Differential Expression of Estrogen-Responsive Genes in Women with Psoriasis.

{"sci_version": "1.2", "schema": "https://corpus.bntrg.co.uk/sci/1.0/sci.schema.json", "id": "pmid:34575702", "kind": "science-record", "revision": 6, "content_hash": "sha256:8fc92b3721112d908f835e5d20094626876820827a99991a48fcdc78b65b47e7", "created_at": "2026-11-01T15:41:54Z", "updated_at": "2026-11-01T21:26:19Z", "generator": {"name": "corpus-assay-engine", "run_id": "reading-sci-2026-11-01"}, "paper": {"state": "complete", "title": "Differential Expression of Estrogen-Responsive Genes in Women with Psoriasis.", "doi": "10.3390/jpm11090925", "pmid": "34575702", "authors": ["Vladimir Sobolev", "Anna Soboleva", "Elena Denisova", "Malika Denieva", "Eugenia Dvoryankova", "Elkhan Suleymanov", "Olga V Zhukova", "Nikolay Potekaev", "Irina Korsunskaya", "Alexandre Mezentsev"], "journal": "Journal of personalized medicine", "year": 2021, "abstract": "In women, the flow of psoriasis is influenced by each phase of a woman's life cycle. According to previous findings, significant changes in the levels of sex hormones affect the severity of the disease. Aim: The aim of this study was to identify the estrogen-responsive genes that could be responsible for the exacerbation of psoriasis in menopausal women. Methods: Skin samples of lesional skin donated by psoriasis patients (n = 5) were compared with skin samples of healthy volunteers (n = 5) using liquid chromatography-tandem mass spectrometry (LC-MS/MS). The set of differentially expressed proteins was subjected to protein ontology analysis to identify differentially expressed estrogen-responsive proteins. The expression of discovered proteins was validated by qPCR and ELISA on four groups of female participants. The first group included ten psoriasis patients without menopause; the second included eleven postmenopausal patients; the third included five healthy volunteers without menopause; and the fourth included six postmenopausal volunteers. Moreover, the participants' blood samples were used to assess the levels of estradiol, progesterone, and testosterone. Results: We found that the levels of estradiol and progesterone were significantly lower and the levels of testosterone were significantly higher in the blood of patients compared to the control. The protein ontology analysis of LC-MS/MS data identified six proteins, namely HMOX1, KRT19, LDHA, HSPD1, MAPK1, and CA2, differentially expressed in the lesional skin of female patients compared to male patients. ELISA and qPCR experiments confirmed differential expression of the named proteins and their mRNA. The genes encoding the named proteins were differentially expressed in patients compared to volunteers. However, KRT19 and LDHA were not differentially expressed when we compared patients with and without menopause. All genes, except MAPK1, were differentially expressed in patients with menopause compared to the volunteers with menopause. HMOX1, KRT19, HSPD1, and LDHA were differentially expressed in patients without menopause compared to the volunteers without menopause. However, no significant changes were found when we compared healthy volunteers with and without menopause. Conclusion: Our experiments discovered a differential expression of six estrogen-controlled genes in the skin of female patients. Identification of these genes and assessment of the changes in their expression provide insight into the biological effects of estrogen in lesional skin. The results of proteomic analysis are available via ProteomeXchange with identifier PXD021673.", "claims": [{"id": "claim-method", "statement": "Due to small sample size, the data of LC–MS/MS were analyzed with non-parametric statistics using the Mann–Whitney U test.", "kind": "methodological", "target": null, "evidence": [{"asset": "source:pmid:34575702", "locator": "sections[10] \"2.8. Statistical Analysis\" paragraph 2", "quote": "Due to small sample size, the data of LC–MS/MS were analyzed with non-parametric statistics using the Mann–Whitney U test."