Identification and validation of pivotal genes related to age-related meniscus degeneration based on gene expression profiling analysis and in vivo and in vitro models detection.

{"sci_version": "1.2", "schema": "https://corpus.bntrg.co.uk/sci/1.0/sci.schema.json", "id": "pmid:34587952", "kind": "science-record", "revision": 7, "content_hash": "sha256:37750a347a109033c1ebb045c454f7ba51eef2081da9aa3814af46d5e00e9b27", "created_at": "2026-11-01T15:41:54Z", "updated_at": "2026-11-01T22:04:51Z", "generator": {"name": "corpus-assay-engine", "run_id": "reading-sci-2026-11-01"}, "paper": {"state": "complete", "title": "Identification and validation of pivotal genes related to age-related meniscus degeneration based on gene expression profiling analysis and in vivo and in vitro models detection.", "doi": "10.1186/s12920-021-01088-6", "pmid": "34587952", "authors": ["Ming Chen", "Siqi Zhou", "Huasong Shi", "Hanwen Gu", "Yinxian Wen", "Liaobin Chen"], "journal": "BMC medical genomics", "year": 2021, "abstract": "BACKGROUND: The componential and structural change in the meniscus with aging would increase the tissue vulnerability of the meniscus, which would induce meniscus tearing. Here, we investigated the molecular mechanism of age-related meniscus degeneration with gene expression profiling analysis, and validate pivotal genes in vivo and in vitro models.\nMETHODS: The GSE45233 dataset, including 6 elderly meniscus samples and 6 younger meniscus samples, was downloaded from the Gene Expression Omnibus (GEO) database. To screen the differential expression of mRNAs and identify the miRNAs targeting hub genes, we completed a series of bioinformatics analyses, including functional and pathway enrichment, protein-protein interaction network, hub genes screening, and construction of a lncRNA-miRNA-mRNA network. Furthermore, crucial genes were examined in human senescent menisci, mouse senescent meniscus tissues and mouse meniscus cells stimulated by IL-1β.\nRESULTS: In total, the most significant 4 hub genes (RRM2, AURKB, CDK1, and TIMP1) and 5 miRNAs (hsa-miR-6810-5p, hsa-miR-4676-5p, hsa-miR-6877-5p, hsa-miR-8085, and hsa-miR-6133) that regulated such 4 hub genes, were finally identified. Moreover, these hub genes were decreased in meniscus cells in vitro and meniscus tissues in vivo, which indicated that hub genes were related to meniscus senescence and could serve as potential biomarkers for age-related meniscus tearing.\nCONCLUSIONS: In short, the integrated analysis of gene expression profile, co-expression network, and models detection identified pivotal genes, which elucidated the possible molecular basis underlying the senescence meniscus and also provided prognosis clues for early-onset age-related meniscus tearing.", "claims": [{"id": "claim-method", "statement": "The expression levels of hub genes that were differentially expressed between young and aging tissues or cells were determined by implementing Student’s t-test with Prism 6.0 (GraphPad Software, USA), and the data of the experimental results were presented as mean ± standard error of mean (SEM).", "kind": "methodological", "target": null, "evidence": [{"asset": "source:pmid:34587952", "locator": "sections[16] \"Statistical analysis\" paragraph 2", "quote": "The expression levels of hub genes that were differentially expressed between young and aging tissues or cells were determined by implementing Student’s t-test with Prism 6.0 (GraphPad Software, USA), and the data of the experimental results were presented as mean ± standard error of mean (SEM)."