Identification of Three Potential circRNA Biomarkers of Polycystic Ovary Syndrome by Bioinformatics Analysis and Validation.

{"sci_version": "1.2", "schema": "https://corpus.bntrg.co.uk/sci/1.0/sci.schema.json", "id": "pmid:34588800", "kind": "science-record", "revision": 8, "content_hash": "sha256:3cc72a57efc3f78375807e5002a57343834550b87db03dcf999dd6d7ccce4a70", "created_at": "2026-11-01T15:41:54Z", "updated_at": "2026-11-01T22:47:37Z", "generator": {"name": "corpus-assay-engine", "run_id": "reading-sci-2026-11-01"}, "paper": {"state": "complete", "title": "Identification of Three Potential circRNA Biomarkers of Polycystic Ovary Syndrome by Bioinformatics Analysis and Validation.", "doi": "10.2147/IJGM.S324126", "pmid": "34588800", "authors": ["Pengyu Huang", "Shengrong Du", "Yunhong Lin", "Zhiqing Huang", "Haiyan Li", "Gangxin Chen", "Suzhu Chen", "Qingfen Chen", "Lincui Da", "Hang Shi", "Wei Wei", "Lei Yang", "Yan Sun", "Beihong Zheng"], "journal": "International journal of general medicine", "year": 2021, "abstract": "OBJECTIVE: It is well known that circRNAs are closely involved in the progression of various diseases. However, their functions and potential regulatory mechanisms in polycystic ovary syndrome (PCOS) remain largely unknown. In the present study, our aim was to investigate the potential diagnostic value of circRNAs in PCOS.\nMETHODS: The circRNA dataset GSE145296, mRNA dataset GSE155489 and miRNA GSE138572 were downloaded from Gene Expression Omnibus (GEO) database. Then, differentially expressed genes (DEGs) were identified. Based on the potential interactions, a network of cirRNA-related competing endogenous RNAs (ceRNAs) was constructed. Biological functions were predicted by Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway enrichment analyses. For further validation, qRT-PCR method was used to detect the expression level of the candidate circRNAs. Then, receiver operating characteristics (ROC) were constructed to evaluate the diagnostic value of the three differentially expressed circRNA (DE-circRNA).\nRESULTS: We constructed a network of cirRNA-related ceRNA network. Hsa_circ_0075691, hsa_circ_0075692 and hsa_circ_0085997 were validate to be dysregulated in PCOS.\nCONCLUSION: Hsa_circ_0075691, hsa_circ_0075692 and hsa_circ_0085997 may be potential diagnostic biomarkers of PCOS, but their specific regulatory mechanisms still need to be further studied.", "claims": [{"id": "claim-method", "statement": "The differentially expressed circRNAs, mRNAs and miRNAs were screened by Limma package, with a threshold of |log2(fold change) [FC]| > 0.58 and P-value < 0.05.", "kind": "methodological", "target": null, "evidence": [{"asset": "source:pmid:34588800", "locator": "sections[4] \"Data Sets Collection and Differential Expression Analysis\" paragraph 2", "quote": "The differentially expressed circRNAs, mRNAs and miRNAs were screened by Limma package, with a threshold of |log2(fold change) [FC]| > 0.58 and P-value < 0.05."}], "state": "complete"}, {"id": "claim-data-access", "statement": "All datasets generated for this study are included in the article materials.", "kind": "methodological", "target": null, "evidence": [{"asset": "source:pmid:34588800", "locator": "sections[17] \"Data Sharing Statement\" paragraph 2", "quote": "All datasets generated for this study are included in the article materials."}], "state": "complete"}], "gaps": []}, "experiment": {"state": "partial", "objective": null, "steps": [{"id": "read_published_estimate", "order": 1, "name": "Read the published estimate from the source", "kind": "other", "state": "complete", "blocked_on": null, "description": "The claim, method and evidence span published with the source article.", "duration_hours": null, "parameters": {}, "inputs": ["source:pmid:34588800"], "outputs": ["the published estimate and its evidence"], "instruments": [], "reagents": []}, {"id": "obtain_source_data", "order": 2, "name": "Obtain the source data from the named repository", "kind": "data-preparation", "state": "blocked", "blocked_on": "data:accession_absent", "description": "The GEO series accession resolves and its sample accessions are listed. This lane did not download the dataset or read its licence.", "duration_hours": null, "parameters": {}, "inputs": [], "outputs": ["the source data with its repository provenance"], "instruments": [], "reagents": []}, {"id": "run_analysis", "order": 3, "name": "Run the published