}], "state": "complete"}, {"id": "claim-data-access", "statement": "The mass spectrometry proteomics data were deposited to the ProteomeXchange Consortium via the PRIDE partner repository [15] with the dataset identifier PXD021673.", "kind": "methodological", "target": null, "evidence": [{"asset": "source:pmid:34575702", "locator": "sections[22] \"Data Availability Statement\" paragraph 2", "quote": "The mass spectrometry proteomics data were deposited to the ProteomeXchange Consortium via the PRIDE partner repository [15] with the dataset identifier PXD021673."}], "state": "complete"}], "gaps": []}, "experiment": {"state": "complete", "objective": null, "steps": [{"id": "read_published_estimate", "order": 1, "name": "Read the published estimate from the source", "kind": "other", "state": "complete", "blocked_on": null, "description": "The claim, method and evidence span published with the source article.", "duration_hours": null, "parameters": {}, "inputs": ["source:pmid:34575702"], "outputs": ["the published estimate and its evidence"], "instruments": [], "reagents": []}, {"id": "obtain_source_data", "order": 2, "name": "Obtain the source data from the named repository", "kind": "data-preparation", "state": "complete", "blocked_on": null, "description": "The GEO series accession resolves and its sample accessions are listed. This lane did not download the dataset or read its licence.", "duration_hours": null, "parameters": {}, "inputs": ["data:geo:PXD021673"], "outputs": ["the source data with its repository provenance"], "instruments": [], "reagents": []}, {"id": "run_analysis", "order": 3, "name": "Run the published analysis", "kind": "analysis", "state": "complete", "blocked_on": null, "description": "Apply the paper's statistical method to the resolved series and compare the result with the published target.", "duration_hours": null, "parameters": {}, "inputs": ["data:geo:PXD021673"], "outputs": ["the replicated result and its comparison"], "instruments": [], "reagents": []}], "materials": [], "instruments": [], "reagents": [], "conditions": {}, "gaps": []}, "data": {"state": "partial", "assets": [{"id": "source:pmid:34575702", "role": "manuscript", "format": "xml", "media_type": "application/xml", "uri": "https://doi.org/10.3390/jpm11090925", "sha256": "sha256:a9644b5caf8b781d4a2ac45a4773aaf4b0439d036e0eeef60472e743a7a35d32", "bytes": 63727, "access": "open", "state": "resolved", "reader": null, "reader_status": "reader_required", "identifier": "10.3390/jpm11090925", "version": null, "note": "Full article fetched from PMC; the checksum covers the rendered section body, not the original XML bytes.", "structure": {"pmcid": "PMC8465408", "source": "europe_pmc_fulltext", "coverage": "whole_body", "text_hash_scope": "rendered_section_body"}}, {"id": "data:geo:PXD021673", "role": "raw", "format": "geo-series", "media_type": "application/vnd.ncbi.geo-series+json", "uri": "https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=PXD021673", "sha256": null, "bytes": null, "access": "open", "state": "resolved", "reader": null, "reader_status": "reader_required", "identifier": "PXD021673", "version": null, "note": "The mass spectrometry proteomics data were deposited to the ProteomeXchange Consortium via the PRIDE partner