}], "state": "complete"}, {"id": "claim-data-access", "statement": "The DNA and RNA sequencing data were downloaded from Genebank database through gene names RRM2 (Gene ID: 6241 and 20135), CDK1(Gene ID: 983 and 12534), AURKB (Gene ID: 9212 and 20877), and TIMP1(Gene ID: 7076 and 21857). Then, the microarray data used in this study could be obtained through GEO ticket number GSE45233 in the GEO database (https://www.ncbi.nlm.nih.gov/gds/?term=GSE45233/).", "kind": "methodological", "target": null, "evidence": [{"asset": "source:pmid:34587952", "locator": "sections[28] \"Availability of data and materials\" paragraph 2", "quote": "The DNA and RNA sequencing data were downloaded from Genebank database through gene names RRM2 (Gene ID: 6241 and 20135), CDK1(Gene ID: 983 and 12534), AURKB (Gene ID: 9212 and 20877), and TIMP1(Gene ID: 7076 and 21857). Then, the microarray data used in this study could be obtained through GEO ticket number GSE45233 in the GEO database (https://www.ncbi.nlm.nih.gov/gds/?term=GSE45233/)."}], "state": "complete"}], "gaps": []}, "experiment": {"state": "complete", "objective": null, "steps": [{"id": "read_published_estimate", "order": 1, "name": "Read the published estimate from the source", "kind": "other", "state": "complete", "blocked_on": null, "description": "The claim, method and evidence span published with the source article.", "duration_hours": null, "parameters": {}, "inputs": ["source:pmid:34587952"], "outputs": ["the published estimate and its evidence"], "instruments": [], "reagents": []}, {"id": "obtain_source_data", "order": 2, "name": "Obtain the source data from the named repository", "kind": "data-preparation", "state": "complete", "blocked_on": null, "description": "The GEO series accession resolves and its sample accessions are listed. This lane did not download the dataset or read its licence.", "duration_hours": null, "parameters": {}, "inputs": ["data:geo:GSE45233"], "outputs": ["the source data with its repository provenance"], "instruments": [], "reagents": []}, {"id": "run_analysis", "order": 3, "name": "Run the published analysis", "kind": "analysis", "state": "complete", "blocked_on": null, "description": "Apply the paper's statistical method to the resolved series and compare the result with the published target.", "duration_hours": null, "parameters": {}, "inputs": ["data:geo:GSE45233"], "outputs": ["the replicated result and its comparison"], "instruments": [], "reagents": []}], "materials": [], "instruments": [], "reagents": [], "conditions": {}, "gaps": []}, "data": {"state": "partial", "assets": [{"id": "source:pmid:34587952", "role": "manuscript", "format": "xml", "media_type": "application/xml", "uri": "https://doi.org/10.1186/s12920-021-01088-6", "sha256": "sha256:0db4cb1f904a874a3842326fa6dbfddb4ef46471facde934080b73ce06d2b83c", "bytes": 43896, "access": "open", "state": "resolved", "reader": null, "reader_status": "reader_required", "identifier": "10.1186/s12920-021-01088-6", "version": null, "note": "Full article fetched from PMC; the checksum covers the rendered section body, not the original XML bytes.", "structure": {"pmcid": "PMC8482591", "source": "europe_pmc_fulltext", "coverage": "whole_body", "text_hash_scope": "rendered_section_body"}}, {"id": "data:geo:GSE45233", "role": "raw", "format": "geo-series", "media_type": "application/vnd.ncbi.geo-series+json", "uri": "https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE45233", "sha256": null, "bytes": null, "access": "open", "state": "resolved", "reader": null, "reader_status": "reader_required", "identifier": "GSE45233", "version": null, "note": "The DNA and RNA sequencing data were downloaded from Genebank database through gene names RRM2 (Gene ID: 6241 and 20135), CDK1(Gene ID: 983 and 12534), AURKB (Gene ID: 9212 and 20877), and TIMP1(Gene ID: 7076 and 21857). Then, the microarray data used in this study could be obtained through GEO ticket number GSE45233 in the GEO database (https://www.ncbi.nlm.nih.gov/gds/?term=GSE45233/).", "structure": {"repository": "GEO", "access_route": "GEO accession URL", "access_statement_verbatim": "The DNA and RNA sequencing data were downloaded from Genebank database through gene names RRM2 (Gene ID: 6241 and 20135), CDK1(Gene ID: 983 and 12534), AURKB (Gene ID: 9212 and 20877), and TIMP1(Gene ID: 7076 and 21857). Then, the microarray data used in this study could be obtained through GEO ticket number GSE45233 in the GEO database (https://www.ncbi.nlm.nih.gov/gds/?term=GSE45233/).", "access_statement_kind": "data_availability_statement", "sample_accessions": ["GSM1099551", "GSM1099552", "GSM1099553", "GSM1099554", "GSM1099555", "GSM1099556", "GSM1099557", "GSM1099558", "GSM1099559", "GSM1099560", "GSM1099561", "GSM1099562"], "sample_count": 12, "group_sizes": null, "group_sizes_basis": null, "platform": "10558", "taxon": "Homo sapiens", "title": "Transcriptome Analysis of Human Injured Meniscus Reveals a Distinct Phenotype of Meniscus Degeneration with Aging", "resolution_checked_at": "2026-11-01T15:39:54Z", "resolution_check": "identifier_resolution_only_no_download_no_licence_read", "downloaded": false, "licence_read": false}}, {"id": "asset:table:pmid:34587952:1", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:9308372f4ed28a48883226c9069e53ff481a38118fe40aef845203e5ce55f66e", "bytes": 894, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[15]/table-wrap[1]#Tab1", "version": null, "note": "The primer sequences of genes in this experiment", "structure": {"pmcid": "PMC8482591", "section_index": 15, "section_title": "qRT-PCR confirmation of the hub genes", "row_count": 11, "column_count": 4}, "table": {"label": "Table 1", "caption": "The primer sequences of genes in this experiment", "rows": [["Target genes", "Species", "Forward primer", "Reverse primer"], ["RRM2", "Homo", "GTTTGTGGCAGACAGACTTA", "TCACTCCCATCCTCTGATAC"], ["RRM2", "Mouse", "TAGGCGAGTATCAGAGGATG", "GTGTAGCCAGTTGGTTGTT"], ["AURKB", "Homo", "CCAGAAGGTGATGGAGAATAG", "CCCATGGCAGTACATTAGAG"], ["AURKB", "Mouse", "CTACAAGGAACTGCAGAAGAG", "CAGGTTCTCCGGCTTTATG"], ["CDK1", "Homo", "GTCAGCTCGTTACTCAACTC", "CTTCTGGCCACACTTCATTA"], ["CDK1", "Mouse", "CATGGTCAGAGGTAGGTTAGA", "CTAAGCAGCACAGCGATAC"], ["TIMP1", "Homo", "CCACCTTATACCAGCGTTATG", "CAGGTAGTGATGTGCAAGAG"], ["TIMP1", "Mouse", "GGCATCCTCTTGTTGCTATC", "GGTGGTCTCGTTGATTTCTG"], ["GAPDH", "Homo", "GAAGGTGAAGGTCGGAGTC", "GAAGATGGTGATGGGATTTC"], ["GAPDH", "Mouse", "AGGTCGGTGTGAACGGATTTG", "TGTAGACCATGTAGTTGAGGTCA"]], "row_count": 11, "column_count": 4, "numeric_cells": 0, "header_rows": 1, "locator": "section[15]/table-wrap[1]#Tab1"}}, {"id": "asset:table:pmid:34587952:2", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:e56a8b8b86f257ce02840f591111f0cabe3d143768f1cbb22080fcfc2a95f7f8", "bytes": 658, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[21]/table-wrap[1]#Tab2", "version": null, "note": "Information of the 5 miRNAs most relevant to the common hub genes", "structure": {"pmcid": "PMC8482591", "section_index": 21, "section_title": "Construction of a lncRNA–miRNA–mRNA network", "row_count": 6, "column_count": 6}, "table": {"label": "Table 2", "caption": "Information of the 5 miRNAs most relevant to the common hub genes", "rows": [["", "Target genes", "Position", "Energy", "Binding region length", "P-value"], ["hsa-miR-6810-5p", "RRM2,CDK1,TIMP1", "3UTR", "− 24.1", "29", "0.01664477"], ["hsa-miR-4676-5p", "RRM2,CDK1,TIMP1", "3UTR", "− 22.9", "18", "0.007139029"], ["hsa-miR-6877-5p", "RRM2,CDK1,TIMP1", "3UTR", "− 21.8", "24", "0.000873123"], ["hsa-miR-8085", "RRM2,CDK1,TIMP1", "3UTR", "− 22.6", "25", "0.006883728"], ["hsa-miR-6133", "RRM2,AURKB,TIMP1", "3UTR", "− 22.4", "17", "0.001472693"]], "row_count": 6, "column_count": 6, "numeric_cells": 25, "header_rows": 1, "locator": "section[21]/table-wrap[1]#Tab2"}}], "gaps": ["asset:data:geo:GSE45233 not downloaded", "asset:data:geo:GSE45233 licence not read"]}, "analysis": {"state": "partial", "methods": [{"id": "method-1", "family": "differential_expression", "specific": "limma_voom", "label": "Differential expression analysis", "dsl_operations": ["normalise_counts", "differential_expression_fit", "fdr_bh"], "missing_operations": [], "expressible": true, "parameters": {}, "data_shapes": ["count_matrix_with_condition"], "evidence": {"score": 0.8, "band": "high", "quote": "Limma"}}, {"id": "method-2", "family": "network_analysis", "specific": "ppi_network", "label": "Network / pathway