Screening and Bioinformatics Analysis of Competitive Endogenous RNA Regulatory Network --Related to Circular RNA in Breast Cancer.

{"sci_version": "1.2", "schema": "https://corpus.bntrg.co.uk/sci/1.0/sci.schema.json", "id": "pmid:34545330", "kind": "science-record", "revision": 8, "content_hash": "sha256:3992d6faef3cf2699a673f4fb53605e5300c0fdea0c0dbe578ede9ce65da0cf2", "created_at": "2026-11-01T15:41:53Z", "updated_at": "2026-11-01T22:47:33Z", "generator": {"name": "corpus-assay-engine", "run_id": "reading-sci-2026-11-01"}, "paper": {"state": "complete", "title": "Screening and Bioinformatics Analysis of Competitive Endogenous RNA Regulatory Network --Related to Circular RNA in Breast Cancer.", "doi": "10.1155/2021/5575286", "pmid": "34545330", "authors": ["Tao Wang", "Yi Zhang", "Yan He", "Yang Liu", "Peng Qi"], "journal": "BioMed research international", "year": 2021, "abstract": "PURPOSE: Circular RNA as a competitive endogenous RNA (ceRNA) plays a significant role in the pathogenesis and progression of breast cancer. In this study, a circular RNA-related ceRNA regulatory network was constructed, which provides new biomarkers and therapeutic targets for the treatment of breast cancer. Materials and methods. The expression profile datasets (GSE101123, GSE143564, GSE50428) of circRNAs, miRNAs, and mRNAs were downloaded from the GEO database, and then differentially expressed RNAs (DEcircRNAs, DEmiRNAs, DEmRNAs) were obtained through the CSCD, TargetScan, miRDB, and miRTarBase databases. CircRNA-miRNA pairs and miRNA-mRNA pairs were constructed. Finally, a ceRNA regulatory network was established. Downstream analysis of the ceRNA network included GO, KEGG analysis, survival analysis, sub-network construction, the BCIP, and qRT-PCR verification.\nRESULTS: In total, 144 differentially expressed (DE) DEcircRNA, 221 DEmiRNA, and 1211 DEmRNA were obtained, and 96 circRNA-miRNA pairs and 139 miRNA-mRNA pairs were constructed by prediction. The ceRNA regulatory network (circRNA-miRNA-mRNA) was constructed, which included 42 circRNA, 36miRNA, and 78 mRNA. GO function annotation showed genes were mainly enriched in receptor activity activated by transforming growth factor beta (TGF-beta) and in the regulation of epithelial cell apoptosis. KEGG analysis showed genes were mainly enriched in the TGF-beta signaling, PI3K-Akt signaling, and Wnt signaling pathways. Four genes associated with survival and prognosis of breast cancer were obtained by survival analysis, the prognostic sub-network included 4 circRNA, 4 miRNA, and 4 mRNA. BCIP analysis and qRT-PCR verification confirmed that relative mRNA expression levels were consistent with those in the GEO database.\nCONCLUSION: A circRNA-related ceRNA regulatory network was constructed for breast cancer in this study and key genes affecting pathogenesis and progression were identified. These findings may help better understand and further explore the molecular mechanisms that affect the progression and pathogenesis of breast cancer.", "claims": [{"id": "claim-method", "statement": "DEcircRNA, DEmiRNA, and DEmRNA were obtained using the limma package in R version 4.0.3.", "kind": "methodological", "target": null, "evidence": [{"asset": "source:pmid:34545330", "locator": "sections[4] \"2.2. Identification of DEcircRNA, DEmiRNA, DEmRNA Were Obtained\" paragraph 2", "quote": "DEcircRNA, DEmiRNA, and DEmRNA were obtained using the limma package in R version 4.0.3."}], "state": "complete"}, {"id": "claim-data-access", "statement": "The three datasets (GSE101123, GSE143564, and GSE50428) in this study were downloaded from the GEO database (https://www.ncbi.nlm.nih.gov/gds/?term=).", "kind": "methodological", "target": null, "evidence": [{"asset": "source:pmid:34545330", "locator": "sections[21] \"Data Availability\" paragraph 2", "quote": "The three datasets (GSE101123, GSE143564, and GSE50428) in this study were downloaded from the GEO database (https://www.ncbi.nlm.nih.gov/gds/?term=)."