repository [15] with the dataset identifier PXD021673.", "structure": {"repository": "GEO", "access_route": "GEO accession URL", "access_statement_verbatim": "The mass spectrometry proteomics data were deposited to the ProteomeXchange Consortium via the PRIDE partner repository [15] with the dataset identifier PXD021673.", "access_statement_kind": "data_availability_statement", "sample_accessions": [], "sample_count": null, "group_sizes": null, "group_sizes_basis": null, "platform": null, "taxon": null, "title": "LC-MS/MS analysis of lesional and normally looking psoriatic skin", "resolution_checked_at": "2026-10-31T18:35:55Z", "resolution_check": "identifier_resolution_only_no_download_no_licence_read", "downloaded": false, "licence_read": false}}, {"id": "asset:table:pmid:34575702:1", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:f375b934092ef49e1c9aeeeba0d120e228d58b38d4c4f1d9a2758f87742e25d8", "bytes": 3112, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[4]/table-wrap[1]#jpm-11-00925-t001", "version": null, "note": "Clinical characteristics of psoriasis patients and volunteers that participated in the LC–MS/MS, qPCR, and ELISA studies.", "structure": {"pmcid": "PMC8465408", "section_index": 4, "section_title": "2.2. Clinical Samples", "row_count": 51, "column_count": 6}, "table": {"label": "Table 1", "caption": "Clinical characteristics of psoriasis patients and volunteers that participated in the LC–MS/MS, qPCR, and ELISA studies.", "rows": [["ID", "Age", "Medical History", "ID", "Age", "Medical History"], ["", "", "LC-MS male patients", "", "", "qPCR/ELISA patients"], ["1", "30", "not reported", "", "", "with menopause"], ["2", "40", "stage 1 arterial hyperten-", "1", "46", "gastritis, cholecystitis,"], ["", "", "sion, hyperuricemia,", "", "", "pancreatitis,"], ["", "", "obesity,", "", "", "hypertension, coronary"], ["3", "68", "psoriatic arthritis,", "", "", "artery disease, angina"], ["", "", "hypertension, stage 2,", "", "", "pectoris, urolithiasis"], ["", "", "bronchitis, dyscirculatory", "2", "46", "hypertension, stage 2,"], ["", "", "encephalopathy,", "", "", "kidney cyst"], ["", "", "hyperuricemia, obesity", "3", "47", "cholecystitis,"], ["", "", "1st degree", "", "", "cholelithiasis"], ["", "", "", "4", "48", "type II diabetes, obesity"], ["", "", "LC-MS female patients", "", "", "stage 3,"], ["1", "48", "stage 2 hypertension", "", "", "arterial hypertension, no-"], ["2", "60", "stage 2 hypertension", "", "", "dular Hashimoto’s thy-"], ["", "", "", "", "", "roiditis, uterine fibroids,"], ["", "", "LC-MS male volunteers", "", "", "cerebrovascular"], ["1", "53", "phlebeurysm", "", "", "disease, discirculatory"], ["2", "77", "arthrosclerosis", "", "", "encephalopathy arte-"], ["", "", "", "", "", "rial hypertension"], ["", "", "LC-MS female volunteers", "5", "51", "tachycardia"], ["1", "39", "white line hernia", "", "", "nodular Hashimoto’s"], ["2", "60", "incisional ventral hernia", "", "", "thyroiditis,"], ["3", "79", "arthrosclerosis, abdomi-", "", "", "osteochondrosis"], ["", "", "nal aortic aneurysm,", "", "", "dorsopathy"], ["", "", "chronic pyelonephritis,", "6", "51", "hypertension, stage 2;"], ["", "", "dyslipidemia,", "7", "53", "hypertension, stage 2;"], ["", "", "hypertension", "", "", "depression;"], ["", "", "", "8", "53", "nodular goiter;"], ["", "", "qPCR/ELISA patients,", "9", "53", "hypertension, stage 2"], ["", "", "without menopause", "", "", "type 2 diabetes, osteo-"], ["1", "19", "not reported", "", "", "arthritis; dorsopathy;"], ["2", "21", "erysipelas, obesity stage", "10", "54", "not reported"], ["", "", "4, cholecystitis, uterine", "", "", "qPCR/ELISA