analysis", "dsl_operations": ["build_graph", "centrality_scores", "pathway_enrich"], "missing_operations": [], "expressible": true, "parameters": {}, "data_shapes": ["edge_list"], "evidence": {"score": 0.7, "band": "medium", "quote": "protein-protein interaction"}}, {"id": "method-3", "family": "network_analysis", "specific": "pathway_enrichment", "label": "Network / pathway analysis", "dsl_operations": ["pathway_enrich"], "missing_operations": [], "expressible": true, "parameters": {}, "data_shapes": ["edge_list"], "evidence": {"score": 0.7, "band": "medium", "quote": "pathway enrichment"}}, {"id": "method-4", "family": "network_analysis", "specific": "centrality", "label": "Network / pathway analysis", "dsl_operations": ["build_graph", "centrality_scores", "pathway_enrich"], "missing_operations": [], "expressible": true, "parameters": {}, "data_shapes": ["edge_list"], "evidence": {"score": 0.8, "band": "high", "quote": "Centrality"}}, {"id": "method-5", "family": null, "specific": null, "label": "Student’s t-test", "dsl_operations": [], "missing_operations": [], "expressible": null, "parameters": {}, "data_shapes": [], "evidence": {"score": 1.0, "band": "verbatim", "quote": "The expression levels of hub genes that were differentially expressed between young and aging tissues or cells were determined by implementing Student’s t-test with Prism 6.0 (GraphPad Software, USA), and the data of the experimental results were presented as mean ± standard error of mean (SEM)."}}], "targets": [], "gaps": ["method.reader_named_unmapped"]}, "capability": {"state": "complete", "requirements": [{"capability_id": "capability:computational_analysis", "label": "Computational analysis platform", "assay_families": ["meta_analysis", "machine_learning", "survival_analysis", "statistical_regression", "pca", "molecular_docking", "network_analysis", "differential_expression", "gwas"], "availability_state": "owned", "tier_unlocked": "R1", "candidate": "Automated Assays Laravel application and simulated adapters"}], "gaps": []}, "readiness": {"state": "complete", "tier": "R1", "blocking_axis": "none", "blocked_on": "nothing:replicable_now", "axes": {"method": {"tier": "R1", "expressible": true, "required_operations": ["normalise_counts", "differential_expression_fit", "fdr_bh"], "missing_operations": [], "basis": "The paper names the method it used and the corpus's method extractor maps it onto the DSL catalogue: limma_voom."}, "capability": {"tier": "R1", "capability_id": "capability:computational_analysis", "availability_state": "owned", "basis": "The computational analysis is owned. The physical bench the paper used is not, so a physical validation cannot be run here."}, "data": {"tier": "R1", "reachable": true, "accessions": ["GSE45233"], "resolved_accessions": ["GSE45233"], "statements": ["The DNA and RNA sequencing data were downloaded from Genebank database through gene names RRM2 (Gene ID: 6241 and 20135), CDK1(Gene ID: 983 and 12534), AURKB (Gene ID: 9212 and 20877), and TIMP1(Gene ID: 7076 and 21857). Then, the microarray data used in this study could be obtained through GEO ticket number GSE45233 in the GEO database (https://www.ncbi.nlm.nih.gov/gds/?term=GSE45233/)."], "basis": "The paper names GSE45233 in Gene Expression Omnibus (GEO) and the accession resolves in the repository. No dataset was downloaded and no licence was read."}}, "can_run": {"dsl_operations": ["normalise_counts", "differential_expression_fit", "fdr_bh"], "assets": ["source:pmid:34587952", "data:geo:GSE45233", "asset:table:pmid:34587952:1", "asset:table:pmid:34587952:2"], "steps": ["run_analysis"]}, "must_build": {"dsl_operations": [], "converters": [], "readers": [], "capabilities": [], "data_gaps": ["data:geo:GSE45233"]}, "gaps": []}, "review": {"state": "partial", "machine_critique": {"kind": "extraction_review", "reader": {"model": "MiniMax-M3.1-Flash", "provider": "minimax", "provider_family": "minimax", "read_at": "2026-10-31T18:35:18Z", "independence": "single_reader"}, "evidence_check": {"method": "verbatim", "availability": "verbatim"}, "calls": 3, "usage": {"prompt_tokens": 