analysis", "kind": "analysis", "state": "complete", "blocked_on": null, "description": "Apply the paper's statistical method to the resolved series and compare the result with the published target.", "duration_hours": null, "parameters": {}, "inputs": [], "outputs": ["the replicated result and its comparison"], "instruments": [], "reagents": []}], "materials": [], "instruments": [], "reagents": [], "conditions": {}, "gaps": ["step:obtain_source_data blocked on data:accession_absent"]}, "data": {"state": "partial", "assets": [{"id": "source:pmid:34588800", "role": "manuscript", "format": "xml", "media_type": "application/xml", "uri": "https://doi.org/10.2147/IJGM.S324126", "sha256": "sha256:e033d81262435d87a7cb463af6bfcd56edd44eb18693ccce1f75ea7feef2d481", "bytes": 30560, "access": "open", "state": "resolved", "reader": null, "reader_status": "reader_required", "identifier": "10.2147/IJGM.S324126", "version": null, "note": "Full article fetched from PMC; the checksum covers the rendered section body, not the original XML bytes.", "structure": {"pmcid": "PMC8473987", "source": "europe_pmc_fulltext", "coverage": "whole_body", "text_hash_scope": "rendered_section_body"}}, {"id": "asset:table:pmid:34588800:1", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:3f46250f50d7b11d90d2e42e01c69a7fa809f5326a4fe9e10b5997eb9c5f134d", "bytes": 507, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[7]/table-wrap[1]#t0001", "version": null, "note": "Specific RNAs Primers for qRT-PCR Analysis", "structure": {"pmcid": "PMC8473987", "section_index": 7, "section_title": "Validation with qRT- PCR Method", "row_count": 9, "column_count": 2}, "table": {"label": "Table 1", "caption": "Specific RNAs Primers for qRT-PCR Analysis", "rows": [["Gene Name", "Sequence (5ʹ-3ʹ)"], ["GAPDH", "F:AAGAAGGTGGTGAAGCAGGC"], ["R:TCAAAGGTGGAGGAGTGGGT"], ["has_circ_0075961", "F:CCGCCTTTTGCGGTCTGG"], ["R:AGTGCAGGGTCCGAGGTATT"], ["has_circ_0075962", "F:CATTGTCTGCCCGCATGCCT"], ["R:AGTGCAGGGTCCGAGGTATT"], ["has_circ_0085997", "F:CCGCGCTAGCACCATCTGAAAT"], ["R:AGTGCAGGGTCCGAGGTATT"]], "row_count": 9, "column_count": 2, "numeric_cells": 4, "header_rows": 1, "locator": "section[7]/table-wrap[1]#t0001"}}, {"id": "asset:table:pmid:34588800:2", "role": "table", "format": "jats-table", "media_type": "application/vnd.jats.table+json", "uri": null, "sha256": "sha256:597017088ab923a80e6e7a42db35433e47456737ffd8899729812e7b7cb9b21d", "bytes": 470, "access": "open", "state": "verified", "reader": "read_table", "reader_status": "available", "identifier": "section[12]/table-wrap[1]#t0002", "version": null, "note": "Basic Characteristics of the Candidate circRNAs", "structure": {"pmcid": "PMC8473987", "section_index": 12, "section_title": "A circRNA-miRNA-mRNA Regulatory Network of PCOS", "row_count": 4, "column_count": 6}, "table": {"label": "Table 2", "caption": "Basic Characteristics of the Candidate circRNAs", "rows": [["circRNA ID", "Position Strand", "Genomic Length", "Best Transcript", "Gene Symbol", "Regulation"], ["hsa_circ_0075691", "–", "99,936", "NM_000332", "ATXN1", "Up"], ["hsa_circ_0075692", "–", "238,864", "NM_000332", "ATXN1", "Up"], ["hsa_circ_0085997", "–", "2335", "None", "None", "Down"]], "row_count": 4, "column_count": 6, "numeric_cells": 8, "header_rows": 1, "locator": "section[12]/table-wrap[1]#t0002"}}], "gaps": []}, "analysis": {"state": "complete", "methods": [{"id": "method-1", "family": "differential_expression", "specific": "limma_voom", "label": "Differential expression analysis", "dsl_operations": ["normalise_counts", "differential_expression_fit", "fdr_bh"], "missing_operations": [], "expressible": true, "parameters": {}, "data_shapes": ["count_matrix_with_condition"], "evidence": {"score": 1.0, "band": "verbatim", "quote": "The differentially expressed circRNAs, mRNAs and miRNAs were screened by Limma package, with a threshold of |log2(fold change) [FC]| > 0.58 and P-value < 0.05."