volunteers"], ["", "", "fibroids", "", "", "without menopause"], ["3", "28", "not reported", "1", "26", "not reported"], ["4", "30", "goiter, euthyroid sick", "2", "28", "not reported"], ["", "", "syndrome,", "3", "29", "not reported"], ["5", "32", "bilateral otitis media,", "4", "32", "not reported"], ["", "", "cholecystitis", "5", "33", "not reported"], ["", "", "vaginal yeast infection", "6", "38", "not reported"], ["6", "32", "not reported", "", "", ""], ["7", "32", "diffuse goiter, grade 2;", "", "", "qPCR/ELISA volunteers"], ["8", "36", "depression", "", "", "with menopause"], ["9", "42", "gastritis, pyelonephritis;", "", "", ""], ["", "", "insulin resistance,", "1", "43", "not reported"], ["", "", "hypertension, stage 2,", "2", "49", "not reported"], ["", "", "cerebrovascular disease,", "3", "50", "not reported"], ["", "", "cholecystitis", "4", "55", "not reported"], ["10", "43", "not reported", "5", "57", "not reported"]], "row_count": 51, "column_count": 6, "numeric_cells": 96, "header_rows": 1, "locator": "section[4]/table-wrap[1]#jpm-11-00925-t001"}}, {"id": "asset:table:pmid:34575702:2", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:93199496984709e8504290310c37b9caab665f8dbdc2a23ae0be9e6794e7e6a6", "bytes": 1127, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[8]/table-wrap[1]#jpm-11-00925-t002", "version": null, "note": "Gene-specific primers used in the qPCR experiments.", "structure": {"pmcid": "PMC8465408", "section_index": 8, "section_title": "2.6. Quantitative PCR", "row_count": 15, "column_count": 5}, "table": {"label": "Table 2", "caption": "Gene-specific primers used in the qPCR experiments.", "rows": [["Gene", "Reference Sequence", "Primer Name", "Primer Sequence", "Product Size, bp"], ["CA2", "NM_000067.3", "CA2 forward", "GGCTGGTTGGTGCTTTGTTT", "118"], ["", "", "CA2 re-verse", "TTGTGAGTGCTCATCACCCT", ""], ["HMOX1", "NM_002133.3", "HMOX1 forward", "GGCCTAAACTTCAGAGGGGG", "99"], ["", "", "HMOX1 reverse", "AGACAGCTGCCACATTAGGG", ""], ["HSPD1", "NM_002156.5", "HSPD1 forward", "CTGGCACGCTCTATAGCCAA", "142"], ["", "", "HSPD1 reverse", "CAGGGGTGGTCACAGGTTTA", ""], ["KRT19", "NM_002276.5", "KRT19 forward", "CCACTACTACACGACCATCCA", "89"], ["", "", "KRT19 reverse", "GTCGATCTGCAGGACAATCC", ""], ["LDHA", "NM_005566.4", "LDHA forward", "TAAGCTGTCATGGGTGGGTC", "100"], ["", "", "LDHA reverse", "GGGTGCAGAGTCTTCAGAGAG", ""], ["MAPK1", "NM_002745.5", "MAPK1 forward", "CAGTTCTTGACCCCTGGTCC", "186"], ["", "", "MAPK1 reverse", "TACATACTGCCGCAGGTCAC", ""], ["18S RNA", "NR_003286.2", "18S RNA forward", "CTACCACATCCAAGGAAGCA", "103"], ["", "", "18S RNA reverse", "TTTTTCGTCACTACCTCCCCG", ""]], "row_count": 15, "column_count": 5, "numeric_cells": 20, "header_rows": 1, "locator": "section[8]/table-wrap[1]#jpm-11-00925-t002"}}, {"id": "asset:table:pmid:34575702:3", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:6fc0747a3d33645033862ed1cebae2ba5fa83cbba00c010ee2657d925f638e5c", "bytes": 896, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[12]/table-wrap[1]#jpm-11-00925-t003", "version": null, "note": "The levels of sex hormones in blood samples of qPCR/ELISA participants with and without menopause. pM and nM are concentrations (pmol/L and nmol/L, respectively).", "structure": {"pmcid": "PMC8465408", "section_index": 12, "section_title": "3.1. The Blood of Female Psoriasis Patients Contains Less Estradiol and Progesterone, and More Testosterone Compared to the Healthy Volunteers", "row_count": 11, "column_count": 5}, "table": {"label": "Table 3", "caption": "The levels of sex hormones in blood samples of qPCR/ELISA participants with and without menopause. pM and nM are concentrations (pmol/L