitative Polymerase Chain Reaction Primers Used", "structure": {"pmcid": "PMC8591196", "section_index": 21, "section_title": "Quantitative Polymerase Chain Reaction", "row_count": 16, "column_count": 3}, "table": {"label": "Table 2", "caption": "List of Quantitative Polymerase Chain Reaction Primers Used", "rows": [["Axin2", "TGACTCTCCTTCCAGATCCCA", "TGCCCACACTAGGCTGACA"], ["Bmal1", "TGACCCTCATGGAAGGTTAGAA", "GGACATTGCATTGCATGTTGG"], ["Ccnd1", "GCGTACCCTGACACCAATCTC", "CTCCTCTTCGCACTTCTGCTC"], ["cMyc", "ATGCCCCTCAACGTGAACTTC", "GTCGCAGATGAAATAGGGCTG"], ["Cry1", "CACTGGTTCCGAAAGGGACTC", "CTGAAGCAAAAATCGCCACCT"], ["Dolk1", "CAGTGTGGGACCGATACTCCT", "CCAAGCAAAGGCATGACCA"], ["Ereg", "CTGCCTCTTGGGTCTTGACG", "GCGGTACAGTTATCCTCGGATTC"], ["Fam76b", "GAATGTCGGATTGCACATCCT", "GGTCTGAGGTGCTCCATATTTC"], ["Gapdh", "AGGTCGGTGTGAACGGATTTG", "TGTAGACCATGTAGTTGAGGTCA"], ["Golga1", "AAGAATTGGATGCACGAACCA", "AGCCGCTCGTTTAAGTCAGAT"], ["Lgr5", "CCTACTCGAAGACTTACCCAGT", "GCATTGGGGTGAATGATAGCA"], ["Msmo1", "AAACAAAAGTGTTGGCGTGTTC", "AAGCATTCTTAAAGGGCTCCTG"], ["Mlixpl", "AGATGGAGAACCGACGTATCA", "ACTGAGCGTGCTGACAAGTC"], ["Pmpca", "CTGCACACAGACGGTTCAG", "GTCCAGAGTGGTAACTTTGGTTT"], ["Nr1d1", "TGAACGCAGGAGGTGTGATTG", "GAGGACTGGAAGCTATTCTCAGA"], ["Rnf128", "ATTCAAAGAGGCATCCAAGTCAC", "TGCATTTCGTAATCTTCGAGCAG"]], "row_count": 16, "column_count": 3, "numeric_cells": 2, "header_rows": 1, "locator": "section[21]/table-wrap[1]#tbl2"}}, {"id": "asset:table:pmid:34534703:3", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:de76d86a4bd218933d22762fc6334afba7aae46b3af934ff77ef3011c0aac23b", "bytes": 1132, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[24]/table-wrap[1]#tbl3", "version": null, "note": "Details of Statistical Tests", "structure": {"pmcid": "PMC8591196", "section_index": 24, "section_title": "Statistics", "row_count": 13, "column_count": 6}, "table": {"label": "Table 3", "caption": "Details of Statistical Tests", "rows": [["Figure 1"], ["A", "Two-way ANOVA", "f(6, 52) = 2.766; P = .0208", "J", "Unpaired t test", "P < .0001"], ["C", "One-way ANOVATukey post-test", "f(3, 46) = 80.56; P < .0001P < .0001", "K", "Unpaired t test", "P = .7113"], ["D", "One-way ANOVATukey post-test", "f(3, 47) = 57.41; P < .0001;P < .0001", "L", "Unpaired t test", "P = .5447"], ["F", "Unpaired t test", "P = .0338", "M", "Unpaired t test", "P = .4881"], ["H", "One-way ANOVATukey post-test", "f(2, 390) = 5.936; P = .0029;ZT12 P = .0030", "O", "Unpaired t test", "P = .3793"], ["I", "Unpaired t test", "P = .1036", ""], ["Figure 2"], ["B", "Unpaired t test", "P = .0012", "J", "Unpaired t test", "P = .0013"], ["D", "Unpaired t test", "P = .0166", "K", "Unpaired t test", "P < .0001"], ["F", "Two-way ANOVATukey post-test", "f(2, 218) = 3.386; P = .0352ZT4 P = .0246", "L", "Unpaired t test", "P = .0123"], ["G", "Unpaired t test", "P = .031", "N", "Unpaired t test", "P = .0005"], ["I", "Unpaired t test", "P = .1409", "P", "Unpaired t test", "P < .0001"]], "row_count": 13, "column_count": 6, "numeric_cells": 23, "header_rows": 0, "locator": "section[24]/table-wrap[1]#tbl3"}}], "gaps": ["asset:data:geo:GSE157357 not downloaded", "asset:data:geo:GSE157357 licence not read"]}, "analysis": {"state": "complete", "methods": [{"id": "method-1", "family": "multi_omics_integration", "specific": "pathway_progeny", "label": "Multi-omics integration", "dsl_operations": ["multiomics_factor_analysis", "joint_pathway_score"], "missing_operations": [], "expressible": true, "parameters": {}, "data_shapes": ["aligned_multi_layer_matrices"], "evidence": {"score": 0.8, "band": "high", "quote": "Progeny"}}], "targets": [], "gaps": []}, "capability": {"state": "complete", "requirements": [{"capability_id": "capability:computational_analysis", "label": "Computational analysis platform", "assay_families": ["meta_analysis", "machine_learning", "survival_analysis", "statistical_regression", "pca", "molecular_docking", "network_analysis", "differential_expression", "gwas"], "availability_state": "owned", "tier_unlocked": "R1", "candidate": "Automated Assays Laravel application and simulated adapters"}], "gaps": []}, "readiness": {"state": "complete", "tier": "R1", "blocking_axis": "none", "blocked_on": "nothing:replicable_now", "axes": {"method": {"tier": "R1", "expressible": true, "required_operations": ["multiomics_factor_analysis", "joint_pathway_score"], "missing_operations": [], "basis": "The paper names the method it used and the corpus's method extractor maps it onto the DSL catalogue: pathway_progeny."}, "capability": {"tier": "R1", "capability_id": "capability:computational_analysis", "availability_state": "owned", "basis": "The computational analysis is owned. The physical bench the paper used is not, so a physical validation cannot be run here."