}], "state": "complete"}], "gaps": []}, "experiment": {"state": "complete", "objective": null, "steps": [{"id": "read_published_estimate", "order": 1, "name": "Read the published estimate from the source", "kind": "other", "state": "complete", "blocked_on": null, "description": "The claim, method and evidence span published with the source article.", "duration_hours": null, "parameters": {}, "inputs": ["source:pmid:34545330"], "outputs": ["the published estimate and its evidence"], "instruments": [], "reagents": []}, {"id": "obtain_source_data", "order": 2, "name": "Obtain the source data from the named repository", "kind": "data-preparation", "state": "complete", "blocked_on": null, "description": "The GEO series accession resolves and its sample accessions are listed. This lane did not download the dataset or read its licence.", "duration_hours": null, "parameters": {}, "inputs": ["data:geo:GSE101123"], "outputs": ["the source data with its repository provenance"], "instruments": [], "reagents": []}, {"id": "run_analysis", "order": 3, "name": "Run the published analysis", "kind": "analysis", "state": "complete", "blocked_on": null, "description": "Apply the paper's statistical method to the resolved series and compare the result with the published target.", "duration_hours": null, "parameters": {}, "inputs": ["data:geo:GSE101123"], "outputs": ["the replicated result and its comparison"], "instruments": [], "reagents": []}], "materials": [], "instruments": [], "reagents": [], "conditions": {}, "gaps": []}, "data": {"state": "partial", "assets": [{"id": "source:pmid:34545330", "role": "manuscript", "format": "xml", "media_type": "application/xml", "uri": "https://doi.org/10.1155/2021/5575286", "sha256": "sha256:7bed10f5a2e175b162c49c0cc7ab4d3849a333b35e16a1b57cb4f86cf19800fa", "bytes": 40122, "access": "open", "state": "resolved", "reader": null, "reader_status": "reader_required", "identifier": "10.1155/2021/5575286", "version": null, "note": "Full article fetched from PMC; the checksum covers the rendered section body, not the original XML bytes.", "structure": {"pmcid": "PMC8449716", "source": "europe_pmc_fulltext", "coverage": "whole_body", "text_hash_scope": "rendered_section_body"}}, {"id": "data:geo:GSE101123", "role": "raw", "format": "geo-series", "media_type": "application/vnd.ncbi.geo-series+json", "uri": "https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE101123", "sha256": null, "bytes": null, "access": "open", "state": "resolved", "reader": null, "reader_status": "reader_required", "identifier": "GSE101123", "version": null, "note": "The three datasets (GSE101123, GSE143564, and GSE50428) in this study were downloaded from the GEO database (https://www.ncbi.nlm.nih.gov/gds/?term=).", "structure": {"repository": "GEO", "access_route": "GEO accession URL", "access_statement_verbatim": "The three datasets (GSE101123, GSE143564, and GSE50428) in this study were downloaded from the GEO database (https://www.ncbi.nlm.nih.gov/gds/?term=).", "access_statement_kind": "data_availability_statement", "sample_accessions": ["GSM2699587", "GSM2699588", "GSM2699589", "GSM2699590", "GSM2699591", "GSM2699592", "GSM2699593", "GSM2699594", "GSM2699595", "GSM2699596", "GSM2699597"], "sample_count": 11, "group_sizes": null, "group_sizes_basis": null, "platform": "19978", "taxon": "Homo sapiens", "title": "circRNA expression in breast cancer and non-tumor breast tissues", "resolution_checked_at": "2026-11-01T15:39:54Z", "resolution_check": "identifier_resolution_only_no_download_no_licence_read", "downloaded": false, "licence_read": false}}, {"id": "data:geo:GSE143564", "role": "raw", "format": "geo-series", "media_type": "application/vnd.ncbi.geo-series+json", "uri": "https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE143564", "sha256": null, "bytes": null, "access": "open", "state": "resolved", "reader": null, "reader_status": "reader_required", "identifier": "GSE143564", "version": null, "note": "The three datasets (GSE101123, GSE143564, and GSE50428) in this study were downloaded from the GEO database (https://www.ncbi.nlm.nih.gov/gds/?term=).", "structure": {"repository": "GEO", "access_route": "GEO accession