and nmol/L, respectively).", "rows": [["Group of Participants", "N", "Estradiol, pM", "Progesterone, nM", "Testosterone, nM"], ["Volunteers without", "6", "480.63 ± 157.43", "8.18 ± 2.47", "0.406 ± 0.078"], ["menopause", "", "", "", ""], ["Volunteers with", "5", "53.8 ± 15.91", "0.973 ± 0.206", "0.733 ± 0.061"], ["menopause", "", "", "", ""], ["p-value", "", "0.026", "0.018", "0.018"], ["Patients without", "10", "116.32 ± 45.85", "0.159 ± 0.013", "1.708 ± 0.362"], ["menopause", "", "", "", ""], ["Patients with", "10", "14.51 ± 0.44", "0.110 ± 0.011", "3.428 ± 0.368"], ["menopause", "", "", "", ""], ["p-value", "", "0.0495", "0.011", "0.005"]], "row_count": 11, "column_count": 5, "numeric_cells": 22, "header_rows": 1, "locator": "section[12]/table-wrap[1]#jpm-11-00925-t003"}}, {"id": "asset:table:pmid:34575702:4", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:80a64938d20b1fbb4a826f80e3c25c87fb8c913e24db843ded61661cabb7ec42", "bytes": 2449, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[13]/table-wrap[1]#jpm-11-00925-t004", "version": null, "note": "The ontology analysis of proteins differentially expressed in female lesional and uninvolved skin. The analyzed proteins were differentially expressed in female lesional and uninvolved skin and were not differentially expressed in male lesional and uninvolved skincompared to the skin of healthy volunteers.", "structure": {"pmcid": "PMC8465408", "section_index": 13, "section_title": "3.2. LC–MS/MS Study Identifies Six Estrogen-Responsive Proteins That Are Differentially Expressed in Male and Female Psoriatic Skin", "row_count": 15, "column_count": 4}, "table": {"label": "Table 4", "caption": "The ontology analysis of proteins differentially expressed in female lesional and uninvolved skin. The analyzed proteins were differentially expressed in female lesional and uninvolved skin and were not differentially expressed in male lesional and uninvolved skincompared to the skin of healthy volunteers.", "rows": [["Term", "Genes", "p-Value", "FDR"], ["Translational initiation", "RPL30, RPL10, RPS7, RPS8, RPL11, RPL13A, RPL23A, RPS15, RPS27, RPS19, RPL14, EIF3C, RPL28, EIF3D, EIF4G1, RPS12", "8.59 × 10−15", "6.62 × 10−12"], ["Nuclear-transcribed mRNA catabolic process, nonsense- mediated decay", "RPL30, RPL10, RPS7, RPS8, RPL11, RPL13A, RPL23A, RPS15, RPS27, RPS19, RPL14, RPL28, EIF4G1, RPS12", "6.03 × 10−13", "1.89 × 10−10"], ["SRP-dependent cotranslational protein targeting to membrane", "RPL30, RPL10, RPS7, RPS8, RPL11, RPL13A, RPL23A, RPS15, RPS27, RPS19, RPL14, RPL28, RPS12", "7.37 × 10−13", "1.89 × 10−10"], ["Viral transcription", "RPL30, RPL10, RPS7, RPS8, RPL11, RPL13A, RPL23A, RPS15, RPS27, RPS19, RPL14, RPL28, RPS12", "6.20 × 10−12", "1.19 × 10−9"], ["Translation", "RPL30, RPL10, RPS7, RPS8, RPL11, RPL13A, SARS, RPL23A, RPS15, RPS27, RPS19, RPL14, RPL28, EIF4G1, RPS12", "7.59 × 10−10", "1.17 × 10−7"], ["rRNA processing", "RPL30, RPL10, RPS7, RPS8, RPL11, RPL13A, DDX21, RPL23A, RPS15, RPS27, RPS19, RPL14, RPL28, RPS12", "1.03 × 10−9", "1.32 × 10−7"], ["Cell-cell adhesion", "LDHA, AHNAK, HSPA5, RPL14, TACSTD2, EFHD2, RPL23A, TAGLN2, ENO1, ALDOA, SPTBN2, EIF4G1", "1.24 × 10−6", "1.37 × 10−4"], ["Regulation of mRNA stability", "PSMD6, PSMD7, PSMD13, PSMC1, PSMD3, HSPB1, HSPA1B, EIF4G1", "4.20 × 10−6", "4.04 × 10−4"], ["Response to estrogen", "LDHA, KRT19, CA2, HMOX1, MAPK1, HSPD1", "5.83 × 10−5", "4.81 × 10−3"], ["Glycolytic process", "GPI, LDHA, PGAM1, ENO1, ALDOA", "6.24 × 10−5", "4.81 × 10−3"], ["Regulation of cellular amino acid metabolic process", "PSMD6, PSMD7, PSMD13, PSMC1, PSMD3", "3.09 × 10−4", "0.022"], ["Canonical glycolysis", "GPI, PGAM1, ENO1, ALDOA", "5.88 × 10−4", "0.038"], ["Antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent", "PSMD6, PSMD7, PSMD13, PSMC1, PSMD3", "6.95 × 10−4", "0.041"], ["NIK/NF-κB signaling", "PSMD6, PSMD7, PSMD13, PSMC1, PSMD3", "8.29 × 10−4", "0.046"]], "row_count": 15, "column_count": 4, "numeric_cells": 40, "header_rows": 1, "locator": "section[13]/table-wrap[1]#jpm-11-00925-t004"}}, {"id": "asset:table:pmid:34575702:5", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:78c3bd318025b89e49819b387fd044e3007c251848649d4146628ffc205a33f7", "bytes": 1892, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[13]/table-wrap[2]#jpm-11-00925-t005", "version": null, "note": "The ontology analysis of proteins differentially expressed in male lesional and uninvolved skin. The analyzed proteins were differentially expressed in male lesional and uninvolved skin and were not differentially expressed in female lesional and uninvolved skin compared to the skin of healthy volunteers.", "structure": {"pmcid": "PMC8465408", "section_index": 13, "section_title": "3.2. LC–MS/MS Study Identifies Six Estrogen-Responsive Proteins That Are Differentially Expressed in Male and Female Psoriatic Skin", "row_count": 12, "column_count": 4}, "table": {"label": "Table 5", "caption": "The ontology analysis of proteins differentially expressed in male lesional and uninvolved skin. The analyzed proteins were differentially expressed in male lesional and uninvolved skin and were not differentially expressed in female lesional and uninvolved skin compared to the skin of healthy volunteers.", "rows": [["Term", "Genes", "p-Value", "FDR"], ["SRP-dependent cotran- slational protein targe- ting to membrane", "RPS28, RPS16, RPL32, RPL23, RPL37A, RPL35A, FAU, RPL8, SRP14, RPL17, RPL19", "4.74 × 10−9", "4.95 × 10−6"], ["Translational initiation", "RPS28, RPS16, RPL32, EIF6, RPL23, RPL37A, RPL35A, FAU, RPL8, RPL17, RPL19", "1.79 × 10−7", "9.32 × 10−5"], ["Viral transcription", "RPS28, RPS16, RPL32, RPL23, RPL37A, RPL35A, FAU, RPL8, RPL17, RPL19", "3.32 × 10−7", "1.16 × 10−4"], ["Nuclear-transcribed mRNA catabolic process, nonsense- mediated decay", "RPS28, RPS16, RPL32, RPL23, RPL37A, RPL35A, FAU, RPL8, RPL17, RPL19", "5.57 × 10−7", "1.45 × 10−4"], ["Translation", "RPS28, RPS16, RPL32, RPL23, RPL37A, RPL35A, FAU, RPL8, RPL17, SLC25A6, RPL19", "4.33 × 10−5", "0.009"], ["Negative regulation of endopeptidase activity", "CSTB, CSTA, ITIH2, SERPIND1, SERPINF1, SERPINH1, SERPING1, COL6A3", "6.01 × 10−5", "0.010"], ["rRNA processing", "RPS28, RPS16, RPL32, RPL23, RPL37A, RPL35A, FAU, RPL8, RPL17, RPL19", "6.56 × 10−5", "0.010"], ["Regulation of comple- ment activation", "CFH, C9, C8B, PHB2, C8A", "9.86 × 10−5", "0.013"], ["Complement activation alternative pathway", "CFH, C9, C8B, C8A", "1.43 × 10−4", "0.017"], ["Cell-cell adhesion", "CNN2, PDLIM1, LAD1, DDX3X, ATIC, CTTN, RUVBL1, CHMP4B, PARK7, CNN3", "3.86 × 10−4", "0.040"], ["DNA duplex unwinding", "DDX3X, XRCC5, DDX1, RUVBL2, RUVBL1", "4.47 × 10−4", "0.042"]], "row_count": 12, "column_count": 4, "numeric_cells": 28, "header_rows": 1, "locator": "section[13]/table-wrap[2]#jpm-11-00925-t005"}}], "gaps": ["asset:data:geo:PXD021673 not downloaded", "asset:data:geo:PXD021673 licence not read"]}, "analysis": {"state": "partial", "methods": [{"id": "method-1", "family": "principal_component_analysis", "specific": "pca", "label": "Principal component analysis", "dsl_operations": ["pca_fit"], "missing_operations": [], "expressible": true, "parameters": {}, "data_shapes": ["wide_numeric_matrix"], "evidence": {"score": 0.8, "band": "high", "quote": "PCA"}}, {"id": "method-2", "family": null, "specific": null, "label": "Mann–Whitney U test", "dsl_operations": [], "missing_operations": [], "expressible": null, "parameters": {}, "data_shapes": [], "evidence": {"score": 1.0, "band": "verbatim", "quote": "Due to small sample size, the data of LC–MS/MS were analyzed with non-parametric statistics using the Mann–Whitney U test."