}}, {"id": "method-2", "family": "network_analysis", "specific": "pathway_enrichment", "label": "Network / pathway analysis", "dsl_operations": ["pathway_enrich"], "missing_operations": [], "expressible": true, "parameters": {}, "data_shapes": ["edge_list"], "evidence": {"score": 0.7, "band": "medium", "quote": "pathway enrichment"}}], "targets": [], "gaps": []}, "capability": {"state": "complete", "requirements": [{"capability_id": "capability:computational_analysis", "label": "Computational analysis platform", "assay_families": ["meta_analysis", "machine_learning", "survival_analysis", "statistical_regression", "pca", "molecular_docking", "network_analysis", "differential_expression", "gwas"], "availability_state": "owned", "tier_unlocked": "R1", "candidate": "Automated Assays Laravel application and simulated adapters"}], "gaps": []}, "readiness": {"state": "blocked", "tier": "R4", "blocking_axis": "data", "blocked_on": "data:accession_absent", "axes": {"method": {"tier": "R1", "expressible": true, "required_operations": ["normalise_counts", "differential_expression_fit", "fdr_bh"], "missing_operations": [], "basis": "The paper names the method it used and the corpus's method extractor maps it onto the DSL catalogue: limma_voom."}, "capability": {"tier": "R1", "capability_id": "capability:computational_analysis", "availability_state": "owned", "basis": "The computational analysis is owned. The physical bench the paper used is not, so a physical validation cannot be run here."}, "data": {"tier": "R4", "reachable": false, "accessions": [], "resolved_accessions": [], "statements": ["All datasets generated for this study are included in the article materials."], "basis": "The paper names no accession to its source data, so the data has to come from the authors."}}, "can_run": {"dsl_operations": ["normalise_counts", "differential_expression_fit", "fdr_bh"], "assets": ["source:pmid:34588800", "asset:table:pmid:34588800:1", "asset:table:pmid:34588800:2"], "steps": ["run_analysis"]}, "must_build": {"dsl_operations": [], "converters": [], "readers": [], "capabilities": [], "data_gaps": ["data:geo:None"]}, "gaps": ["data:accession_absent"]}, "review": {"state": "partial", "machine_critique": {"kind": "extraction_review", "reader": {"model": "MiniMax-M3.1-Flash", "provider": "minimax", "provider_family": "minimax", "read_at": "2026-10-31T19:50:51Z", "independence": "single_reader"}, "evidence_check": {"method": "verbatim", "availability": "verbatim"}, "calls": 3, "usage": {"prompt_tokens": 25466, "completion_tokens": 1084, "cached_tokens": 777}}, "human_critique": null, "stages": [{"id": "extraction", "state": "complete", "reader": "MiniMax-M3.1-Flash", "provider": "minimax"}], "gaps": ["review.independent_reader", "review.machine_critique", "review.human_critique"]}, "execution": {"state": "absent", "status": "not_run", "mode": null, "runs": [], "gaps": ["execution.not_run"]}, "provenance": {"entities": [{"id": "pmid:34588800", "type": "paper", "label": "pmid:34588800"}, {"id": "source:pmid:34588800", "type": "manuscript", "label": "PMID 34588800 full text"}, {"id": "data:geo:None", "type": "dataset", "label": "GEO None"}], "activities": [{"id": "activity-reading-sci-2026-11-01", "type": "classification", "used": [{"id": "pmid:34588800", "type": "paper", "label": "pmid:34588800"}, {"id": "source:pmid:34588800", "type": "manuscript", "label": "PMID 34588800 full text"}, {"id": "data:geo:None", "type": "dataset", "label": "GEO None"}], "agent": "agent:corpus-assay-engine"}, {"id": "activity-read-34588800", "type": "extraction", "used": ["source:pmid:34588800"], "agent": "agent:minimax-reader"}, {"id": "activity-resolve-None", "type": "accession_resolution", "used": ["data:geo:None"], "agent": "agent:corpus-assay-engine"}], "agents": [{"id": "agent:corpus-assay-engine", "type": "software", "label": "Corpus assay engine"}, {"id": "agent:minimax-reader", "type": "software", "label": "MiniMax literature reader"}], "source_run_id": "reading-sci-2026-11-01", "dsl_catalogue_fingerprint": "343fb30756ba6ec3", "capability_table_fingerprint": "2cb3e42f047d2ecf", "snapshot_id": "ba34b49490d9bfaf"}, "lineage": {"parent_id": "pmid:34588800", "parent_hash": "sha256:3f9d67fd7db6ef7864c4cdc433e5dc0d2448e4ce53c1cfa1415dc0c321f46691", "fork_of": null, "generation": 7}, "gaps": ["execution.not_run", "review.human_critique", "review.independent_reader", "review.machine_critique", "step:obtain_source_data blocked on data:accession_absent"], "assays": [{"role": "analysis", "definition_id": "differential_expression", "definition_version": "f2132e96ae6c7a4e", "definition_digest": null, "required_operations": ["normalise_counts", "differential_expression_fit", "fdr_bh"], "support_state": "supported", "source_hashes": {"dsl_catalogue": "f2132e96ae6c7a4e"}, "confidence": 1.0, "evidence": ["The differentially expressed circRNAs, mRNAs and miRNAs were screened by Limma package, with a threshold of |log2(fold change) [FC]| > 0.58 and P-value < 0.05."], "order_basis": "analysis_only", "id": "assay:1"}]}