URL", "access_statement_verbatim": "The three datasets (GSE101123, GSE143564, and GSE50428) in this study were downloaded from the GEO database (https://www.ncbi.nlm.nih.gov/gds/?term=).", "access_statement_kind": "data_availability_statement", "sample_accessions": ["GSM4262013", "GSM4262014", "GSM4262015", "GSM4262016", "GSM4262017", "GSM4262018"], "sample_count": 6, "group_sizes": null, "group_sizes_basis": null, "platform": "21572", "taxon": "Homo sapiens; synthetic construct", "title": "miRNA expession data in breast cancer and adjacent normal tissues", "resolution_checked_at": "2026-11-01T15:39:54Z", "resolution_check": "identifier_resolution_only_no_download_no_licence_read", "downloaded": false, "licence_read": false}}, {"id": "data:geo:GSE50428", "role": "raw", "format": "geo-series", "media_type": "application/vnd.ncbi.geo-series+json", "uri": "https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE50428", "sha256": null, "bytes": null, "access": "open", "state": "resolved", "reader": null, "reader_status": "reader_required", "identifier": "GSE50428", "version": null, "note": "The three datasets (GSE101123, GSE143564, and GSE50428) in this study were downloaded from the GEO database (https://www.ncbi.nlm.nih.gov/gds/?term=).", "structure": {"repository": "GEO", "access_route": "GEO accession URL", "access_statement_verbatim": "The three datasets (GSE101123, GSE143564, and GSE50428) in this study were downloaded from the GEO database (https://www.ncbi.nlm.nih.gov/gds/?term=).", "access_statement_kind": "data_availability_statement", "sample_accessions": ["GSM1219102", "GSM1219103", "GSM1219104", "GSM1219105", "GSM1219106", "GSM1219107", "GSM1219108", "GSM1219109", "GSM1219110", "GSM1219111", "GSM1219112", "GSM1219113", "GSM1219114", "GSM1219115", "GSM1219116", "GSM1219117", "GSM1219118", "GSM1219119", "GSM1219120", "GSM1219121", "GSM1219122", "GSM1219123", "GSM1219124", "GSM1219125", "GSM1219126", "GSM1219127", "GSM1219128", "GSM1219129", "GSM1219130", "GSM1219131", "GSM1219132"], "sample_count": 31, "group_sizes": null, "group_sizes_basis": null, "platform": "13648", "taxon": "Homo sapiens", "title": "Expression and differential expression analysis of breast cancer patient samples and normal samples", "resolution_checked_at": "2026-11-01T15:39:54Z", "resolution_check": "identifier_resolution_only_no_download_no_licence_read", "downloaded": false, "licence_read": false}}, {"id": "asset:table:pmid:34545330:1", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:c29789134561af50996f2c2b74924d68e7b275856500419c0b3e635170797a51", "bytes": 646, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[8]/table-wrap[1]#tab1", "version": null, "note": "Primer sequence information of the genes for PCR experiment.", "structure": {"pmcid": "PMC8449716", "section_index": 8, "section_title": "2.6. Relative mRNA Expression Level by qRT-PCR", "row_count": 11, "column_count": 3}, "table": {"label": "Table 1", "caption": "Primer sequence information of the genes for PCR experiment.", "rows": [["Gene", "Primer", "Sequence (5'to3')"], ["TPD52", "Forward", "TCCTTTAGTATACGTTCCATTCAGC"], ["Reverse", "GGCTTGGTTCCCCCTACTT"], ["CCND2", "Forward", "GTGCATTTACACCGACAACTCC"], ["Reverse", "CAGAGCAATGAAGGTCTGAGCA"], ["BTG2", "Forward", "GAGGTGTCCTACCGCATTGG"], ["Reverse", "AGCACTTGGTTCTTGCAGGT"], ["LIFR", "Forward", "GCGAGCCTATACAGATGGTGG"], ["Reverse", "CCACTGGGATGAGAATGGCAA"], ["Beta-actin", "Forward", "CCTGGCACCCAGCACAAT"], ["Reverse", "GGGCCGGACTCGTCATAC"]], "row_count": 11, "column_count": 3, "numeric_cells": 2, "header_rows": 1, "locator": "section[8]/table-wrap[1]#tab1"}}, {"id": "asset:table:pmid:34545330:2", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:73e8c677b4427a38ae1ccf9fa0c2cc9cda7541b928703875e0ed07ee3885ec8e", "bytes": 391, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[11]/table-wrap[1]#tab2", "version": null, "note": "Basic information of three gene microarray datasets of breast cancer.", "structure": {"pmcid": "PMC8449716", "section_index": 11, "section_title": "3.1. DEcircRNA, DEmiRNA, and DEmRNA Were