}}], "targets": [], "gaps": ["method.reader_named_unmapped"]}, "capability": {"state": "complete", "requirements": [{"capability_id": "capability:computational_analysis", "label": "Computational analysis platform", "assay_families": ["meta_analysis", "machine_learning", "survival_analysis", "statistical_regression", "pca", "molecular_docking", "network_analysis", "differential_expression", "gwas"], "availability_state": "owned", "tier_unlocked": "R1", "candidate": "Automated Assays Laravel application and simulated adapters"}], "gaps": []}, "readiness": {"state": "complete", "tier": "R1", "blocking_axis": "none", "blocked_on": "nothing:replicable_now", "axes": {"method": {"tier": "R1", "expressible": true, "required_operations": ["pca_fit"], "missing_operations": [], "basis": "The paper names the method it used and the corpus's method extractor maps it onto the DSL catalogue: pca."}, "capability": {"tier": "R1", "capability_id": "capability:computational_analysis", "availability_state": "owned", "basis": "The computational analysis is owned. The physical bench the paper used is not, so a physical validation cannot be run here."}, "data": {"tier": "R1", "reachable": true, "accessions": ["PXD021673"], "resolved_accessions": ["PXD021673"], "statements": ["The mass spectrometry proteomics data were deposited to the ProteomeXchange Consortium via the PRIDE partner repository [15] with the dataset identifier PXD021673."], "basis": "The paper names PXD021673 in ProteomeXchange Consortium via the PRIDE partner repository and the accession resolves in the repository. No dataset was downloaded and no licence was read."}}, "can_run": {"dsl_operations": ["pca_fit"], "assets": ["source:pmid:34575702", "data:geo:PXD021673", "asset:table:pmid:34575702:1", "asset:table:pmid:34575702:2", "asset:table:pmid:34575702:3", "asset:table:pmid:34575702:4", "asset:table:pmid:34575702:5"], "steps": ["run_analysis"]}, "must_build": {"dsl_operations": [], "converters": [], "readers": [], "capabilities": [], "data_gaps": ["data:geo:PXD021673"]}, "gaps": []}, "review": {"state": "partial", "machine_critique": {"kind": "extraction_review", "reader": {"model": "MiniMax-M3.1-Flash", "provider": "minimax", "provider_family": "minimax", "read_at": "2026-10-31T18:35:11Z", "independence": "single_reader"}, "evidence_check": {"method": "verbatim", "availability": "verbatim"}, "calls": 3, "usage": {"prompt_tokens": 49765, "completion_tokens": 750, "cached_tokens": 520}}, "human_critique": null, "stages": [{"id": "extraction", "state": "complete", "reader": "MiniMax-M3.1-Flash", "provider": "minimax"}], "gaps": ["review.independent_reader", "review.machine_critique", "review.human_critique"]}, "execution": {"state": "absent", "status": "not_run", "mode": null, "runs": [], "gaps": ["execution.not_run"]}, "provenance": {"entities": [{"id": "pmid:34575702", "type": "paper", "label": "pmid:34575702"}, {"id": "source:pmid:34575702", "type": "manuscript", "label": "PMID 34575702 full text"}, {"id": "data:geo:PXD021673", "type": "dataset", "label": "GEO PXD021673"}], "activities": [{"id": "activity-reading-sci-2026-11-01", "type": "classification", "used": [{"id": "pmid:34575702", "type": "paper", "label": "pmid:34575702"}, {"id": "source:pmid:34575702", "type": "manuscript", "label": "PMID 34575702 full