}, "data": {"tier": "R1", "reachable": true, "accessions": ["GSE157357"], "resolved_accessions": ["GSE157357"], "statements": ["Transcript profiling: GEO accession number: GSE157357."], "basis": "The paper names GSE157357 in GEO and the accession resolves in the repository. No dataset was downloaded and no licence was read."}}, "can_run": {"dsl_operations": ["multiomics_factor_analysis", "joint_pathway_score"], "assets": ["source:pmid:34534703", "data:geo:GSE157357", "asset:table:pmid:34534703:1", "asset:table:pmid:34534703:2", "asset:table:pmid:34534703:3"], "steps": ["run_analysis"]}, "must_build": {"dsl_operations": [], "converters": [], "readers": [], "capabilities": [], "data_gaps": ["data:geo:GSE157357"]}, "gaps": []}, "review": {"state": "partial", "machine_critique": {"kind": "extraction_review", "reader": {"model": "MiniMax-M3.1-Flash", "provider": "minimax", "provider_family": "minimax", "read_at": "2026-10-31T19:49:18Z", "independence": "single_reader"}, "evidence_check": {"method": null, "availability": "verbatim"}, "calls": 3, "usage": {"prompt_tokens": 78552, "completion_tokens": 1071, "cached_tokens": 784}}, "human_critique": null, "stages": [{"id": "extraction", "state": "complete", "reader": "MiniMax-M3.1-Flash", "provider": "minimax"}], "gaps": ["review.independent_reader", "review.machine_critique", "review.human_critique"]}, "execution": {"state": "absent", "status": "not_run", "mode": null, "runs": [], "gaps": ["execution.not_run"]}, "provenance": {"entities": [{"id": "pmid:34534703", "type": "paper", "label": "pmid:34534703"}, {"id": "source:pmid:34534703", "type": "manuscript", "label": "PMID 34534703 full text"}, {"id": "data:geo:GSE157357", "type": "dataset", "label": "GEO GSE157357"}], "activities": [{"id": "activity-reading-sci-2026-11-01", "type": "classification", "used": [{"id": "pmid:34534703", "type": "paper", "label": "pmid:34534703"}, {"id": "source:pmid:34534703", "type": "manuscript", "label": "PMID 34534703 full text"}, {"id": "data:geo:GSE157357", "type": "dataset", "label": "GEO GSE157357"}], "agent": "agent:corpus-assay-engine"}, {"id": "activity-read-34534703", "type": "extraction", "used": ["source:pmid:34534703"], "agent": "agent:minimax-reader"}, {"id": "activity-resolve-GSE157357", "type": "accession_resolution", "used": ["data:geo:GSE157357"], "agent": "agent:corpus-assay-engine"}], "agents": [{"id": "agent:corpus-assay-engine", "type": "software", "label": "Corpus assay engine"}, {"id": "agent:minimax-reader", "type": "software", "label": "MiniMax literature reader"}], "source_run_id": "reading-sci-2026-11-01", "dsl_catalogue_fingerprint": "343fb30756ba6ec3", "capability_table_fingerprint": "2cb3e42f047d2ecf", "snapshot_id": "ba34b49490d9bfaf"}, "lineage": {"parent_id": "pmid:34534703", "parent_hash": "sha256:420f70e9c7f4662ef42a9ad16e34aacca15722661f154120e2fccc33ccf7dcf6", "fork_of": null, "generation": 6}, "gaps": ["asset:data:geo:GSE157357 licence not read", "asset:data:geo:GSE157357 not downloaded", "execution.not_run", "review.human_critique", "review.independent_reader", "review.machine_critique"], "assays": [{"role": "data_generation", "definition_id": "rna_seq", "definition_version": "99e1195c7d6f", "definition_digest": null, "required_operations": [], "support_state": "partial", "source_hashes": {"assay_lexicon": "99e1195c7d6f"}, "confidence": 0.93, "evidence": ["essed for circadian transcription rhythms by RNA sequencing, and in vivo and organoid assays were used t"], "order_basis": "paper_text_order:820", "id": "assay:1"}, {"role": "data_generation", "definition_id": "animal_model", "definition_version": "99e1195c7d6f", "definition_digest": null, "required_operations": [], "support_state": "partial", "source_hashes": {"assay_lexicon": "99e1195c7d6f"}, "confidence": 0.99, "evidence": ["transcription rhythms by RNA sequencing, and in vivo and organoid assays were used to test Bmal1-", "clock function and only weak clock function in vivo. Apcmin clock-disrupted tumors show high Yes", "Methods Animal Housing and Breeding Mice were housed on a 12-hour light/12-hour dark cycle", "light fully penetrated throughout each cage. Mice were maintained under Canadian Council for Animal"], "order_basis": "paper_text_order:840", "id": "assay:2"}, {"role": "analysis", "definition_id": "multi_omics_integration", "definition_version": "f2132e96ae6c7a4e", "definition_digest": null, "required_operations": ["multiomics_factor_analysis", "joint_pathway_score"], "support_state": "supported", "source_hashes": {"dsl_catalogue": "f2132e96ae6c7a4e"}, "confidence": 0.8, "evidence": ["Progeny"], "order_basis": "consumes_earlier_output", "id": "assay:3"}]}