Extracted", "row_count": 4, "column_count": 4}, "table": {"label": "Table 2", "caption": "Basic information of three gene microarray datasets of breast cancer.", "rows": [["Data source", "Series", "Platform", "Sample size(N/T)"], ["circRNA", "GSE101123", "GPL19978", "3/8"], ["miRNA", "GSE143564", "GPL21572", "3/3"], ["mRNA", "GSE50428", "GPL13648", "5/26"]], "row_count": 4, "column_count": 4, "numeric_cells": 9, "header_rows": 1, "locator": "section[11]/table-wrap[1]#tab2"}}, {"id": "asset:table:pmid:34545330:3", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:99c07c74276405728d2ff38ec84b1efb8816a3ff8529a8c620132e456ce4d641", "bytes": 641, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[17]/table-wrap[1]#tab3", "version": null, "note": "Median expression values of the four genes in breast cancer tissues compared with adjacent normal tissues (AdjN) from METABRIC and TCGA, respectively, by Breast Cancer Integrative Platform (BCIP).", "structure": {"pmcid": "PMC8449716", "section_index": 17, "section_title": "3.7. The Expression of Four mRNAs Was Evaluated in the BCIP", "row_count": 6, "column_count": 5}, "table": {"label": "Table 3", "caption": "Median expression values of the four genes in breast cancer tissues compared with adjacent normal tissues (AdjN) from METABRIC and TCGA, respectively, by Breast Cancer Integrative Platform (BCIP).", "rows": [["Gene", "Median (METABRIC)", "Median (TCGA)"], ["AdjN tissues", "Tumor tissues", "AdjN tissues", "Tumor tissues"], ["TPD52", "7.5792", "8.6433", "10.972", "12.4048"], ["CCND2", "10.3733", "9.144", "10.6866", "9.2848"], ["BTG2", "9.8903", "9.1643", "12.714", "11.8921"], ["LIFR", "6.3842", "5.5721", "12.0969", "9.1239"]], "row_count": 6, "column_count": 5, "numeric_cells": 17, "header_rows": 2, "locator": "section[17]/table-wrap[1]#tab3"}}], "gaps": ["asset:data:geo:GSE101123 not downloaded", "asset:data:geo:GSE101123 licence not read", "asset:data:geo:GSE143564 not downloaded", "asset:data:geo:GSE143564 licence not read", "asset:data:geo:GSE50428 not downloaded", "asset:data:geo:GSE50428 licence not read"]}, "analysis": {"state": "complete", "methods": [{"id": "method-1", "family": "differential_expression", "specific": "limma_voom", "label": "Differential expression analysis", "dsl_operations": ["normalise_counts", "differential_expression_fit", "fdr_bh"], "missing_operations": [], "expressible": true, "parameters": {}, "data_shapes": ["count_matrix_with_condition"], "evidence": {"score": 1.0, "band": "verbatim", "quote": "DEcircRNA, DEmiRNA, and DEmRNA were obtained using the limma package in R version 4.0.3."}}], "targets": [], "gaps": []}, "capability": {"state": "complete", "requirements": [{"capability_id": "capability:computational_analysis", "label": "Computational analysis platform", "assay_families": ["meta_analysis", "machine_learning", "survival_analysis", "statistical_regression", "pca", "molecular_docking", "network_analysis", "differential_expression", "gwas"], "availability_state": "owned", "tier_unlocked": "R1", "candidate": "Automated Assays Laravel application and simulated adapters"}], "gaps": []}, "readiness": {"state": "complete", "tier": "R1", "blocking_axis": "none", "blocked_on": "nothing:replicable_now", "axes": {"method": {"tier": "R1", "expressible": true, "required_operations": ["normalise_counts", "differential_expression_fit", "fdr_bh"], "missing_operations": [], "basis": "The paper names the method it used and the corpus's method extractor maps it onto the DSL catalogue: limma_voom."}, "capability": {"tier": "R1", "capability_id": "capability:computational_analysis", "availability_state": "owned", "basis": "The computational analysis is owned. The physical bench the paper used is not, so a physical validation cannot be run here."}, "data": {"tier": "R1", "reachable": true, "accessions": ["GSE101123", "GSE143564", "GSE50428"], "resolved_accessions": ["GSE101123", "GSE143564", "GSE50428"], "statements": ["The three datasets (GSE101123, GSE143564, and GSE50428) in this study were downloaded from the GEO database (https://www.ncbi.nlm.nih.gov/gds/?term=)."], "basis": "The paper names GSE101123, GSE143564, GSE50428 in Gene Expression Omnibus (GEO) and the accession resolves in the repository. No dataset was downloaded and no licence was read."