text"}, {"id": "data:geo:PXD021673", "type": "dataset", "label": "GEO PXD021673"}], "agent": "agent:corpus-assay-engine"}, {"id": "activity-read-34575702", "type": "extraction", "used": ["source:pmid:34575702"], "agent": "agent:minimax-reader"}, {"id": "activity-resolve-PXD021673", "type": "accession_resolution", "used": ["data:geo:PXD021673"], "agent": "agent:corpus-assay-engine"}], "agents": [{"id": "agent:corpus-assay-engine", "type": "software", "label": "Corpus assay engine"}, {"id": "agent:minimax-reader", "type": "software", "label": "MiniMax literature reader"}], "source_run_id": "reading-sci-2026-11-01", "dsl_catalogue_fingerprint": "343fb30756ba6ec3", "capability_table_fingerprint": "2cb3e42f047d2ecf", "snapshot_id": "ba34b49490d9bfaf"}, "lineage": {"parent_id": "pmid:34575702", "parent_hash": "sha256:350c68f448f37dc23b4c872392dc0091dd39d5c5accc941f71eceb392412f8e3", "fork_of": null, "generation": 5}, "gaps": ["asset:data:geo:PXD021673 licence not read", "asset:data:geo:PXD021673 not downloaded", "execution.not_run", "method.reader_named_unmapped", "review.human_critique", "review.independent_reader", "review.machine_critique"], "assays": [{"role": "data_generation", "definition_id": "mass_spectrometry", "definition_version": "99e1195c7d6f", "definition_digest": null, "required_operations": [], "support_state": "partial", "source_hashes": {"assay_lexicon": "99e1195c7d6f"}, "confidence": 0.99, "evidence": ["s (n = 5) using liquid chromatography-tandem mass spectrometry (LC-MS/MS). The set of differentially expres", "uid chromatography-tandem mass spectrometry (LC-MS/MS). The set of differentially expressed protei", "he control. The protein ontology analysis of LC-MS/MS data identified six proteins, namely HMOX1,", "or Cancer Research, Frederick, MD, USA). The mass spectrometry proteomics data were deposited to the Proteo"], "order_basis": "paper_text_order:564", "id": "assay:1"}, {"role": "data_generation", "definition_id": "qpcr", "definition_version": "99e1195c7d6f", "definition_digest": null, "required_operations": [], "support_state": "partial", "source_hashes": {"assay_lexicon": "99e1195c7d6f"}, "confidence": 0.99, "evidence": ["sion of discovered proteins was validated by qPCR and ELISA on four groups of female participa", "atients compared to male patients. ELISA and qPCR experiments confirmed differential expressio", "rs (mean age: 49.2 years). Skin biopsies for qPCR and ELISA assays were obtained from female p", "11 healthy volunteers that we identified as qPCR/ELISA participants. To distinguish the chang"], "order_basis": "paper_text_order:804", "id": "assay:2"}, {"role": "data_generation", "definition_id": "elisa", "definition_version": "99e1195c7d6f", "definition_digest": null, "required_operations": [], "support_state": "partial", "source_hashes": {"assay_lexicon": "99e1195c7d6f"}, "confidence": 0.99, "evidence": ["iscovered proteins was validated by qPCR and ELISA on four groups of female participants. The f", "f female patients compared to male patients. ELISA and qPCR experiments confirmed differential", "age: 49.2 years). Skin biopsies for qPCR and ELISA assays were obtained from female participant", "ealthy volunteers that we identified as qPCR/ELISA participants. To distinguish the changes in"], "order_basis": "paper_text_order:813", "id": "assay:3"}, {"role": "analysis", "definition_id": "principal_component_analysis", "definition_version": "f2132e96ae6c7a4e", "definition_digest": null, "required_operations": ["pca_fit"], "support_state": "supported", "source_hashes": {"dsl_catalogue": "f2132e96ae6c7a4e"}, "confidence": 0.8, "evidence": ["PCA"], "order_basis": "consumes_earlier_output", "id": "assay:4"}]}