36263, "completion_tokens": 1263, "cached_tokens": 792}}, "human_critique": null, "stages": [{"id": "extraction", "state": "complete", "reader": "MiniMax-M3.1-Flash", "provider": "minimax"}], "gaps": ["review.independent_reader", "review.machine_critique", "review.human_critique"]}, "execution": {"state": "absent", "status": "not_run", "mode": null, "runs": [], "gaps": ["execution.not_run"]}, "provenance": {"entities": [{"id": "pmid:34587952", "type": "paper", "label": "pmid:34587952"}, {"id": "source:pmid:34587952", "type": "manuscript", "label": "PMID 34587952 full text"}, {"id": "data:geo:GSE45233", "type": "dataset", "label": "GEO GSE45233"}], "activities": [{"id": "activity-reading-sci-2026-11-01", "type": "classification", "used": [{"id": "pmid:34587952", "type": "paper", "label": "pmid:34587952"}, {"id": "source:pmid:34587952", "type": "manuscript", "label": "PMID 34587952 full text"}, {"id": "data:geo:GSE45233", "type": "dataset", "label": "GEO GSE45233"}], "agent": "agent:corpus-assay-engine"}, {"id": "activity-read-34587952", "type": "extraction", "used": ["source:pmid:34587952"], "agent": "agent:minimax-reader"}, {"id": "activity-resolve-GSE45233", "type": "accession_resolution", "used": ["data:geo:GSE45233"], "agent": "agent:corpus-assay-engine"}], "agents": [{"id": "agent:corpus-assay-engine", "type": "software", "label": "Corpus assay engine"}, {"id": "agent:minimax-reader", "type": "software", "label": "MiniMax literature reader"}], "source_run_id": "reading-sci-2026-11-01", "dsl_catalogue_fingerprint": "343fb30756ba6ec3", "capability_table_fingerprint": "2cb3e42f047d2ecf", "snapshot_id": "ba34b49490d9bfaf"}, "lineage": {"parent_id": "pmid:34587952", "parent_hash": "sha256:437c0573412cce92a2c2da9b1c022f2abf3f075bd42bae25f7de3bcdc55b8765", "fork_of": null, "generation": 6}, "gaps": ["asset:data:geo:GSE45233 licence not read", "asset:data:geo:GSE45233 not downloaded", "execution.not_run", "method.reader_named_unmapped", "review.human_critique", "review.independent_reader", "review.machine_critique"], "assays": [{"role": "data_generation", "definition_id": "animal_model", "definition_version": "99e1195c7d6f", "definition_digest": null, "required_operations": [], "support_state": "partial", "source_hashes": {"assay_lexicon": "99e1195c7d6f"}, "confidence": 0.99, "evidence": ["ed on gene expression profiling analysis and in vivo and in vitro models detection.", "ofiling analysis, and validate pivotal genes in vivo and in vitro models. METHODS: The GSE45233 d", "meniscus cells in vitro and meniscus tissues in vivo, which indicated that hub genes were related", "es were examined in human senescent menisci, mouse senescent meniscus tissues and mouse meniscu"], "order_basis": "paper_text_order:95", "id": "assay:1"}, {"role": "data_generation", "definition_id": "rna_seq", "definition_version": "99e1195c7d6f", "definition_digest": null, "required_operations": [], "support_state": "partial", "source_hashes": {"assay_lexicon": "99e1195c7d6f"}, "confidence": 0.93, "evidence": ["ailability of data and materials The DNA and RNA sequencing data were downloaded from Genebank database"], "order_basis": "paper_text_order:5028", "id": "assay:2"}, {"role": "data_generation", "definition_id": "microarray", "definition_version": "99e1195c7d6f", "definition_digest": null, "required_operations": [], "support_state": "partial", "source_hashes": {"assay_lexicon": "99e1195c7d6f"}, "confidence": 0.93, "evidence": ["nd TIMP1(Gene ID: 7076 and 21857). Then, the microarray data used in this study could be obtained th"], "order_basis": "paper_text_order:5247", "id": "assay:3"}, {"role": "analysis", "definition_id": "differential_expression", "definition_version": "f2132e96ae6c7a4e", "definition_digest": null, "required_operations": ["normalise_counts", "differential_expression_fit", "fdr_bh"], "support_state": "supported", "source_hashes": {"dsl_catalogue": "f2132e96ae6c7a4e"}, "confidence": 0.8, "evidence": ["Limma"], "order_basis": "consumes_earlier_output", "id": "assay:4"}]}