}}, "can_run": {"dsl_operations": ["normalise_counts", "differential_expression_fit", "fdr_bh"], "assets": ["source:pmid:34545330", "data:geo:GSE101123", "asset:table:pmid:34545330:1", "asset:table:pmid:34545330:2", "asset:table:pmid:34545330:3"], "steps": ["run_analysis"]}, "must_build": {"dsl_operations": [], "converters": [], "readers": [], "capabilities": [], "data_gaps": ["data:geo:GSE101123"]}, "gaps": []}, "review": {"state": "partial", "machine_critique": {"kind": "extraction_review", "reader": {"model": "MiniMax-M3.1-Flash", "provider": "minimax", "provider_family": "minimax", "read_at": "2026-10-31T18:34:59Z", "independence": "single_reader"}, "evidence_check": {"method": "verbatim", "availability": "verbatim"}, "calls": 3, "usage": {"prompt_tokens": 34395, "completion_tokens": 1757, "cached_tokens": 784}}, "human_critique": null, "stages": [{"id": "extraction", "state": "complete", "reader": "MiniMax-M3.1-Flash", "provider": "minimax"}], "gaps": ["review.independent_reader", "review.machine_critique", "review.human_critique"]}, "execution": {"state": "absent", "status": "not_run", "mode": null, "runs": [], "gaps": ["execution.not_run"]}, "provenance": {"entities": [{"id": "pmid:34545330", "type": "paper", "label": "pmid:34545330"}, {"id": "source:pmid:34545330", "type": "manuscript", "label": "PMID 34545330 full text"}, {"id": "data:geo:GSE101123", "type": "dataset", "label": "GEO GSE101123"}], "activities": [{"id": "activity-reading-sci-2026-11-01", "type": "classification", "used": [{"id": "pmid:34545330", "type": "paper", "label": "pmid:34545330"}, {"id": "source:pmid:34545330", "type": "manuscript", "label": "PMID 34545330 full text"}, {"id": "data:geo:GSE101123", "type": "dataset", "label": "GEO GSE101123"}], "agent": "agent:corpus-assay-engine"}, {"id": "activity-read-34545330", "type": "extraction", "used": ["source:pmid:34545330"], "agent": "agent:minimax-reader"}, {"id": "activity-resolve-GSE101123", "type": "accession_resolution", "used": ["data:geo:GSE101123"], "agent": "agent:corpus-assay-engine"}], "agents": [{"id": "agent:corpus-assay-engine", "type": "software", "label": "Corpus assay engine"}, {"id": "agent:minimax-reader", "type": "software", "label": "MiniMax literature reader"}], "source_run_id": "reading-sci-2026-11-01", "dsl_catalogue_fingerprint": "343fb30756ba6ec3", "capability_table_fingerprint": "2cb3e42f047d2ecf", "snapshot_id": "ba34b49490d9bfaf"}, "lineage": {"parent_id": "pmid:34545330", "parent_hash": "sha256:0d5a8011abeccb04a830572023185ec90e908e5c483d70273f50394a6e29b734", "fork_of": null, "generation": 7}, "gaps": ["asset:data:geo:GSE101123 licence not read", "asset:data:geo:GSE101123 not downloaded", "asset:data:geo:GSE143564 licence not read", "asset:data:geo:GSE143564 not downloaded", "asset:data:geo:GSE50428 licence not read", "asset:data:geo:GSE50428 not downloaded", "execution.not_run", "review.human_critique", "review.independent_reader", "review.machine_critique"], "assays": [{"role": "data_generation", "definition_id": "apoptosis_assay", "definition_version": "99e1195c7d6f", "definition_digest": null, "required_operations": [], "support_state": "partial", "source_hashes": {"assay_lexicon": "99e1195c7d6f"}, "confidence": 0.69, "evidence": ["ta) and in the regulation of epithelial cell apoptosis. KEGG analysis showed genes were mainly enri"], "order_basis": "paper_text_order:1448", "id": "assay:1"}, {"role": "analysis", "definition_id": "differential_expression", "definition_version": "f2132e96ae6c7a4e", "definition_digest": null, "required_operations": ["normalise_counts", "differential_expression_fit", "fdr_bh"], "support_state": "supported", "source_hashes": {"dsl_catalogue": "f2132e96ae6c7a4e"}, "confidence": 1.0, "evidence": ["DEcircRNA, DEmiRNA, and DEmRNA were obtained using the limma package in R version 4.0.3."], "order_basis": "consumes_earlier_output", "id": "assay:2"}]}